Swine erysipelothrix antigen recombinant protein nfliC-SpaA as well as product and application thereof

Abstract

The invention relates to the field of veterinary drugs, in particular to a swine erysipelothrix antigen recombinant protein nfliC-SpaA as well as a product and application of the swine erysipelothrix antigen recombinant protein nfliC-SpaA. The amino acid sequence of the swine erysipelothrix antigen recombinant protein nfliC-SpaA is as shown in SEQ ID NO.2. The protein can provide 100% protection for mice and piglets attacked by type 1 and type 2 strains.

Description

Technical Field

[0001] The present application relates to the field of veterinary drugs, and specifically to a recombinant protein nfliC-SpaA of Erysipelothrix rhusiopathiae antigen and its products and applications. Background Art

[0002] Swine erysipelas is an acute and febrile zoonotic infectious disease caused by Erysipelothrix rhusiopathiae. According to the length of the disease cycle, the clinical symptoms are mainly manifested as acute septicemia type, subacute papular type, chronic endocarditis and arthritis type, and the fatality rate can reach 80%. The disease is prevalent worldwide, causing great economic losses to the pig industry and threatening human health.

[0003] There are many serotypes of Erysipelothrix rhusiopathiae. According to the type of cell wall heat-stable antigen, Erysipelothrix rhusiopathiae can be divided into 16 serotypes, among which the strains of serotypes 1a, 1b and 2 have the strongest virulence. Strains of serotype 1a are mostly isolated from pigs with acute symptoms, and strains of serotype 2 are mostly isolated from pigs with chronic symptoms. The main prevalent serotypes are 1a and 2.

[0004] Commercialized swine erysipelas vaccines mainly include inactivated swine erysipelas vaccines (mainly type 2) and attenuated live vaccines (type 1 or 2). On the one hand, due to the obvious differences in the colony morphology and immunogenicity of Erysipelothrix rhusiopathiae cultured in different batches, the preparation difficulty of inactivated vaccines is increased. On the other hand, inactivated vaccines cause relatively large stress to pigs and have a short immune persistence period; while the effects of live vaccines are often interfered by maternal antibodies and drugs such as antibiotics, and there is a risk of reversion to virulence. Therefore, developing highly efficient and broad-spectrum genetic engineering subunit vaccines is the difficulty and key to preventing and controlling this disease.

[0005] In view of this, the present application is specifically proposed. Summary of the Invention

[0006] The first object of the present application is to provide a recombinant protein nfliC-SpaA of Erysipelothrix rhusiopathiae antigen.

[0007] The second object of the present application is to provide a nucleic acid encoding the recombinant protein nfliC-SpaA of antigen.

[0008] The third object of the present application is to provide an application of the recombinant protein nfliC-SpaA of antigen.

[0009] The fourth object of the present application is to provide a subunit vaccine of Erysipelothrix rhusiopathiae.

[0010] In order to achieve the above objects, the present application specifically adopts the following technical solutions:

[0011] A recombinant protein nfliC-SpaA of Erysipelothrix rhusiopathiae antigen, wherein the amino acid sequence of the recombinant protein nfliC-SpaA is shown in SEQ ID NO.2.

[0012] Biological materials related to the recombinant protein nfliC-SpaA of Erysipelothrix rhusiopathiae antigen, including:

[0013] (1) Nucleic acid encoding the recombinant protein nfliC-SpaA of Erysipelothrix rhusiopathiae antigen as claimed in claim 1;

[0014] (2) An expression cassette containing the nucleic acid in (1);

[0015] (3) A vector containing the nucleic acid in (1) or the expression cassette in (2);

[0016] A recombinant cell containing the nucleic acid in (1), the expression cassette in (2) or the vector in (3).

[0017] In some embodiments, the nucleotide sequence of the nucleic acid is shown in SEQ ID NO.1.

[0018] Use of the above-mentioned recombinant protein nfliC-SpaA of Erysipelothrix rhusiopathiae antigen in the preparation of a medicament for preventing Erysipelothrix rhusiopathiae infection.

[0019] In some embodiments, the medicament is a subunit vaccine of Erysipelothrix rhusiopathiae.

[0020] A subunit vaccine of Erysipelothrix rhusiopathiae, comprising a pharmaceutically acceptable carrier and an immunologically effective amount of the above-mentioned recombinant protein nfliC-SpaA of Erysipelothrix rhusiopathiae antigen.

[0021] In some embodiments, the content of the recombinant protein nfliC-SpaA is ≥50 μg / ml, preferably 50 - 250 μg / ml.

[0022] In some embodiments, the pharmaceutically acceptable carrier includes at least one of adjuvants, lyophilization protectants, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants and preservatives.

[0023] Preferably, the adjuvant includes one or more of aluminum hydroxide adjuvant, saponin, avridine, DDA, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS1314, muramyl dipeptide, Gel adjuvant.

[0024] In some embodiments, the concentration range of the adjuvant is from 5% V / V to 50% V / V, preferably 10% V / V.

[0025] In some embodiments, the lyoprotectant is selected from sugars, polyols, polymers, surfactants, salts, amines or amino acids.

[0026] Preferably, the immunostimulant includes alpha-interferon, beta-interferon, gamma-interferon, granulocyte macrophage colony-stimulating factor, macrophage colony-stimulating factor or interleukin-2.

[0027] Compared with the prior art, the technical effect of the present application is as follows:

[0028] By using bioinformatics software to analyze the domains and functional domains of the Erysipelothrix rhusiopathiae SpaA protein, in the present application, the nfliC protein with adjuvant and immune-enhancing effects is fused to the N-terminus of the protective antigen in the truncated form of the Erysipelothrix rhusiopathiae SpaA protein. After expression and purification, the antigen recombinant protein nfliC-SpaA is used to judge the immunogenicity through animal evaluation, and finally an antigen protein that can provide 100% protection for mice and piglets challenged with type 1 and type 2 strains is obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present application. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0030] Figure 1 It is the SDS-PAGE detection diagram of the expression of the antigen recombinant protein in Example 2. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The relevant terms in the present application are explained as follows:

[0032] The term "Erysipelothrix rhusiopathiae" refers to Erysipelothrix rhusiopathiae, also known as Erysipelothrix rhusiopathiae, a Gram-positive bacterium with a clear tendency to form filaments. It is a straight or slightly curved rod with a size of (0.2-0.4) μm × (0.8-2.5) μm. The morphology of the bacterium in sick pigs and culture media varies. The bacteria in the diseased material are arranged alone, in pairs or in clusters; they usually exist in clusters in white blood cells; in old broth cultures and in the endocardial warts of chronically sick pigs, they are mostly filamentous. The pathogen is non-motile and does not form spores and capsules. According to the type of cell wall heat-stable antigens, Erysipelothrix rhusiopathiae can be divided into 16 serotypes, of which 1a, 1b and 2 strains are the most virulent. Serotype 1a strains are mostly isolated from pigs with acute symptoms, and serotype 2 strains are mostly isolated from pigs with chronic symptoms. The main prevalent serotypes are mainly 1a and 2.

[0033] The term "antigen" refers to a substance that can induce an immune response in the body, that is, a substance that can be specifically recognized and bound by the antigen receptors (TCR / BCR) on the surface of T / B lymphocytes, activate T / B cells, cause them to proliferate and differentiate, produce immune response products (sensitized lymphocytes or antibodies), and can specifically bind to corresponding products in vivo and in vitro.

[0034] The term "SpaA" refers to the SpaA protein. The surface protective antigen A (SpaA) consists of an N-terminal immune protective region and a C-terminal cell binding region, and the gene encoding it is 1881 bp in size. The SpaA protein is the main immune protective antigen of Erysipelothrix rhizogenes and is present in almost all strains with strong virulence.

[0035] The term "nfliC" refers to the N-terminal 99aa of the flagellin protein (FliC) of Salmonella typhimurium. FliC is the main structural protein of bacterial flagella, and when recognized by Toll-like receptor 5 (TLR5) or NOD-like receptor (NLRC4), FliC activates NF-Kβ and initiates an inflammatory immune response, leading to adaptive immunity.

[0036] The present application provides a recombinant protein nfliC-SpaA of Erysipelothrix rhizogenes antigen, and the amino acid sequence of the recombinant protein nfliC-SpaA is shown in SEQ ID NO.2.

[0037] This application provides biomaterials related to the above-mentioned protein, such as nucleic acids encoding the above-mentioned protein, vectors containing nucleic acid fragments (such as cloning plasmids and expression plasmids, etc.), and recombinant cells containing nucleic acid fragments. These biomaterials can be directly used as biological modules for the production of the antigen recombinant protein nfliC-SpaA in this application, and have the advantages of being fast and efficient. The nucleic acid fragment in this application can be obtained by primer amplification or by artificial synthesis. The nucleotide sequence encoding the nfliC-SpaA fusion protein is shown in SEQ ID NO.1.

[0038] The antigen recombinant protein nfliC-SpaA provided by this application can be used to prepare related products for preventing Erysipelothrix rhusiopathiae infection, such as vaccines for preventing infection, antibody detection reagents, and so on.

[0039] This application provides a subunit vaccine for Erysipelothrix rhusiopathiae. In addition to the active ingredient mainly being the antigen recombinant protein nfliC-SpaA provided by this application, it may also contain a pharmaceutically acceptable carrier, aiming to meet different requirements in actual applications such as production, transportation, dosage form, and administration method.

[0040] The term "vaccine" refers to a pharmaceutical composition containing the protein antigen of Erysipelothrix rhusiopathiae, and this pharmaceutical composition can induce, stimulate, or enhance the immune response of pigs to Erysipelothrix rhusiopathiae.

[0041] The term "immunogenic amount" should be understood as "immunologically effective amount", also known as immunoprotective amount or effective amount for generating an immune response, which is the amount of antigen that can effectively induce an immune response in the recipient, and this amount is sufficient to prevent or improve the signs or symptoms of the disease, including adverse health effects or their complications. The said immune response may be sufficient for diagnostic purposes or other tests, or may be suitable for preventing the signs or symptoms of the disease, including adverse health outcomes or their complications caused by infections by pathogens. Humoral immunity or cell-mediated immunity or both can be induced. The immune response of an animal to an immunogenic composition can be indirectly evaluated, for example, by measuring antibody titers, lymphocyte proliferation assays, or directly evaluated by monitoring signs or symptoms after challenge with a wild-type strain. The protective immunity provided by the vaccine can be evaluated by measuring, for example, the clinical signs of the subject such as reduction in mortality, morbidity, temperature values, the overall physiological condition of the subject, and overall health and performance. The said immune response may include, but is not limited to, inducing cellular and / or humoral immunity.

[0042] In some embodiments, the subunit vaccine contains an immunogenic amount of the antigen recombinant protein nfliC-SpaA, and the content of the antigen recombinant protein nfliC-SpaA is ≥ 50 μg / ml, preferably 50 - 250 μg / ml. For example, it can be but is not limited to 50 μg / ml, 55 μg / ml, 60 μg / ml, 65 μg / ml, 70 μg / ml, 75 μg / ml, 80 μg / ml, 85 μg / ml, 90 μg / ml, 95 μg / ml, 100 μg / ml, 105 μg / ml, 110 μg / ml, 115 μg / ml, 120 μg / ml, 125 μg / ml, 130 μg / ml, 135 μg / ml, 140 μg / ml, 145 μg / ml, 150 μg / ml, 155 μg / ml, 160 μg / ml, 165 μg / ml, 170 μg / ml, 175 μg / ml, 180 μg / ml, 185 μg / ml, 190 μg / ml, 195 μg / ml, 200 μg / ml, 205 μg / ml, 210 μg / ml, 215 μg / ml, 220 μg / ml, 225 μg / ml, 230 μg / ml, 235 μg / ml, 240 μg / ml, 245 μg / ml or 250 μg / ml.

[0043] In the present application, the antigen recombinant protein nfliC-SpaA of Erysipelothrix rhusiopathiae can be prepared by a prokaryotic expression system, or can also be prepared by a eukaryotic expression system, a cell expression system or a chemical synthesis method.

[0044] The term "pharmaceutically acceptable carrier" refers to all other components in the subunit vaccine of the present application except the subunit protein antigen of Erysipelothrix rhusiopathiae, a carrier or diluent that does not stimulate the body and does not hinder the biological activity and characteristics of the compound used, and is preferably an adjuvant.

[0045] The term "adjuvant" can include aluminum hydroxide adjuvant; saponins, such as Quil A, QS-21 (Cambridge Biotech Incorporation, Cambridge MA), GPI-0100 (Galenica Pharmaceuticals Incorporation, Birmingham AL); water-in-oil emulsions; oil-in-water emulsions; water-in-oil-in-water emulsions; polymers of acrylic acid or methacrylic acid; compounds selected from copolymers of maleic anhydride and alkenyl derivatives.

[0046] The term "emulsion" may in particular be based on light liquid paraffin oil (European Pharmacopea type); isoprenoid oils resulting from olefin oligomerization, such as squalane or squalene oil, in particular isobutene or decene; linear alkyl esters of acids or alcohols, more particularly vegetable oils, ethyl oleate, propylene glycol di-(caprylate / caprate), glyceryl tri-(caprylate / caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearates. The oil is used in combination with an emulsifier in order to form an emulsion. The emulsifier is preferably a non-ionic surfactant, in particular esters of sorbitan, esters of mannite (such as anhydrous mannitol oleate), esters of aliphatic glycols, esters of polyglycerol, esters of propylene glycol and esters of oleic acid, isostearic acid, ricinoleic acid or hydroxystearic acid, which are optionally ethoxylated, and also polyoxypropylene-polyoxyethylene block copolymers, in particular Pluronic products, especially L121. See "The theory and practical application of adjuvants" by Hunter et al. (Ed. by DES Stewart-Tull, John Wiley and Sons, New York, 1995: 51-94) and "Vaccine" by Todd et al. (1997, 15: 564-570). For example, the SPT emulsion described on page 147 of "Vaccine design, the Subunit and adiuvant approach" (Plenum Press, 1995) by Powell M and Newman M and the MF59 emulsion described on page 183 may be used.

[0047] The term "polymer of acrylic or methacrylic acid" is preferably a cross-linked polymer of acrylic or methacrylic acid, especially cross-linked with a polyalkenyl ether or polyol of sugar, and these compounds are known as Carbomer (trade name Carbopol) (Phameuropa, 1996, 8(2)). Those skilled in the art can also refer to US Patent US2909462, which describes such acrylic polymers cross-linked with polyhydroxylated compounds having at least 3 hydroxyl groups, preferably not more than 8, and in which at least 3 hydrogen atoms of the hydroxyl groups are replaced by an unsaturated aliphatic radical having at least 2 carbon atoms. Preferred groups are those containing 2-4 carbon atoms, such as vinyl, allyl, and other ethylenically unsaturated groups. The unsaturated groups themselves may contain other substituents, such as methyl. These products are sold under the name Carbopol (BF Goodrich, Ohio, USA) and are particularly suitable. They are cross-linked with allyl sucrose or allyl pentaerythritol. Among these, Carbopol 974P, 934P, and 971P can be mentioned, and Carbopol 971P is most preferably used.

[0048] The term "copolymer of maleic anhydride and alkenyl derivatives" also includes the copolymer of maleic anhydride and ethylene, EMA (Monsanto). These polymers dissolve in water to produce an acidic solution, which is preferably neutralized to physiological pH in order to produce an adjuvant solution into which an immunogenic, immunizing, or vaccine composition itself can be incorporated.

[0049] The term "adjuvant" also includes, but is not limited to, the RIBI adjuvant system (Ribi Incorporation), Block co-polymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin (recombinant or otherwise), cholera toxin, IMS 1314, muramyl dipeptide, Gel adjuvant, etc.

[0050] In a preferred embodiment, the adjuvant comprises one or more of mineral oil, aluminum hydroxide adjuvant, saponin, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS1314, muramyl dipeptide, Montanide ISA 206 or Gel adjuvant.

[0051] In some embodiments, the concentration range of the adjuvant is from 5% V / V to 50% V / V, preferably 10% V / V. The concentration range of the adjuvant can be, but is not limited to, 5% V / V, 10% V / V, 15% V / V, 20% V / V, 25% V / V, 30% V / V, 35% V / V, 40% V / V, 45% V / V or 50% V / V.

[0052] The term "lyoprotectant" refers to a component that, in addition to excipients, protects the drug efficacy of the active pharmaceutical ingredient during the freeze-drying process and storage after freeze-drying. The lyoprotectant can be selected from sugars, polyols, polymers, surfactants, salts, amines or amino acids.

[0053] In some embodiments, the immunostimulant comprises alpha-interferon, beta-interferon, gamma-interferon, granulocyte-macrophage colony-stimulating factor, macrophage colony-stimulating factor or interleukin-2.

[0054] The term "prevention" when referring to Erysipelothrix rhusiopathiae infection means inhibiting the replication of Erysipelothrix rhusiopathiae, inhibiting the spread of Erysipelothrix rhusiopathiae or preventing Erysipelothrix rhusiopathiae from colonizing in its host, and alleviating the symptoms of the disease or disorder caused by Erysipelothrix rhusiopathiae infection.

[0055] The present application will be further described below in conjunction with specific embodiments, and the advantages and features of the present application will become clearer as the description progresses. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of the present application. Those skilled in the art should understand that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, but such modifications and replacements all fall within the protection scope of the present application.

[0056] The chemical reagents used in the embodiments of the present application are all of analytical grade and are purchased from the National Pharmaceutical Group. The experimental methods described in the present application are all conventional methods unless otherwise specified; the biological materials, unless otherwise specified, can be obtained from commercial channels.

[0057] Example 1: Construction of the pET28a_SEr_nfliC-SpaA expression system

[0058] 1. Experimental materials

[0059] The plasmid extraction kit was purchased from Tiangen Biotech; T4 DNA Ligase was purchased from BioLab; NdeI and SalI restriction endonucleases, and pET28a plasmid were purchased from Novagen; the agarose gel DNA recovery kit was purchased from Tianze Biotech, and other reagents were all of analytical grade.

[0060] 2. Experimental procedures

[0061] 2.1 Extraction of Erysipelothrix rhusiopathiae DNA

[0062] According to the instructions of the virus DNA extraction kit, take 0.2 ml of the liver suspension infected with Erysipelothrix rhusiopathiae in a sterile 1.5 ml centrifuge tube, add 0.4 ml of VB to the sample solution, vortex and mix well, and let it stand at room temperature for 10 minutes. Add 0.45 ml of AD buffer to the sample solution and mix well by force. Place the VB column in a 2 ml collection tube, take 0.6 ml of the mixed solution and add it to the VB column, centrifuge at 14000g for 1 minute, add the remaining mixed solution to the VB column, centrifuge at 14000g for 1 minute, discard the 2 ml collection tube, place the VB column in a new 2 ml collection tube, add 0.4 ml of W1 buffer, centrifuge at 14000g for 30 seconds, add 0.6 ml of Wash buffer to the VB column, centrifuge at 14000g for 30 seconds, centrifuge without sample for 3 minutes, add 50 μl of RNase free water to the center of the membrane, let it stand for 3 minutes, and centrifuge at 14000g for 1 minute. The centrifuged liquid is the DNA genome.

[0063] 2.2 Sequencing of the spaA gene

[0064] Oligonucleotide primers were synthesized according to the conserved region sequences at the 5' and 3' ends of the spaA gene for sequencing. The sequencing primer sequences are as follows:

[0065] SpaA-F: ATGAAAAAGAAAAAACACCTAT;

[0066] SpaA-R: CTATTTTAAACTTCCATCGTTCTT;

[0067] The synthesized primers and spaA genomic DNA were sent to Invitrogen for sequencing, and the spaA gene was codon-optimized according to the sequencing results.

[0068] The codon-optimized spaA gene was fully synthesized by Genewiz (Suzhou) Inc. and ligated to the pUCGW plasmid.

[0069] 2.3 Construction of the nfliC-SpaA expression plasmid

[0070] After removing the signal peptide at the N-terminus and the repetitive sequence at the C-terminus of spaA by sequence analysis, nfliC-SpaA was obtained through overlap PCR technology (the specific primer information is shown in Table 1 below and the sequence information is as follows). It was ligated to the pET28a plasmid, and the ligated plasmid was transformed into Trans T1 competent cells. A single colony was picked and cultured in 5 mL of LB medium for 7 h, and then the plasmid was extracted. The extracted plasmid pET28a_SEr_nfliC-SpaA was digested with the restriction enzyme sites of NdeI and SalI. The appearance of an exogenous fragment with a size of 1662 bp and a vector fragment after digestion was the correct antigen recombinant plasmid. At the same time, it was sent to Genewiz (Suzhou) Inc. for sequencing analysis. The above positive plasmid was transformed into Escherichia coli BL21(DE3), and a single colony was picked and cultured overnight in LB medium containing 50 μg of kanamycin. The positive clone was the pET28a_SEr_nfliC-SpaA expression strain.

[0071] Table 1: Primer Design for Cloning the Antigen Protein Gene of the Present Application

[0072] The nucleotide sequence of the nucleic acid encoding the antigen recombinant protein nfliC-SpaA is as follows (1662 bp, SEQ ID NO.1):

[0073]

[0074] The amino acid sequence of the antigen recombinant protein nfliC-SpaA is as follows (SEQ ID NO.2):

[0075]

[0076] Example 2: Expression of the nfilC-SpaA Antigen Recombinant Protein

[0077] 1. Experimental Method

[0078] 1.1 Prepare LB medium containing 50 - 100 μg / ml of kanamycin.

[0079] 1.2 Inoculate the strain pET28a_SEr_nfliC-SpaA / E.Coli BL21(DE3) prepared in Example 1 into the medium, with an inoculation amount of 1% (V / V), and culture it with shaking at 37°C.

[0080] 1.3 When OD600 = 0.4 - 0.6, place it at 28°C for 30 minutes.

[0081] 1.4. Add isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.1 - 1.0 mM, and culture with shaking at 28 °C for 24 hours.

[0082] 1.5. After the culture, collect the cells, resuspend the cells with buffer (20 mM Tris, 0.5 M NaCl, pH 7.0), disrupt by sonication, and centrifuge to obtain the supernatant for SDS-PAGE analysis of protein expression.

[0083] 2. Experimental Results

[0084] A clear target protein band (62 kDa) was visible in the expression product. The SDS-PAGE detection diagram of the antigen recombinant protein expression is as Figure 1 shown.

[0085] Example 3: Purification of nfilC-SpaA Antigen Recombinant Protein

[0086] 1. Experimental Materials:

[0087] The antigen prepared in Example 2; Ni Sepharose 6 Fast Flow was purchased from GE Healthcare, USA, and other reagents were all of analytical grade.

[0088] 2. Experimental Method

[0089] 2.1 Bacterial cell lysis: After the culture of nfliC-SpaA bacterial solution was completed, centrifuge to collect the cells, resuspend the cells at a ratio of 10 ml of lysis buffer (20 mmol / L Tris buffer (pH 7.0), 0.5 mol / L NaCl) per gram of wet cell weight, disrupt the cells 3 times with a high-pressure homogenizer at 800 bar, and centrifuge to collect the supernatant.

[0090] 2.2 Nickel column affinity chromatography: Add 0.02 mol / L imidazole to the supernatant, filter, and then perform protein affinity chromatography purification using a protein chromatography purification system. The chromatography medium is Ni Sepharose 6 Fast Flow, and the system flow rate is 90 cm / h. Before loading, equilibrate the chromatography column with equilibration buffer (0.02 mol / L Tris (pH 7.0), 0.02 mol / L imidazole, 0.5 mol / L NaCl). After loading, elute the impurity proteins with buffer solution (0.02 mol / L Tris (pH 7.0), 0.05 mol / L imidazole, 0.5 mol / L NaCl), and elute the target protein with buffer solution (0.02 mol / L Tris (pH 7.0), 0.5 mol / L imidazole, 0.5 mol / L NaCl), and collect the elution product.

[0091] 2.3 The protein purity was detected by SDS-PAGE electrophoresis. After staining, a clear target protein band should be visible. The gel was scanned by a gel imaging system, and the purity of the target protein was analyzed by software.

[0092] 2.4 The protein content was determined by the BCA method, and the protein content was about 2 mg / mL.

[0093] 3. Experimental Results

[0094] The purity of the recombinant nfliC-SpaA antigen protein was about 90% after purification by Ni ion affinity chromatography.

[0095] Example 4: Preparation of a genetically engineered subunit vaccine composition against swine erysipelas

[0096] The recombinant nfilC-SpaA antigen protein against swine erysipelas prepared in Example 3 was added to the adjuvant. During the addition process, it was continuously stirred with an emulsifier at a speed of 800 rpm for 12 min, mixed evenly, and stored at 4°C, which was the genetically engineered subunit vaccine composition against swine erysipelas. The adjuvant applicable to this application can be an adjuvant well-known to those skilled in the art. In this application, the selected adjuvant is a high-molecular polymer water-soluble adjuvant, such as carbomer. The specific ratio of each component in the prepared vaccine is shown in Table 2.

[0097] Table 2 Composition ratio of the genetically engineered subunit vaccine composition against swine erysipelas

[0098] Example 5 Immunogenicity test of the genetically engineered subunit vaccine composition against swine erysipelas

[0099] Forty 5- to 6-week-old BALB / c mice were randomly divided into 8 groups, with 5 mice in each group. The first and second groups were immunized with vaccine 1 respectively, the third and fourth groups were immunized with vaccine 2 respectively, the fifth and sixth groups were immunized with vaccine 3 respectively, and the seventh and eighth groups were the control groups. The dose was 0.2 ml / mouse / time, and immunization was carried out once. The control groups were immunized with an equal amount of PBS + adjuvant by subcutaneous injection.

[0100] The BALB / c mice immunized for 4 weeks were challenged. The first, third, fifth, and seventh groups were inoculated with 0.2 ml / 5000 CFU / mouse of the C43-8 strain of type 1 bacteria, and the second, fourth, sixth, and eighth groups were inoculated with 0.2 ml / 5000 CFU / mouse of the C43-6 strain of type 2 bacteria by subcutaneous injection in the neck and back. After challenge, the mice were observed continuously for 10 days. All the mice in the challenge control group died, and 5 / 5 of the mice in the vaccine immunization groups were protected. The specific results are shown in Tables 3 and 4.

[0101] Table 3 Evaluation results of mice challenged with type 1 swine erysipelas bacteria Group Protection rate Mortality rate 1 5 / 5 0 / 5 3 5 / 5 0 / 5 5 5 / 5 0 / 5 7 / 5 / 5

[0102] Table 4 Evaluation results of mice challenged with type 2 Erysipelothrix rhusiopathiae Group Protection rate Mortality rate 2 5 / 5 0 / 5 4 5 / 5 0 / 5 6 5 / 5 0 / 5 8 / 5 / 5

[0103] The results showed that after immunizing mice with the subunit vaccine of the present application, it could provide 5 / 5 protection against type 1 and type 2 strains of Erysipelothrix rhusiopathiae, indicating that the subunit vaccine obtained in the present application could provide good protection against different serotypes, and proving that the antigen of the present application had good immunogenicity.

[0104] Example 6: Immunoprotection test of genetically engineered subunit vaccine against Erysipelothrix rhusiopathiae in piglets

[0105] Forty 40 - 41-day-old weaned piglets negative for both Erysipelothrix rhusiopathiae antigen and antibody were randomly divided into 8 groups, with 5 piglets in each group. Groups 9 and 10 were immunized with Vaccine 1 respectively, Groups 11 and 12 were immunized with Vaccine 2 respectively, Groups 13 and 14 were immunized with Vaccine 3 respectively, and Groups 15 and 16 were used as control groups. Immunization was performed by intramuscular injection in the neck once, with an immunization dose of 2 ml / head. The control groups were immunized with an equal volume of PBS + adjuvant.

[0106] A challenge test was conducted on the piglets immunized for two weeks. Groups 9, 11, 13, and 15 were inoculated with 2 ml of type 1 C43 - 8 strain bacterial solution at a concentration of 1×10 6 CFU / head respectively, and Groups 10, 12, 14, and 16 were inoculated with 2 ml of type 2 C43 - 6 strain bacterial solution at a concentration of 1×10 3 CFU / head respectively, by ear marginal vein injection. Observation was continued for 14 days, and the clinical characteristics and death situations were recorded. The specific results are shown in Table 5 and Table 6.

[0107] Table 5 Challenge test results of type 1 bacteria of subunit vaccine against Erysipelothrix rhusiopathiae in piglets

[0108] Table 6 Challenge test results of type 2 bacteria of subunit vaccine against Erysipelothrix rhusiopathiae in piglets

[0109] The results showed that after immunizing piglets with the subunit vaccine of the present application, it could provide 5 / 5 protection against type 1 and type 2 strains of Erysipelothrix rhusiopathiae, that is, this vaccine could provide good protection against different serotypes. All the piglets immunized with the subunit vaccine of the present application were healthy without any symptoms of disease, and there were no red patches at the injection sites. After euthanizing the piglets for autopsy and culturing bacteria, the challenged strains were not isolated from the kidneys, spleens, livers, and hearts, and no obvious abnormalities were found in each organ. However, some organ hemorrhages or infarctions were visible in the commercial inactivated vaccine group. All the challenged control piglets became ill, with elevated body temperatures, listlessness, slow movement, and the skin eruptions showed "branded" erythema. Successive piglets died. It can be seen that the nfliC-SpaA subunit vaccine prepared in the present application can provide good protection for piglets, proving that the antigen of the present application has good immunogenicity.

[0110] Example 7 Comparative Test on Immunogenicity of Genetic Engineering Subunit Vaccine against Erysipelothrix rhusiopathiae

[0111] Fifteen 40 - 41-day-old weaned piglets with negative antigens and antibodies against Erysipelothrix rhusiopathiae were randomly divided into 3 groups, with 5 piglets in each group. Group 17 was immunized with Vaccine 2, Group 18 was immunized with a commercial inactivated Erysipelothrix rhusiopathiae vaccine, and Group 19 was the control group. They were immunized once by intramuscular injection in the neck. The immunization dose of the subunit vaccine was 2 ml / head, the immunization dose of the inactivated vaccine was 3 ml / head, and the control group was immunized with 3 ml / head of PBS + adjuvant.

[0112] A challenge test was conducted on the piglets immunized for two weeks. Groups 17, 18, and 19 were respectively inoculated with a mixed bacterial solution of type 1 C43 - 8 strain and type 2 C43 - 6 strain (1×10 6 CFU / head for type 1; 1×10 3 CFU / head for type 2) at a dose of 2 ml / head by ear marginal vein injection. They were continuously observed for 14 days, and the clinical characteristics and death situations were recorded. The specific results are shown in Table 7.

[0113] Table 7 Results of Comparative Test on Immunogenicity of Genetic Engineering Subunit Vaccine against Erysipelothrix rhusiopathiae

[0114] The results showed that after immunizing the piglets, in the commercial inactivated vaccine group, 1 / 5 of the piglets showed listlessness and reduced appetite 1 - 2 days after challenge, and then gradually recovered. There were no red patches at the injection sites of all the piglets. All the piglets in the subunit vaccine group of the present application were healthy without any symptoms of disease, and there were no red patches at the injection sites. After euthanizing the piglets for autopsy and culturing bacteria, the challenged strains were not isolated from the kidneys, spleens, livers, and hearts, and no obvious abnormalities were found in each organ. However, some organ hemorrhages or infarctions were visible in the commercial inactivated vaccine group. All the challenged control piglets became ill, with elevated body temperatures, listlessness, slow movement, and the skin eruptions showed "branded" erythema. Successive piglets died. It can be seen that the nfliC-SpaA subunit vaccine prepared in the present application can provide good protection against different serotypes.

[0115] Note that the above is only a preferred embodiment of the present application and the technical principles applied. Those skilled in the art will understand that the present application is not limited to the specific embodiments described herein, and various obvious changes, re-adjustments, and substitutions can be made by those skilled in the art without departing from the protection scope of the present application. Therefore, although the present application has been described in more detail through the above embodiments, the present application is not limited to the above embodiments. Without departing from the technical concept of the present application, more other equivalent embodiments can be included, all of which fall within the protection scope of the present application.

Claims

1. A recombinant protein nfliC-SpaA of Erysipelothrix rhusiopathiae antigen, characterized in that, the amino acid sequence of the recombinant protein nfliC-SpaA is shown in SEQ ID NO.

2.

2. A biological material related to the recombinant protein nfliC-SpaA described in claim 1, characterized in that, the biological material includes: (1) Nucleic acid encoding the recombinant protein nfliC-SpaA described in claim 1; (2) An expression cassette containing the nucleic acid in (1); (3) A vector containing the nucleic acid in (1) or the expression cassette in (2); (4) A recombinant cell containing the nucleic acid in (1), the expression cassette in (2) or the vector in (3).

3. The biological material according to claim 2, characterized in that, the nucleotide sequence of the nucleic acid is shown in SEQ ID NO.

1.

4. Use of the recombinant protein nfliC-SpaA described in claim 1 in the preparation of a drug for preventing Erysipelothrix rhusiopathiae infection.

5. The use according to claim 4, characterized in that, the drug is a subunit vaccine of Erysipelothrix rhusiopathiae.

6. A subunit vaccine of Erysipelothrix rhusiopathiae, characterized in that, the subunit vaccine includes a pharmaceutically acceptable carrier and an immunologically effective amount of the recombinant protein nfliC-SpaA described in claim 1.

7. The subunit vaccine according to claim 6, characterized in that, the content of the recombinant protein nfliC-SpaA is ≥50 μg / ml, preferably 50 - 250 μg / ml.

8. The subunit vaccine according to claim 6, characterized in that, the pharmaceutically acceptable carrier includes at least one of adjuvants, lyoprotectants, immunostimulants, antioxidants, surfactants, colorants, volatile oils, buffers, dispersants, propellants and preservatives; Preferably, the adjuvant includes: aluminum hydroxide adjuvant, saponin, avridine, DDA, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion, polymers of acrylic acid or methacrylic acid, copolymers of maleic anhydride and alkenyl derivatives, RIBI adjuvant system, Block co-polymer, SAF-M, monophosphoryl lipid A, Avridine lipid-amine adjuvant, Escherichia coli heat-labile enterotoxin, cholera toxin, IMS1314, muramyl dipeptide, Gel adjuvant, etc.

9. The subunit vaccine according to claim 8, characterized in that, the concentration range of the adjuvant is from 5% V / V to 50% V / V, preferably 10% V / V.

10. The subunit vaccine according to claim 8, characterized in that, the lyoprotectant is selected from sugars, polyols, polymers, surfactants, salts, amines or amino acids; Preferably, the immunostimulant includes α-interferon, β-interferon, γ-interferon, granulocyte macrophage colony-stimulating factor, macrophage colony-stimulating factor or interleukin 2.

Images