Fusion protein of IL-2 variant for targeting CD73 receptor

Abstract

The invention discloses a fusion protein of an IL-2 variant for targeting a CD73 receptor, and belongs to the field of biomedicine. In a cell experiment, the mCD73-IL-2v can delay the depletion of CD8 < + > T cells. In animal experiments, compared with a PBS group, the mCD73-IL-2v can obviously inhibit the growth of melanoma, the proportion of CD8 + T cells and NK cells in the spleen of a tumor-bearing mouse is up-regulated, and the proportion of Tregs is down-regulated. After mCD73-IL-2v treatment, the proportion of CD8 + T cell depletion markers (PD1, LAG3 and Tim3) in the spleen of a tumor-bearing mouse is reduced, and depletion is delayed. The mCD73-IL-2v can also reduce the proportion of proinflammatory factors such as TNF-alpha (tumor necrosis factor-alpha) and IFN-gamma (interferon-gamma) in serum of tumor-bearing mice and relieve the toxic and side effects of IL-2 (interleukin-2).

Description

Technical Field

[0001] The present invention relates to a fusion protein of an IL-2 variant targeting the CD73 receptor, belonging to the field of biomedicine. Background Art

[0002] Interleukin-2 (IL-2) is a pleiotropic cytokine, known as the T cell growth factor for its function, and is involved in the growth and proliferation of many immune cells [TANIGUCHI T, MATSUI H, FUJITA T, et al. Structure and expression of a cloned cDNA for human interleukin-2 [J]. Nature, 1983, 302(5906): 305-10.]. IL-2 is mainly secreted by activated T cells. The biological activity of IL-2 is mainly exerted through the IL-2 receptor on the cell surface: the IL2-Rα monomer, the IL2-Rβγc dimer, and the IL2-Rαβγc trimer. After IL-2 binds to the IL2-Rβγc dimer, it can also activate STAT5 for signal transduction. The high-affinity IL2-Rαβγc trimer (Kd≈10 –11 mol / L) is persistently expressed on the surface of Treg cells, and the medium-affinity IL2-Rβγc dimer (Kd≈10 –9 mol / L) is mainly expressed on the surface of NK cells and Teff cells. Therefore, low concentrations of IL-2 first stimulate Treg cells, while high concentrations of IL-2 act on Teff cells, and high doses of IL-2 can cause adverse reactions such as vascular leak syndrome, pulmonary edema, hypotension, and cardiotoxicity [PALIARD X, DE WAALMALEFIJT R, YSSEL H, et al. Simultaneous production of IL-2, IL-4, and IFN-gamma by activated human CD4+ and CD8+ T cell clones [J]. J Immunol, 1988, 141(3): 849-55.]. Therefore, changing the IL-2 receptor preference to improve adverse reactions and efficacy is crucial.

[0003] In recent years, many recombinant IL-2 and IL-2 variants have also emerged clinically, but the cancer treatment effect is poor and the adverse reactions are still severe. The development of immune checkpoint (PD1, LAG3, etc.) inhibitors (ICIs) and other immunomodulatory drugs has made breakthrough progress in cancer immunotherapy. Currently, the more mainstream approach is to fuse immune checkpoint antibodies with IL-2, for example: PD1-IL2v. In contrast, single PD-1 or PD-L1 antibodies cannot better expand specific effector T cell subsets, but cause cells to differentiate into terminal effector phenotypes, leading to T cell exhaustion. IL-2v reduces the activation of Tregs by mutating the key residues of IL-2 so that it does not bind to IL-2Rα. The binding of IL-2 to IL-2Rα is mediated by two hydrophobic patches around F42, Y45 and L72 on the surface of IL-2. Mutating F42A, Y45A and L72G removes most of the van der Waals interactions on the surface, thus preventing IL2v from binding to IL-2Rα [RICKERT M, WANG X, BOULANGER M J, et al. The structure of interleukin-2 complexed with its alpha receptor[J]. Science, 2005, 308(5727):1477-80.].

[0004] Inspired by the above technologies, it is particularly important to find new immune checkpoints that synergize with IL-2v in order to relieve the immunosuppression produced by Tregs, so as to achieve a better effect in immunotherapy. Summary of the Invention

[0005] Aiming at the deficiencies of the above-mentioned prior art, the present invention provides a fusion protein of an IL-2 variant targeting CD73-expressing T cells, aiming to fuse a CD73 antibody with an IL-2 variant (IL-2v) to relieve the immunosuppression produced by Tregs.

[0006] The first technical solution provided by the present invention is a fusion protein of an IL-2 variant targeting CD73-expressing T cells, and the amino acid sequence of the fusion protein is shown in SEQ ID NO.1.

[0007] SEQ ID NO.1:

[0008] MQVQLQESGGGLVQAGGSLRLSCAASGSIGSIIAMGWYRQGPGKQRELVARMFTDDGSTNYDDSVKGRFTISRDSAGTTVYLQMNSLKPEDTAVYYCNAQRRWNAYWGPGTQVTVSSGGSGGTAPASSSTKKTQLQLEHLLLDLQMILNGINNYKNPKLTRMLTAKFAMPKKATELKHLQCLEEELKPLEEVLNGAQSKNFHLRPRDLISNINVIVLELKGSETTFMCEYADETATIVEFLNRWITFAQSIISTLTHHHHHH。

[0009] The second technical solution provided by the present invention is a gene encoding the fusion protein described in the first technical solution.

[0010] In certain embodiments, the nucleotide sequence of the gene is as shown in SEQ ID NO.2.

[0011] The third technical solution provided by the present invention is a recombinant plasmid carrying the gene described in the second technical solution.

[0012] In certain embodiments, the recombinant plasmid uses pET-22b(+) as an expression vector.

[0013] The fourth technical solution provided by the present invention is a recombinant cell expressing the fusion protein described in the first technical solution, or containing the gene described in the second technical solution, or transformed with the recombinant plasmid described in the third technical solution.

[0014] In certain embodiments, the recombinant cell uses Escherichia coli as a host.

[0015] The fifth technical solution provided by the present invention is the use of the fusion protein described in the first technical solution, or the gene described in the second technical solution, or the recombinant plasmid described in the third technical solution, or the recombinant cell described in the fourth technical solution in the preparation of a drug for relieving, alleviating and / or treating melanoma.

[0016] In certain embodiments, the use at least includes one of the following effects:

[0017] (1) Inhibiting the growth of individual melanoma;

[0018] (2) Upregulating the proportions of CD8 + T cells and NK cells in the spleen of tumor-bearing individuals and downregulating the proportion of Tregs;

[0019] (3) Downregulating CD8 in the spleen of tumor-bearing individuals +Proportion of T cell exhaustion markers (PD1, LAG3, Tim3);

[0020] (4) Down-regulate the proportion of pro-inflammatory factors such as TNF-α and IFN-γ in the serum of tumor-bearing individuals.

[0021] The sixth technical solution provided by the present invention is a product for alleviating the exhaustion of CD8 + T cells, and the product includes the fusion protein described in the first technical solution.

[0022] The seventh technical solution provided by the present invention is a method for alleviating the exhaustion of CD8 + T cells in vitro, and the method is to treat CD8 + T cells with the fusion protein described in the first technical solution.

[0023] Beneficial effects

[0024] (1) In cell experiments, mCD73-IL-2v can delay the exhaustion of CD8+ T cells.

[0025] (2) In animal experiments, compared with the PBS group, mCD73-IL-2v can significantly inhibit the growth of melanoma, and the proportions of CD8+ T cells and NK cells in the spleen of tumor-bearing mice are up-regulated, while the proportion of Tregs is down-regulated.

[0026] (3) After treatment with mCD73-IL-2v, the proportions of CD8+ T cell exhaustion markers (PD1, LAG3, Tim3) in the spleen of tumor-bearing mice are down-regulated, delaying exhaustion.

[0027] (4) Compared with IL-2, mCD73-IL-2v can also down-regulate the proportions of pro-inflammatory factors such as TNF-α and IFN-γ in the serum of tumor-bearing mice, reducing the toxic side effects of IL-2. Description of the drawings

[0028] Figure 1 It is a schematic diagram of the pET-22b(+)-IL2 plasmid map.

[0029] Figure 2 It is a schematic diagram of the pET-22b(+)-mCD72-IL2v plasmid map.

[0030] Figure 3 It is a schematic diagram of the pET-22b(+)-mCD72-IL2 plasmid map.

[0031] Figure 4 It is an ultraviolet absorption peak diagram showing the AKTA purification result of mCD72-IL2v protein.

[0032] Figure 5It is the ultraviolet absorption peak diagram showing the AKTA purification result of mCD72-IL2 protein.

[0033] Figure 6 It is the SDS-PAGE analysis result of mCD72-IL2v protein.

[0034] Figure 7 It is the SDS-PAGE analysis result of mCD72-IL2 protein.

[0035] Figure 8 It is the ultraviolet absorption peak diagram showing the AKTA purification result of IL2 protein.

[0036] Figure 9 It is the SDS-PAGE analysis result of IL2 protein.

[0037] Figure 10 It is to determine the affinity between the protein and different receptors by SPR method.

[0038] Figure 11 It is the effect of mCD73-IL2v on the exhaustion degree of CD8 + T cells in vitro.

[0039] Figure 12 It is the tumor volume of mCD73-IL2v in treating murine melanoma solid tumors.

[0040] Figure 13 It is the effect of mCD73-IL2v on the proportion of T lymphocytes in the spleen of tumor-bearing mice.

[0041] Figure 14 It is the effect of mCD73-IL2v on the exhaustion degree of CD8 + T cells in the spleen tissue of tumor-bearing mice in vivo.

[0042] Figure 15 It is the toxicity evaluation of mCD73-IL2v in mice. Specific embodiments

[0043] The following are the preferred embodiments of the present invention. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0044] Raw materials used in the embodiments:

[0045] 1. Preparation method of LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L.

[0046] 2. E.coil TransB(DE3) strain is purchased from TransGen Biotech Co., Ltd.

[0047] 3. The E. coil DH5α strain was purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0048] 4. The B16 melanoma cells were purchased from Wuhan Punosai Life Science Co., Ltd.

[0049] 5. The medium components for B16 melanoma cells were: RPMI-1640 + 10% FBS + 1% P / S.

[0050] 6. Zombie UV TM The Fixable Viability Kit, anti-mouse CD16 / 32 Antibody, anti-mouse CD3-FITC, CD4-BV750, CD8-AF647, CD25-APC / Cy7, FOXP3-PE, CD45-BV510, CD335 (NKp46)-BV650, PD1-PE, Tim3-BV605, LAG3-PE / Cy7 were all purchased from BioLegend.

[0051] 7. The C57BL / 6 mice were purchased from Jicuiyaokang Biotechnology Co., Ltd.

[0052] Example 1 Preparation of the fusion protein

[0053] I. Construction of the prokaryotic expression plasmid

[0054] 1. Construction of the pET-22b(+)-IL-2 plasmid

[0055] The gene sequence of IL-2 was synthesized by Genewiz. The IL-2 fragment (shown in SEQ ID NO.3) was cloned into the pET-22b(+) vector by homologous recombination using the following primers. The constructed plasmid map was verified by sequencing to ensure the correct insertion of the sequence. The nucleotide sequence of SEQ ID NO.3 is as follows: Figure 1 shown as follows:

[0056] ATGGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATCATCTCAACACTGACTCACCATCACCATCACCATTAA。

[0057] The primers for amplifying the pET-22b(+) vector fragment are designed as follows (5'-3'):

[0058] Forward primer F: CGCTAACAAAGCCCGAAAG

[0059] Reverse primer R: GTATATCTCCTTCTTAAAGTTAAACAAAATTATTTC

[0060] The primers for amplifying the IL-2 fragment with homologous arms are designed as follows (5'-3'):

[0061] Forward primer F: ACTTTAAGAAGGAGATATACATGGCACCTACTTCAAGTTC

[0062] Reverse primer R: CCCTTTCGGGCTTTGTTAGCGTTAATGGTGATGGTGATGG

[0063] 2. Construction of the pET-22b(+)-mCD73-IL2v plasmid

[0064] The gene sequence of mCD73-IL2v was synthesized by Genewiz Biotechnology Co., Ltd. The nucleotide sequence is shown in SEQ ID NO.2. Then, the mCD73-IL2v fragment was cloned into the pET-22b(+) vector by homologous recombination using the following primers. The constructed plasmid map was verified by sequencing to ensure the correct insertion of the sequence.Figure 2 as shown

[0065] The primers for amplifying the pET-22b(+)-vector fragment are designed as follows (5'-3'):

[0066] Forward primer F: CTCGAGCACCACCACCAC;

[0067] Reverse primer R: ATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG

[0068] The primers for amplifying mCD73-IL2v with homologous arms are designed as follows (5'-3'):

[0069] Forward primer F: TTTAAGAAGGAGATATACATATGCAAGTGCAGCTGCAAG

[0070] Reverse primer R: TGGTGGTGGTGGTGCTCGAGTTAATGGTGATGGTGATGGTG

[0071] 3. Construction of pET-22b(+)-mCD73-IL-2 plasmid

[0072] Using pET-22b(+)-mCD73-IL2v and pET-22b(+)-IL-2 plasmids as templates, the pET-22b(+)-mCD73 and IL-2 fragments with homologous arms were obtained by PCR using the following primers, and then the pET-22b(+)-mCD73-IL-2 plasmid was obtained by homologous recombination. The recombinant plasmid was verified by sequencing to ensure that the inserted sequence was correct. The constructed plasmid map is as Figure 3 shown, and the nucleotide sequence of mCD73-IL-2 is as follows:

[0073] ATGCAAGTGCAGCTGCAAGAAAGCGGCGGTGGTCTGGTTCAAGCGGGCGGTAGTC

[0074] TGCGTCTGAGCTGCGCGGCGAGCGGCAGCATTGGCAGCATTATTGCGATGGGCTGGTAT

[0075] CGCCAAGGCCCGGGCAAACAGCGCGAACTGGTGGCGCGCATGTTTACCGATGATGGCA

[0076] GCACCAACTATGATGATAGCGTGAAAGGCCGCTTTACCATTAGCCGCGATAGCGCGGGC

[0077] ACCACCGTGTATCTGCAGATGAACAGCCTGAAACCGGAAGATACCGCGGTGTATTATTG

[0078] CAACGCGCAGCGCCGCTGGAACGCGTATTGGGGCCCGGGCACCCAAGTGACCGTGAGC

[0079] AGCGGTGGTAGTGGCGGCACCGCACCTACTTCAAGTTCTACAAAGAAAACACAGCTAC

[0080] AACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACAAGAA

[0081] TCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAAC

[0082] TGAAACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTA

[0083] GCTCAAAGCAAAAACTTTCACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAAT

[0084] AGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCTGATGAGACAG

[0085] CAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATCATCTCAACAC

[0086] TGACTCACCATCACCATCACCATTAA(SEQ ID NO.4).

[0087] The primers for amplifying the pET-22b(+)-mCD73 fragment are designed as follows (5'-3'):

[0088] Forward primer F: CTCGAGCACCACCACCAC

[0089] Reverse primer R: GGTGCCGCCACTACCACC

[0090] The primer design for amplifying the IL-2 fragment with homologous arms is as follows (5'-3'):

[0091] Forward primer F: GCGGTGGTAGTGGCGGCACCGCACCTACTTCAAGTTCTAC

[0092] Reverse primer R: TGGTGGTGGTGGTGCTCGAGTTAATGGTGATGGTGATG

[0093] II. Expression, purification and verification of proteins

[0094] 1. Transformation of plasmids

[0095] The recombinant plasmids pET-22b(+)-mCD73-IL2v, pET-22b(+)-mCD73-IL2, and pET-22b(+)-IL2 were transformed into the E.coil Trans B(DE3) strain by heat shock method to obtain engineering bacteria that can express mCD73-IL2v, mCD73-IL2, and IL2 proteins. The specific method is to thaw the E.coil Trans B(DE3) competent cells on ice. Add 2-3 μL of the recombinant plasmid with a concentration of about 70 μg / μL to every 100 μL of the competent cells, place the competent cells on ice and let them stand for 15 min. After standing, place the competent cells in a 42 °C water bath for heat shock for 90 s. Immediately after the heat shock, place the EP tube containing the competent cells on ice and let it stand for 2-3 min. After that, add 900 μL of antibiotic-free LB medium to the EP tube, place the EP tube in a shaker at 37 °C and 220 rpm for 1 h. Then, take 100 μL of the transformation product and spread it evenly on the LB solid medium with ampicillin resistance (Amp + , final concentration 100 μg / mL), and place it in a 37 °C incubator overnight. The next day, pick round and large single colonies on the plate for sequencing, and use the strains with correct sequences as the strains for subsequent large-scale induction expression.

[0096] 2. Induction expression of proteins

[0097] Inoculate the pET-22b(+)-mCD73-IL2v, pET-22b(+)-mCD73-IL2, and pET-22b(+)-IL2 expression strains into a test tube containing 5 mL of Amp + LB medium at a ratio of 1:100, shake in a shaker at 37 °C and 220 rpm for 5-6 h. Then, pipette the bacterial liquid in the test tube and inoculate it into a flask containing 50 mL of Amp +In a 250 mL conical flask of LB medium, it was placed in a shaker at 37 °C and 220 rpm and cultured overnight. The next day, the activated bacterial solution was aspirated and inoculated into a 3 L shaker flask containing 1 L of 2×YT medium at a ratio of 1:100. After amplification at 37 °C and 250 rpm for about 3 - 4 hours until OD600 reached 0.8 - 1.3, IPTG was added to a final concentration of 0.5 mM, and induction was carried out at 37 °C for 10 h. The cells were collected by centrifugation at 8000 rpm and 4 °C for 10 min. The cell pellet was resuspended in lysis buffer (20 mM Tris-HCl + 500 mM NaCl + 20 mM imidazole + 1% TritonX-100 + 5% glycerol, pH 8.0) at a ratio of 1:15, and the cells were lysed 4 times using a high-pressure homogenizer (pressure 1078 bar). After lysis, the precipitate (inclusion body) was collected by centrifugation at 10000×g and 4 °C for 40 min.

[0098] 3. Renaturation of inclusion bodies

[0099] The above inclusion bodies were added to the washing buffer (20 mM Tris-HCl + 100 mM NaCl + 1% TritonX-100 + 5 mM EDTA, pH 8.0) at a ratio of 1:10, placed on a magnetic stirrer at 400 rpm, stirred at room temperature for 30 min, centrifuged at 4000 rpm and 4 °C for 10 min to harvest the precipitate, and the washing was repeated once, and the inclusion bodies were harvested by centrifugation. The washed inclusion bodies were added to the solubilization buffer (20 mM Tris-HCl + 200 mM NaCl + 6 M GuHCl + 6 mM DTT, pH 8.0) at a ratio of 1:40. The GuHCl in the buffer for solubilizing IL-2 inclusion bodies could be replaced with 8 M GuHCl. Using a magnetic stirrer at 400 rpm, stir at room temperature for 16 - 24 h. The solubilized inclusion bodies were centrifuged at 10000*g and 4 °C for 30 min to harvest the supernatant. The protein concentration of the supernatant was measured using NanoDrop, and it was slowly added dropwise to the dilution buffer (20 mM Tris-HCl + 1 mM GSH + 1 mM GSSG + 600 mM GuHCl + 200 mM NaCl + 400 mM L-Arg + 0.1% PEG4000, pH 8.0) to dilute the refolded protein concentration to 0.1 mg / ml, stirred at 400 rpm at room temperature, and then left standing at 4 °C for 16 - 24 h. The refolding solution was ultrafiltered through a 0.22 μm membrane package to obtain the solution under the membrane, and then concentrated through a 5 KD membrane package to obtain the solution on the membrane.

[0100] 4. Purification and verification of proteins

[0101] DEAE column was used for the purification of IL-2 during the purification process, while Ni-NTA affinity column was used for the purification of mCD73-IL2 and mCD73-IL2v. The above purification experiments were all carried out on an AKTA protein purification system. The specific steps are as follows:

[0102] (1) Ni-NTA affinity purification

[0103] First, rinse the system pipeline with pure water. Then, install a Ni-NTA affinity chromatography column on the protein purification system and rinse the column with pure water until the UV baseline is stable. Then, equilibrate the column with Wash buffer until the UV line is flat. Next, load the sample at a flow rate of 2 ml / min, and collect the liquid flowing through the pipeline as the flow-through fraction. After loading the sample, equilibrate the column with Wash buffer until the UV line is flat. Subsequently, elute with Elution buffer + Wash buffer. Set the Elution buffer at gradients of 5%, 10%, 20%, 50%, and 100% for elution, and collect the protein based on the UV peak. Collect the corresponding tubes for each single peak eluted with different proportions of Elution buffer. The elution peaks of mCD73-IL2 and mCD73-IL2v proteins are shown in Figure 4 、 5 , and collect the purified protein samples for SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining analysis. The results are shown in Figure 6 、 7 .

[0104] (2) DEAE ion exchange column purification

[0105] Before purification by the DEAE ion exchange column, replace the buffer of IL-2 after renaturation with DEAE anion exchange column buffer A, and use a 5KD membrane package to replace until the conductivity drops to 4000 ms / cm.

[0106] Before using the DEAE ion exchange column for purification, first rinse the pipeline of the AKTA protein purification system with pure water, then install a Sepax DEAE ion exchange column, and rinse the column with pure water for 5 column volumes to thoroughly wash away the ethanol in the column. Then, rinse with 100% buffer B - 100% buffer A (low salt) of the anion exchange column for 5 column volumes successively at a flow rate of 3 ml / min until the conductivity baseline is flat. Next, load the sample at a flow rate of 2 ml / min and collect the flow-through fraction. After loading the sample, rinse the column with buffer A until the conductivity returns to the baseline. Then, set the elution parameters to reach 50% buffer B in 30 min, and collect according to the UV peak. The elution peak is shown in Figure 8 , and after collection, perform SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining analysis on each component. The results are as shown in Figure 9 .

[0107] V. Affinity of the protein for different receptor subunits of IL-2Rα and β.

[0108] First, the anti-human IgG (Fc) antibody (SSA015, Sino Biological) was diluted to 25 μg / ml with a pH 5.0, 10 mM sodium acetate solution and coupled to a CM5 chip activated with 400 mM EDC and 100 mM NHS (cytiva) at a flow rate of 10 μl / min until the response value RU was between 9000 and 14000, and finally blocked with 1 M EDC (cytiva). Subsequently, the receptor was diluted to 10 μg / ml with a running buffer (1×PBS-P) solution and loaded at a flow rate of 10 μl / min until the captured response value was around 500 RU. Then, each protein sample was serially diluted two-fold for a total of 9 concentrations, and the steps of capturing the receptor, binding, dissociation, and regeneration (pH 2.0 Glycine) were cycled for each round. Finally, the affinities of IL2, mCD73-IL2, and mCD73-IL2v fusion proteins with CD73 and different receptors of IL-2 were measured. The data were analyzed using Biacore 8K evaluation software, and the 1:1 steady-state affinity model was used to fit the data to determine the KD value and other kinetic parameters. The results are shown in Figure 10 .

[0109] As Figure 10 shown, the affinities of IL-2 and mCD73-IL2 with IL2Rα were 2.64×10 -8 M and 1.84×10 -8 M, respectively, while mCD73-IL2v did not bind to IL2Rα. The affinities of IL-2, mCD73-IL2, and mCD73-IL2v with the IL2Rαβγ trimer were 2.22×10 -11 , 4.03×10 -11 , and 1.40×10 -10 M, respectively. From the results, mCD73-IL2v bound weakly to the IL2Rαβγ trimer, indicating that mCD73-IL2v is non-α type.

[0110] Example 2 Verification of the Activity of mCD73-IL2v at the Cellular Level

[0111] 1. Effect of mCD73-IL2v on CD8 + T Cell Exhaustion

[0112] The so-called T cell exhaustion refers to the loss of T cell function in patients with common chronic infections and cancer. Due to long-term exposure to persistent antigens or chronic inflammation, exhausted T cells gradually lose their effector function and memory T cell characteristics begin to disappear. Therefore, the study detected the expression level of T cell immune checkpoints as another determinant of CD8+T's effective tumor immunity function. The specific experimental methods are as follows:

[0113] Using EasySep TM Mouse T Cell Isolation Kit is used to isolate CD3 T cells from spleen of C57BL / 6 mice. + T cells (specific isolation steps according to EasySep TM Mouse T Cell Isolation Kit instructions), stimulated with CD3 / CD28 antibody for two days, added IL-2, mCD73-IL2 and mCD73-IL2v at a final concentration of 2 μM to the culture medium, and cultured for several days with Zombie UV TM Fixable Viability Kit cell live / dead dyes were used to incubate cells, and then surface markers (i.e., CD3, CD8, PD1, Lag3, Tim3) were used to stain cells, followed by immediate fixation (Fixation / Permeabilization Concentrate, eBioscience TM ) cells and then analyzed by flow cytometry. The results are shown in Figure 11 .

[0114] like Figure 11 As shown, compared with the IL-2 group, primary CD8 + The proportions of T cell exhaustion markers PD1, LAG3, and Tim3 decreased by 1.3 times (75%), 1.1 times (77%), and 2.9 times (16.5%), respectively. The above results indicate that mCD73-IL2v can slow down the progression of CD8 + Depletion of T cells.

[0115] Example 3 Effect and toxicity evaluation of mCD73-IL2v in treating mouse melanoma

[0116] Female, SPF-grade, 6-8-week-old C57BL / 6 mice were selected, and the density of B16 melanoma cells was adjusted to 1×10 7 / mL, inoculated in the mouse armpit, 100μL per mouse. When the tumor grows to 80-100mm 3When the time came, the mice were randomly divided into 4 groups. Each mouse was subcutaneously injected with 3.5 μM IL-2, mCD73-IL2, and mCD73-IL2v (from day 1 to day 5, and from day 8 to day 12). The model group was injected with the same volume of PBS. The tumor volume was measured every other day. The treatment results are shown in Figure 12 .

[0117] After sacrifice, the proportions of effector T cells (CD8 + T, NK cells) and regulatory T cells (Tregs) in the total spleen cells of each mouse were analyzed, and the exhaustion degree of CD8 + T in the spleen cells of mice was analyzed. The specific operation was as follows: First, the spleen was prepared into a single-cell suspension, and then the cells were stained and fixed. The specific method was referred to in Example 2. After that, flow cytometry analysis was performed. The results are shown in Figure 13 , 14 .

[0118] The mice were sacrificed 2 days after the end of mCD73 treatment. Before sacrifice, blood was collected from the mice by eye enucleation, and the proportions of pro-inflammatory factors such as TNF-α and IFN-γ in the mouse serum were detected by ELISA. The blood treatment method was as follows: After the blood coagulated naturally at room temperature for 30 min, it was centrifuged at 1000×g for 15 min at 4°C, and the supernatant was taken. Then, the operation was carried out according to the ELISA kit instructions. The results are shown in Figure 15 .

[0119] As can be seen from Figures 12 to 15 , compared with the PBS group, the growth of melanoma in mice treated with mCD73-IL-2v could be significantly inhibited. The proportions of CD8 + T cells and NK cells in the spleen of mice in the mCD73-IL2v treatment group reached approximately 47.7% and 6.5% respectively, while those in the PBS group and the IL-2 group were 23.7%, 30.5% and 1.88%, 3.45% respectively. It can be seen that the Teff cells in the spleen of mice in the mCD73-IL2v treatment group were significantly up-regulated. The proportion of Tregs in the spleen of mice in the mCD73-IL2v treatment group in CD3+ T cells was approximately 3.26%, while those in the PBS, IL-2, and mCD73-IL2 groups were approximately 5.63%, 10.27%, and 10.42% respectively. Compared with the control group, Tregs in the treatment group were significantly down-regulated. Compared with the IL-2 group, the CD8 +The proportions of T cell exhaustion markers PD1, LAG3, and Tim3 decreased by 2.5-fold (3.92%), 2.6-fold (3.5%), and 2.9-fold (2.97%), respectively, which could significantly delay exhaustion. The concentrations of pro-inflammatory factors TNF-α and IFN-γ in the serum of tumor-bearing mice in the mCD73-IL-2v treatment group were 16.8 and 60.3 pg / mL, respectively, while those in the IL-2 group were approximately 22.4 and 81.5%. From the above results, it can be seen that mCD73-IL-2v can reduce the toxic side effects of IL-2.

[0120] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A fusion protein for targeting CD73 receptor, characterized in that: The amino acid sequence of the fusion protein is shown in SEQ ID NO.

1.

2. A gene encoding the fusion protein of claim 1.

3. A recombinant plasmid carrying the gene according to claim 2.

4. The recombinant plasmid according to claim 3, characterized in that The recombinant plasmid uses pET-22b(+) as an expression vector.

5. A recombinant cell expressing the fusion protein of claim 1, or containing the gene of claim 2, or transformed with the recombinant plasmid of claim 3 or 4.

6. The recombinant cell according to claim 5, characterized in that The recombinant cell uses Escherichia coli as a host.

7. Use of the fusion protein according to claim 1, or the gene according to claim 2, or the recombinant plasmid according to claim 3 or 4, or the recombinant cell according to claim 5 or 6 in the preparation of a drug for alleviating, reducing and / or treating melanoma.

8. The use according to claim 7, characterized in that: The application includes at least one of the following functions: (1) Inhibit the growth of individual melanomas; (2) Upregulation of CD8 in the spleen of tumor-bearing individuals + The ratio of T cells and NK cells, down-regulating the ratio of Tregs; (3) Downregulation of CD8 in the spleen of tumor-bearing individuals + The proportion of T cell exhaustion markers; (4) Down-regulate the ratio of TNF-α and IFN-γ pro-inflammatory factors in the serum of tumor-bearing individuals.

9. A Relief CD8 + A T cell depletion product, characterized in that The product comprises the fusion protein of claim 1.

10. An in vitro CD8 + A method for depleting T cells, characterized in that The method is to use the fusion protein of claim 1 to treat CD8 + T cells.

Images