Lactobacillus paracasei ZhangGao185 capable of promoting bone growth and development and application of lactobacillus paracasei ZhangGao185

Abstract

The invention relates to the technical field of microorganisms, in particular to lactobacillus paracasei ZhangGao185 capable of promoting bone growth and development and application of the lactobacillus paracasei ZhangGao185. The lactobacillus paracasei ZhangGao185 is preserved in China Center for Type Culture Collection on October 14, 2024, the preservation address is No. 299 on eight road, Wuchang District, Wuhan City, Hubei Province, the preservation number is CCTCC NO: M 20242203, and the lactobacillus paracasei ZhangGao185 survives; the sequence of 16S rDNA (ribosomal deoxyribonucleic acid) of the lactobacillus paracasei ZhangGao185 is as shown in SEQ ID NO. 1. The lactobacillus paracasei ZhangGao185 disclosed by the invention has a remarkable effect of promoting bone growth and development, and has a good application prospect in preparation of medicines or health-care foods for promoting bone growth and development.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and particularly relates to a Lactobacillus paracasei ZhangGao185 for promoting bone growth and development and its application. Background Art

[0002] Bone is an important supporting structure of the human body, which not only affects the body shape, but is also closely related to motor ability, posture maintenance and mineral storage. The health status of bones directly affects an individual's daily activity ability and quality of life. Bone growth and development refer to the morphological and functional changes of bones from birth to adulthood. This process includes bone formation, growth, maturation and remodeling. Currently, the treatment methods for poor bone growth and development include symptomatic treatment and surgical intervention. The commonly used treatment methods include: multiple long bone surgeries, growth hormone treatment, C-type natriuretic peptide (CNP). The above treatment methods have obvious clinical effects, but the surgical cost is high and there are many complications. Nutritional support means, such as supplementing calcium, vitamin D and collagen peptides, still have limitations in aspects such as the interaction between nutrients, individual differences and long-term effects. Therefore, there is still a need to develop a new type of product for promoting bone growth and development that can improve bioavailability and applicability for specific populations.

[0003] Zebrafish is a commonly used model organism, and its gene similarity with humans is higher than 85%. On the 5th day after fertilization, all organs in zebrafish are basically fully developed and their functions are similar to those of the human body. The bone development of zebrafish is extremely similar to the bone development process of other vertebrates. Therefore, it can be used to evaluate the efficacy of cartilage injury repair. Dexamethasone is a type of long-acting glucocorticoid, which can cause metabolic imbalance of chondrocytes, thereby triggering chondrocyte injury and ultimately leading to cartilage injury. Using dexamethasone to construct a cartilage injury model can effectively evaluate the efficacy of the test substance in promoting bone growth and development.

[0004] Lactobacillus paracasei, as a probiotic with broad application prospects, its unique biological characteristics make it one of the current research hotspots. Summary of the Invention

[0005] The purpose of the present invention is to provide a Lactobacillus paracasei ZhangGao185 for promoting bone growth and development and its application, which has good performance in promoting bone growth and development and can be effectively applied to the preparation of drugs or health foods for promoting bone growth and development.

[0006] In the first aspect of the present invention, a Lactobacillus paracasei ZhangGao185 for promoting bone growth and development is provided. The Lactobacillus paracasei ZhangGao185 was deposited with the China Center for Type Culture Collection on October 14, 2024, at the address No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the deposit number CCTCC NO: M20242203 and the survival status being alive.

[0007] Furthermore, for the Lactobacillus paracasei ZhangGao185 for promoting bone growth and development, the sequence of the 16S rDNA of the Lactobacillus paracasei ZhangGao185 is as shown in SEQ ID NO.1.

[0008] Furthermore, the colonies of the strain of the Lactobacillus paracasei ZhangGao185 are round, with a smooth surface, neat edges, and a milky white opaque color.

[0009] In the second aspect of the present invention, an application of the above-mentioned Lactobacillus paracasei ZhangGao185 in the preparation of a drug or health food for promoting bone growth and development is provided.

[0010] Furthermore, the drug or health food for promoting bone growth and development is a drug or health food for promoting the repair of cartilage damage.

[0011] Furthermore, the drug or health food for promoting bone growth and development is a drug or health food for improving osteoporosis or increasing bone density.

[0012] Furthermore, the drug or health food is a capsule, tablet, pill, granule, powder, or liquid preparation.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0014] 1. The present invention successfully constructed a zebrafish cartilage damage model and a zebrafish osteoporosis model. Compared with the model group, the Lactobacillus paracasei ZhangGao185 of the present invention can significantly promote the repair of craniofacial cartilage damage in zebrafish, increase the bone density and body length of zebrafish at a concentration of 1×10 5 CFU / mL.

[0015] 2. The Lactobacillus paracasei ZhangGao185 of the present invention was first isolated from the feces of healthy infants and young children. It is a Lactobacillus paracasei of the same species but different strains from the known Lactobacillus paracasei and has the potential to promote bone growth and development. It has good application prospects in the preparation of drugs or health foods for promoting bone growth and development. Description of the Drawings

[0016] Figure 1This is the phylogenetic tree map constructed by Lactobacillus paracasei ZhangGao185 and known Lactobacillus paracasei in Example 1 of the present invention;

[0017] Figure 2 This is the observation result diagram of the colonization of Lactobacillus paracasei ZhangGao185 in the intestine of zebrafish in Example 3 of the present invention;

[0018] Figure 3 This is the statistical result diagram of the colonization of Lactobacillus paracasei ZhangGao185 in the intestine of zebrafish in Example 3 of the present invention;

[0019] Figure 4 This is the observation result diagram of the effect of Lactobacillus paracasei ZhangGao185 on the repair of cartilage damage in zebrafish in Example 4 of the present invention;

[0020] Figure 5 This is the statistical result diagram of the effect of Lactobacillus paracasei ZhangGao185 on the repair of cartilage damage in zebrafish in Example 4 of the present invention;

[0021] Figure 6 This is the observation result diagram of the effect of Lactobacillus paracasei ZhangGao185 on the bone density of zebrafish in Example 5 of the present invention;

[0022] Figure 7 This is the statistical result diagram of the effect of Lactobacillus paracasei ZhangGao185 on the bone density of zebrafish in Example 5 of the present invention;

[0023] Figure 8 This is the statistical result diagram of the effect of Lactobacillus paracasei ZhangGao185 on the body length of zebrafish in Example 6 of the present invention. Detailed implementation manners

[0024] In order to better understand the technical content of the present invention, specific embodiments are provided below to further illustrate the present invention. The following describes the principles and features of the present invention. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention. All other implementation manners obtained by those skilled in the art without creative efforts fall within the scope protected by the present invention. In the description of the present invention, it should be noted that for those not specified in the examples, the conventional conditions or the conditions recommended by the manufacturer are followed. For the reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0025] Example 1. Obtaining and preservation of Lactobacillus paracasei ZhangGao185

[0026] The novel strain Lactobacillus paracei ZhangGao185 of the present invention was isolated from the feces of a healthy infant in Guangzhou City, Guangdong Province. The specific method is as follows:

[0027] Collect fresh feces using a 50 mL sterile centrifuge tube, transport them to the laboratory under cold chain, and after surface disinfection, transfer the samples to a biosafety cabinet. Add an appropriate amount of sterile water according to the feces quality for full dissolution, take an appropriate amount of the sample and spread it on an MRS culture plate, and culture it in an anaerobic workstation. After 48 hours, pick a single colony and inoculate it into a new MRS culture plate, and culture it in the anaerobic workstation. Refer to "Bergey's Manual of Determinative Bacteriology" (Eighth Edition) and "Manual of Fungal Classification and Identification", and observe the colony growth status. Name the strain isolated after purification, numbered ZhangGao185. The growth status of this strain is that the colony is round, with a smooth surface, neat edges, and a milky white opaque color.

[0028] The isolated Lactobacillus paracei ZhangGao185 was subjected to scale-up culture. After molecular identification of the isolated ZhangGao185 strain using 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG [SEQ ID NO.2], 1492R: TACGGCTACCTTGTTACGACTT [SEQ ID NO.3]), 16S sequencing was performed by Genewiz Biotechnology Co., Ltd. The obtained 16S rDNA sequence was subjected to BLAST alignment in the Genome database of NCBI. The alignment results showed that the homology of the 16S rDNA sequence of Lactobacillus paracei ZhangGao185 with the known Lactobacillus paracei was > 99%. Further construct a phylogenetic tree with homologous strains for analysis ( Figure 1 ), and confirm that the ZhangGao185 strain is a different strain of the same species of Lactobacillus paracei. The 16S rDNA sequence of Lactobacillus paracei ZhangGao185 of the present invention is shown in SEQ ID NO.1.

[0029] Lacticaseibacillus paracasei ZhangGao185 16S rDNA sequence (1446bp):

[0030]

[0031] The Lactobacillus paracasei ZhangGao185 of the present invention was deposited with the China Center for Type Culture Collection on October 14, 2024. The deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit number is CCTCC NO: M20242203, named Lactobacillus paracasei ZhangGao185, and its survival status is alive.

[0032] Example 2: Construction and testing methods of zebrafish model

[0033] This example is used to provide a construction method and a testing method for a zebrafish model. The zebrafish used in the present invention are transgenic cartilage fluorescent zebrafish Tg(Col2a1a:eGFP) and wild-type AB strain zebrafish, which are propagated by Guangdong Core Selection Inspection and Testing Co., Ltd. The specific construction method and testing method are as follows.

[0034] 1. Experimental reagents, materials and equipment

[0035] 1) Reagents and materials

[0036] The reagents and materials used in this example are shown in Table 1.

[0037] Table 1 Reagents and materials

[0038]

[0039] 2) Instruments and equipment

[0040] The instruments and equipment used in this example are shown in Table 2.

[0041] Table 2 Instruments and equipment

[0042]

[0043]

[0044] 3) Test article information

[0045] The test article information used in this example is shown in Table 3.

[0046] Table 3 Test article information

[0047]

[0048] 2. Testing method

[0049] 1) Intestinal colonization

[0050] Preparation of FITC working solution: Weigh an appropriate amount of FITC and prepare a 100 mg / mL FITC stock solution with DMSO. When in use, measure an appropriate amount of the FITC stock solution and add PBS to dilute it to a 1 mg / mL FITC working solution.

[0051] Staining: Take 1 mL of the bacterial solution into a 1.5 mL centrifuge tube and centrifuge at 10000×g for 5 min. After centrifugation, discard the supernatant, add 1 mL of the FITC working solution, disperse the bacterial solution with a vortex oscillator, and then place the centrifuge tube in a constant temperature incubator for dark staining for 1 h. After staining, place the centrifuge tube in a centrifuge and centrifuge at 10000×g for 5 min, discard the supernatant, add 1 mL of PBS for washing, and repeat this washing step 3 times. After washing, resuspend the bacterial solution with PBS.

[0052] Model construction and intervention: Select wild-type AB zebrafish at 3 dpf (days post fertilization) and place them in a cell culture plate. The experiment sets up a normal group, and groups of Lactobacillus paracasei ZhangGao185 at 10 3 CFU / mL, 10 4 CFU / mL, 10 5 CFU / mL. Add E3 culture water to the normal group, and add the corresponding concentration of bacterial solution (already stained with FITC solution) to the Lactobacillus paracasei ZhangGao185 groups, and place them in an incubator at 28.5 °C for intervention for several days.

[0053] Observation of intestinal fluorescence intensity: After the intervention, place the zebrafish under a fluorescence microscope to take pictures and observe the intestinal fluorescence intensity, and use Image J software to calculate the fluorescence intensity.

[0054] Data statistics: All data are statistically analyzed using GraphPad Prism 8, and the experimental data are expressed as mean±SEM. One-way ANOVA is used. Compared with the normal group: *P<0.05, **P<0.01, ***P<0.001.

[0055] 2) Bone growth and development

[0056] Model construction and intervention: Select healthy transgenic cartilage fluorescent zebrafish / wild-type AB zebrafish at 3 dpf (days post fertilization) and place them in a cell culture plate. The experiment sets up a normal group, a model group (dexamethasone), a positive group (alendronate sodium), and groups of Lactobacillus paracasei ZhangGao185 at 10 3 CFU / mL, 10 4 CFU / mL, 10 5CFU / mL Lactobacillus paracasei ZhangGao185 group. In the normal group, E3 culture water was added. In the model group, dexamethasone was added. In the positive group, a mixture of dexamethasone and alendronate sodium was added. In the Lactobacillus paracasei ZhangGao185 group, bacterial solutions containing dexamethasone at corresponding concentrations were added, and they were placed in an incubator at 28.5 °C for intervention for several days.

[0057] Craniofacial cartilage detection: After the intervention, the healthy transgenic cartilage fluorescent zebrafish were placed under a fluorescence microscope, photographed, and the fluorescence intensity of the craniofacial cartilage of the cartilage fluorescent zebrafish was observed. Image J software was used to calculate the fluorescence intensity.

[0058] Bone density detection: After the intervention, the wild-type AB strain zebrafish were washed several times and calcein staining was added. After the staining, they were photographed under a fluorescence microscope and the fluorescence intensity of the zebrafish bones was observed. Image J software was used to calculate the fluorescence intensity of the zebrafish bones.

[0059] Body length observation: After the intervention, the wild-type AB strain zebrafish were placed under a stereomicroscope to observe and measure the body length of the zebrafish.

[0060] Data statistics: All data were statistically analyzed using GraphPad Prism 8, and the experimental data were expressed as mean ± SEM. Analyzed by T-test, compared with the normal group: # P < 0.05, ## P < 0.01, ### P < 0.001; compared with the model group: & P < 0.05, && P < 0.01, &&& P < 0.001. Analyzed by one-way ANOVA, compared with the model group: * P < 0.05, ** P < 0.01, *** P < 0.001.

[0061] Example 3. Study on the colonization of Lactobacillus paracasei ZhangGao185 in the zebrafish intestine

[0062] Based on the zebrafish test model and the test method of observing intestinal fluorescence intensity in the intestinal colonization test method described in Example 2, the colonization of the Lactobacillus paracasei of the present invention in the zebrafish intestine was explored. The results of the colonization of Lactobacillus paracasei ZhangGao185 in the zebrafish intestine are as Figures 2 to 3 and Table 4 show. Among them, Figure 2 and Figure 3 are respectively the result observation diagram and statistical chart of the colonization of Lactobacillus paracasei ZhangGao185 in the zebrafish intestine (n = 6).

[0063] Table 4 Statistical table of the colonization of Lactobacillus paracasei ZhangGao185 in the intestines of zebrafish (n = 6)

[0064]

[0065] From Figures 2 to 3 and the results in Table 4, it can be seen that compared with the normal group, the fluorescence intensity in the intestines of zebrafish in the 10 3 CFU / mL and 10 4 CFU / mL Lactobacillus paracasei ZhangGao185 groups increased but without statistical significance (P > 0.05), and the fluorescence intensity in the intestines of zebrafish in the 10 5 CFU / mL Lactobacillus paracasei ZhangGao185 group increased extremely significantly (P < 0.001). Thus, it can be known that Lactobacillus paracasei ZhangGao185 of the present invention can colonize in the intestines of zebrafish.

[0066] Example 4. Effect of Lactobacillus paracasei ZhangGao185 on the repair of craniofacial cartilage injury in zebrafish

[0067] Based on the zebrafish test model and the method for detecting the repair of craniofacial cartilage injury in the bone growth and development test method described in Example 2, the effect of Lactobacillus paracasei of the present invention on the repair of craniofacial cartilage injury in zebrafish was explored. The effect of Lactobacillus paracasei ZhangGao185 on the repair of craniofacial cartilage injury in zebrafish is as shown in Figures 4 to 5 and Table 5. Among them, Figure 4 and Figure 5 are respectively the result observation diagram and statistical chart of the effect of Lactobacillus paracasei ZhangGao185 on the repair of cartilage injury in zebrafish (n = 6).

[0068] Table 5 Statistical table of the effect of Lactobacillus paracasei ZhangGao185 on the repair of cartilage injury in zebrafish (n = 6)

[0069]

[0070]

[0071] From Figures 4 to 5 and the results in Table 5, it can be seen that compared with the normal group, the fluorescence intensity of craniofacial cartilage in zebrafish in the model group decreased extremely significantly (P < 0.001), indicating that the establishment of the zebrafish cartilage injury model in this test was successful. Compared with the model group, the fluorescence intensity of craniofacial cartilage in zebrafish in the positive group increased significantly (P < 0.01), which was consistent with the clinical results, indicating that this test was effective. Compared with the model group, in the 10 3 CFU / mL and 10 4The fluorescence intensity of craniofacial cartilage in zebrafish in the Lactobacillus paracasei ZhangGao185 group at 10 CFU / mL increased, but there was no statistically significant difference (P>0.05). 5 The fluorescence intensity of craniofacial cartilage in zebrafish in the Lactobacillus paracasei ZhangGao185 group at 10 5 CFU / mL increased significantly (P<0.01). It can be seen from this that the Lactobacillus paracasei ZhangGao185 of the present invention can significantly repair cartilage damage in zebrafish.

[0072] Example 5. Effect of Lactobacillus paracasei ZhangGao185 on bone density of zebrafish

[0073] Based on the zebrafish test model and the method for detecting bone density in the bone growth and development test method described in Example 2, the effect of the Lactobacillus paracasei of the present invention on the bone density of zebrafish was explored. The effect of Lactobacillus paracasei ZhangGao185 on the bone density of zebrafish is as Figures 6 to 7 shown in Table 6. Among them, Figure 6 and Figure 7 are respectively the observation diagram and statistical chart of the effect of Lactobacillus paracasei ZhangGao185 on the bone density of zebrafish (n = 6).

[0074] Table 6 Statistical table of the effect of Lactobacillus paracasei ZhangGao185 on the bone density of zebrafish (n = 6)

[0075]

[0076] From Figures 6 to 7 and the results in Table 6, it can be seen that compared with the normal group, the fluorescence intensity of the bones of zebrafish in the model group decreased extremely significantly (P<0.001), indicating that the osteoporosis model of this test zebrafish was successfully established. Compared with the model group, the fluorescence intensity of the bones of zebrafish in the positive group increased significantly (P<0.01), indicating that this test was effective. Compared with the model group, the fluorescence intensity of the bones of zebrafish in the Lactobacillus paracasei ZhangGao185 groups at 10 3 CFU / mL, 10 4 CFU / mL, and 10 5 CFU / mL all increased extremely significantly (P<0.001). It can be seen from this that the Lactobacillus paracasei ZhangGao185 of the present invention can significantly increase the bone density of zebrafish.

[0077] Example 6. Effect of Lactobacillus paracasei ZhangGao185 on the body length of zebrafish

[0078] Based on the zebrafish test model and the method of observing body length in the bone growth and development test method described in Example 2, the effect of the Lactobacillus paracasei of the present invention on the body length of zebrafish was explored. The effect of Lactobacillus paracasei ZhangGao185 on the body length of zebrafish is as Figure 8 shown in Table 7. Among them, Figure 8 is a statistical chart of the effect of Lactobacillus paracasei ZhangGao185 on the body length of zebrafish (n = 6).

[0079] Table 7 Statistical table of the effect of Lactobacillus paracasei ZhangGao185 on the body length of zebrafish (n = 6)

[0080]

[0081] From Figure 8 and the results in Table 7, it can be seen that compared with the normal group, the body length of zebrafish in the model group was extremely significantly shortened (P < 0.001). Compared with the model group, the body length of zebrafish in the positive group was extremely significantly increased (P < 0.001). Compared with the model group, the body length of zebrafish in the 10 3 CFU / mL Lactobacillus paracasei ZhangGao185 group increased but there was no statistical difference (P > 0.05), and the body lengths of zebrafish in the 10 4 CFU / mL and 10 5 CFU / mL Lactobacillus paracasei ZhangGao185 groups were both significantly increased (P < 0.01). It can be seen from this that the Lactobacillus paracasei ZhangGao185 of the present invention can significantly increase the body length of zebrafish.

[0082] In summary, the Lactobacillus paracasei ZhangGao185 of the present invention can significantly promote the repair of craniofacial cartilage injury in zebrafish, increase the bone density and body length of zebrafish at a concentration of 1×10 5 CFU / mL, and has the potential to promote bone growth and development. It has good application prospects in the preparation of drugs or health foods for promoting bone growth and development.

[0083] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A Lactobacillus paracasei strain ZhangGao185 for promoting bone growth and development, characterized in that: The Lactobacillus paracasei ZhangGao185 was preserved by the China Center for Type Culture Collection on October 14, 2024, with the preservation address being No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the preservation number being CCTCC NO:M 20242203, and the survival status being alive.

2. The Lactobacillus paracasei ZhangGao185 for promoting bone growth and development according to claim 1, characterized in that The sequence of 16S rDNA of the Lactobacillus paracasei ZhangGao185 is shown in SEQ ID NO.

1.

3. The Lactobacillus paracasei ZhangGao185 for promoting bone growth and development according to claim 1, characterized in that The colony of the Lactobacillus paracasei strain ZhangGao185 is round, has a smooth surface, neat edges, and is milky white and opaque.

4. Use of the Lactobacillus paracasei ZhangGao185 for promoting bone growth and development as claimed in any one of claims 1 to 3 in the preparation of medicines or health foods for promoting bone growth and development.

5. The use according to claim 4, characterized in that The medicine or health food for promoting bone growth and development is a medicine or health food for promoting cartilage damage repair.

6. The use according to claim 4, characterized in that The medicine or health food for promoting bone growth and development is a medicine or health food for improving osteoporosis or increasing bone density.

7. The use according to any one of claims 4 to 6, characterized in that: The medicine or health food is in the form of capsules, tablets, pills, granules, powders or liquid preparations.

Images