Bacillus subtilis and application thereof
By using Bacillus subtilis strain TXB2 to degrade Jinduer, the problem of herbicide harm in buckwheat fields was solved, efficient degradation and drug harm relief for Jinduer was achieved, and environmentally friendly and safe and harmless.
Patent Information
- Application Number
- CN202510233984.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-05-30
AI Technical Summary
There is a lack of effective methods in the prior art to degrade and alleviate the drug damage caused by the herbicide Jinduer used in buckwheat fields.
Using Bacillus subtilis strain TXB2, a bacteria agent used to degrade herbicides was prepared through its ability to degrade Jindul. This strain was able to significantly degrade the herbicide at different concentrations of Jindul and relieve drug damage in soil and plants.
The Bacillus subtilis strain TXB2 significantly improved the degradation rate of Jindul, alleviated the harm of buckwheat to the herbicide, and had no pollution impact on the environment and human and animal safety, and had good development and application prospects.
Smart Images

Figure CN120060043A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of Jindul degradation, and more particularly to a Bacillus subtilis strain and application thereof. Background Art
[0002] Weeds in buckwheat fields are a major factor affecting buckwheat yield. Current control measures fail to fully utilize agricultural and mechanical measures, relying primarily on chemical herbicides. However, buckwheat is particularly sensitive to herbicides. Herbicides used to control grass weeds during the seedling stage must be strictly controlled. For broadleaf weeds in buckwheat fields, no herbicides are available after emergence, and soil sealing treatment with individual amide herbicides, such as Kindol (S-isopropylamine), is the only option. However, growers often fail to accurately measure the size of the fields and accurately weigh the amount of herbicide and water used, often leading to herbicide damage. There is no research on herbicide damage control in buckwheat fields, both domestically and internationally, and there is a lack of measures to address herbicide damage and environmental hazards during the planting process.
[0003] Using microorganisms such as bacteria and fungi to mitigate herbicide damage and degrade herbicides is a safe, pollution-free method that helps improve crop quality, yield, and safety. However, no strains have been reported that can degrade the herbicide Jindul.
[0004] In summary, how to provide a degrading bacterium for the herbicide Jindul to alleviate the herbicide Jindul's phytotoxicity to buckwheat is an urgent problem to be solved by those skilled in the art. Summary of the Invention
[0005] In view of this, the present invention provides a Bacillus subtilis strain and applications thereof.
[0006] In order to achieve the above object, the present invention adopts the following technical solutions:
[0007] A Bacillus subtilis TXB2, the Bacillus subtilis is named TXB2, and its classification name is Bacillus subtilis. It was deposited in the China Center for Type Culture Collection on May 19, 2022, with a deposit number of CCTCC NO: M 2022679, and the deposit address is Wuhan University, Wuhan, China.
[0008] The application of the above-mentioned Bacillus subtilis TXB2 in the degradation of the herbicide Jindul.
[0009] The above-mentioned Bacillus subtilis TXB2 is used to alleviate the damage caused by Jindul in plants.
[0010] The application of the above-mentioned Bacillus subtilis TXB2 in increasing plant yield and thousand-grain weight.
[0011] Furthermore, the plant is buckwheat.
[0012] A herbicide Jindul-degrading bacterial agent comprises the above-mentioned Bacillus subtilis TXB2.
[0013] It can be seen from the above technical solutions that, compared with the prior art, the present invention has the following beneficial effects:
[0014] The Jindal-degrading bacteria of the present invention are Bacillus subtilis TXB2. Bacillus subtilis TXB2 degrades Jindal in a culture medium for 7 days, achieving a degradation rate of 32.39%. The degradation rate of Jindal in a culture medium for 21 days is 40.47%. The Bacillus subtilis TXB2 provided by the present invention is used to rapidly degrade Jindal, alleviate phytotoxicity during the buckwheat seedling stage, is safe for humans and animals, poses no environmental pollution, and has good development and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.
[0016] Figure 1 This is a diagram showing the results of a flat plate test in Example 2 of the present invention;
[0017] Figure 2 This is a strain morphology diagram of strain TXB2 in Example 4 of the present invention;
[0018] Figure 3 This is the Gram staining of strain TXB2 in Example 4 of the present invention;
[0019] Figure 4 This is the phylogenetic tree of strain TXB2 in Example 4 of the present invention. DETAILED DESCRIPTION
[0020] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0021] The reagents required for the present invention are conventional experimental reagents, purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.
[0022] The culture medium components used in the following examples are as follows:
[0023] LB solid medium: peptone 10 g, yeast extract powder 5 g, NaCl 10 g, agar 15 g, distilled water 1000 mL.
[0024] LB liquid medium: peptone 10 g, yeast extract powder 5 g, NaCl 10 g, distilled water 1000 mL.
[0025] PDA medium: 200 g peeled potatoes, 18 g agar, 20 g glucose, 1000 mL distilled water.
[0026] Basic inorganic salt culture medium: KH2PO4 1.6 g, K2HPO4 0.52 g, NH4NO3 1.0 g, NaCl 0.5 g, MgSO4·7H2O 0.5 g, distilled water 1000 mL.
[0027] Carbon source determination basal culture medium: KH2PO4 2.38 g, K2HPO4·3H2O 5.65 g, (NH4)2SO4 2.64 g, MgSO4·7H2O 1 g, CuSO4·5H2O 6.4 mg, ZnSO4·7H2O 1.5 mg, FeSO4·7H2O 1.1 mg, MnCl2·7H2O 7.9 mg, agar 15 g, distilled water 1000 mL.
[0028] Nitrogen source determination basal medium: glucose 10 g, K2HPO4·3H2O 1 g, MgSO4·7H2O 5 g, NaCl 5 g, FeSO4·7H2O 10 mg, agar 15 g, distilled water 1000 mL.
[0029] Malonate test medium: sodium malonate 3 g, yeast extract 1 g, NaCl 2 g, (NH4)2SO4 2 g, KH2PO4 0.4 g, K2HPO4·3H2O 0.6 g, bromothymol blue 25 mg, distilled water 1000 mL, pH 7.4.
[0030] Methyl red test medium: peptone 7.0 g, glucose 5 g, NaCl 5 g, distilled water 1000 mL.
[0031] Starch hydrolysis test medium: soluble starch 2 g, beef extract 3 g, peptone 5 g, glucose 2.5 g, agar 18 g, distilled water 1000 mL, pH 7.0.
[0032] Fat hydrolysis test medium: peptone 10 g, CaCl2·2H2O 0.1 g, agar 17 g, distilled water 1000 mL, pH 7.4.
[0033] NA medium: 3 g beef extract, 5 g peptone, 2.5 g glucose, 18 g agar, 1000 mL distilled water, pH 7.0.
[0034] Example 1
[0035] Isolation of strains
[0036] Soil samples were collected from a farm plot in the new district of Inner Mongolia Agricultural University in Hohhot, Inner Mongolia, at a distance of 0 to 10 cm from the ground surface. 5 g of soil sample was weighed and placed in 95 mL of liquid basic inorganic salt culture medium. Jinduer was added as the only carbon source for microbial growth to make the final concentration of Jinduer 50 mg / L. The sample was cultured on a shaker at 150 r / min and 28 ° C. After enrichment culture for 7 days, 1 mL was transferred to a basic inorganic salt culture medium containing 100 mg / L Jinduer and cultured for 7 days. Then 1 mL was transferred to a basic inorganic salt culture medium containing 150 mg / L Jinduer and cultured for 7 days. By gradually increasing the concentration of Jinduer, the selection pressure of herbicides on microorganisms was increased, aiming to isolate and screen highly efficient herbicide-degrading strains. After 21 days of enrichment culture, the basic inorganic salt culture medium was made into 10 -1 , 10 -3 , 10 -4 , 10 -5 Different concentrations, take different concentrations of culture solution 200μL and apply it to PDA and LB culture medium respectively, apply 10 -3 concentration culture medium, 10 -4 and 10 -5 Concentrated culture medium was used to separate fungi and bacteria, repeated 3 times, and cultured in a 25℃ constant temperature box for 2-5 days after inoculation. Single colonies with different morphologies were picked for purification, numbered, preserved and set aside.
[0037] Example 2
[0038] Preliminary screening of Jindul-degrading bacteria by plate assay
[0039] The isolated bacterial strains were purified twice on LB medium by the plate streak method, and the fungal strains were purified twice on PDA medium by the single spore separation method. The purified bacterial strains were spread on LB medium by the dilution coating plate method and cultured for 3 days, and the fungal strains were inoculated in PDA medium and cultured for 5 days. Take 500μL of the herbicide Jindul and quickly add it to 99.5mL of basic inorganic salt culture medium at a temperature of 40±2.5℃ to make the total amount of solution in the culture medium 100mL. Mix it immediately and pour it into the glass culture dish before the culture medium solidifies, 20mL per dish. After the culture medium solidifies in the culture dish, the isolated bacteria and fungi cakes with a diameter of 5mm are inverted and inoculated into the culture dish. The uninoculated culture dish is used as a control. Each treatment is repeated 3 times and cultured at a constant temperature of 25℃. Observe whether there is a transparent circle around the cake. The diameter of the transparent circle is measured after 7 days of culture. The presence of a transparent circle is used to preliminarily judge whether the strain can utilize the herbicide Jindul. The results are shown in Table 1. Figure 1 shown.
[0040] Table 1 Flat plate test results
[0041]
[0042] After initial screening, a strain was isolated and named TXB2. The strain TXB2 showed a clear zone with a diameter of 1.35 cm on the plate and was able to utilize the herbicide Jindul.
[0043] Example 3
[0044] Determination of the degradation rate of Jindul by strain TXB2
[0045] Determination method of Jindul degradation rate: take the concentration of 1×10 8 5 mL of the bacterial culture solution with a CFU / mL to be tested was aseptically transferred into 95 mL of basic inorganic salt culture medium with a Jindul concentration of 100 mg / L, and cultured at a constant temperature of 25°C and 180 r / min in a shaker for 7 and 21 days to obtain the test solution. 5 mL of the test solution was placed in a 50 mL centrifuge tube, 5 mL of acetonitrile was added, and the solution was shaken for 1 hour on a shaker at 25°C and 220 r / min. 1 g of NaCl was added and shaken until the liquid stratification was clearly observed. Then centrifuged at 4000 g for 5 minutes, the upper organic liquid was aspirated with a pipette, the supernatant was filtered with a 0.22 μm disposable filter, and the degradation rate was determined by high performance liquid chromatography after filtration.
[0046] Instrumental Conditions: Determine the concentration of S-metolachlor in samples by liquid chromatography using a mobile phase of acetonitrile: ultrapure water (20:80, v / v). The detection wavelength for S-metolachlor is 254 nm, the flow rate is 1.0 mL / min, the injection volume is 5 μL, the column temperature is 25°C, and the retention time is 8 min. The substance is identified by its peak elution time, and the S-metolachlor content is quantitatively calculated based on its peak area.
[0047]
[0048] The results are shown in Table 2.
[0049] Table 2 Degradation rate of isolated strains to S-isopropylamine
[0050]
[0051]
[0052] Example 4
[0053] Identification of strain TXB2
[0054] (1) Morphological identification
[0055] The strain was spread on LB solid medium by dilution method and single colonies grew out. The colonies of strain TXB2 were milky white, opaque, with irregular edges, wrinkles, and a depression in the middle. Figure 2 ).
[0056] (2) Physiological and biochemical identification
[0057] The test was carried out with reference to the Manual of Identification of Common Bacteria Systems, and the physiological and biochemical indicators of the strains, such as carbon source and nitrogen source utilization, malonate utilization, methyl red test, starch hydrolysis, oxidase test and catalase test, were determined. Strain TXB2 is a Gram-positive bacterium ( Figure 3 ), can decompose starch and fat, can use glucose and mannitol as the sole carbon source, and can use ammonium nitrate and ammonium sulfate as the sole nitrogen source, see Table 3 for details.
[0058] Table 3 Physiological and biochemical characteristics of strain TXB2
[0059]
[0060] Note: “+” indicates positive, “-” indicates negative.
[0061] (3) Molecular biological identification
[0062] DNA was extracted according to the instructions of the TIAN GEN Bacterial Genomic DNA Extraction Kit (spin column type) (Beijing, China), which was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. The PCR primers for strain TXB2 were 27F and 1492R, 7F and 1540R, rpoBF and rpoBR, and trpBF and trpBR, respectively. The primer sequences are detailed in Table 4 .
[0063] A 25 μL reaction system contained: 17 μL ddH2O, 2.5 μL 10× PCR Buffer, 2 μL dNTPs, 1 μL upstream primer, 1 μL downstream primer, 0.5 μL Taq DNA polymerase, and 1 μL template DNA. PCR reaction conditions: initial denaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at 30 s; 72°C for 1 min; 34 cycles; and 72°C for 10 min.
[0064] The PCR products of the four genes were detected by 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotechnology Co., Ltd. for 16S rDNA sequencing. The sequencing results are as follows. The four gene sequences obtained were spliced and compared with the Gen Bank nucleic acid database. The strain sequences with high similarity were selected for analysis. The phylogenetic tree was constructed using MEGA7.0 software. Strain TXB2 was clustered with Bacillus subtilis (Bacillus subtilis) ( Figure 4 ).
[0065] Table 4 Primers and sequences
[0066]
[0067]
[0068] 27F 1492R:
[0069]
[0070] 7F 1540R:
[0071]
[0072] rpoBR rpoBF:
[0073]
[0074] trpBF trpBR:
[0075] ATGTACGCCCAATCCAAATGATGCTGGTAAAAAACAGATTTTCCATTGTAACATAAGTTGACAAAAAGAAAAAGGGAAGCAGCCAAACGGCTATTTCCCCTTTTTTATAGTGATGCTTCAAAATTGACAGCACATCTTCTTTGTTGAGTGATTTAAATTGGCCGAATGTACCGTTAGCCATTGCCTTGTCAGCAATTGTGTCAAGCTGCTCATCATTAATATCATAATCAGCAAGACGGT TCGGAGCGCCAAGGCTTGTCCAGAATGCGGACAGCTTATCGATACCTTCAAGGGCAATTTCTTCATCCGTTTTACCTGCTTCTTCAACATCAAACACGCGAACTGCAAGCTGTTTCATGCGGGCAGGGTTTTCAGACAATGTGTGTCTCATCCAGTTCGGGAACAAAATTGCCAGTCCGCCGGCATGCGGAATATCATAAACGGCTGATACTGCATGTTCAATATGTGAGTGCCACAA, SEQ. ID NO.12.
[0076] Based on the results of morphological, physiological and biochemical tests and molecular biological identification, strain TXB2 was identified as Bacillus subtilis.
[0077] (4) Preservation
[0078] The Bacillus subtilis is named TXB2, and its classification name is Bacillus subtilis. It was deposited in the China Center for Type Culture Collection on May 19, 2022, with the deposit number CCTCCNO: M 2022679, and the deposit address is Wuhan University, Wuhan, China.
[0079] Example 5
[0080] Effect of strain TXB2 on alleviating Jindul phytotoxicity in pot experiments
[0081] Buckwheat seeds were mixed with strain TXB2 and then sprayed with herbicides of different concentrations. The effect of strain TXB2 in degrading Jindul and alleviating herbicide damage was analyzed by changing the herbicide damage index.
[0082] The strain TXB2 was cultured in LB liquid medium at 25°C and 180 r / min in a shaking incubator and diluted to 1×10 8 CFU / mL, make the fungicide; for buckwheat seeds, add 20mL of fungicide to every 20g of seeds, mix evenly, and place in a cool and dry place to dry for later use.
[0083] There were two potted trials: one using sterilized soil (July 2023) and one using non-sterilized soil (December 2023).
[0084] In the first potted experiment, soil samples were taken from the farm of Inner Mongolia Agricultural University, sterilized in an oven at 180°C for 2 h, and mixed with vermiculite at a volume ratio of 2:1 before use. In the second potted experiment, soil from the New District Farm of Inner Mongolia Agricultural University was used directly without sterilization. The rest of the test was the same as the first potted experiment.
[0085] Each treatment was set to 0, 80, 100, 120, 140, 160 mL / 667 m 2 There were 6 herbicide concentrations and 3 replicates.
[0086] After sowing, cover the soil with 2 to 3 cm of soil. Calculate the soil surface area based on the diameter of the soil in different flower pots. 2 Water consumption: 60kg, herbicide: 0, 80, 100, 120, 140, 160mL / 667m 2 Six different concentrations were used, and the water and pesticide application rates were calculated proportionally based on the soil surface area of the pots. The herbicide Jindul was then sprayed immediately. Ten days after sowing, the level of pesticide damage was assessed according to the pesticide damage grading standard (Table 5), and the pesticide damage index and the reduction rate were calculated.
[0087] Table 5 Buckwheat herbicide Jindul phytotoxicity grading standards
[0088]
[0089] Note: During the investigation, the number of damaged buckwheat seedlings and the damage level were recorded, and the pesticide damage index and pesticide control efficacy were calculated.
[0090]
[0091] The results are shown in Tables 6, 7, 8 and 9.
[0092] Table 6 Injury index of buckwheat after seed dressing with bacterial strains and spraying with Jinduer (July 2023, soil sterilization)
[0093]
[0094] Table 7 The rate of reduction of the phytotoxicity of buckwheat after spraying with Jinduer by seed dressing with bacterial strains (%) (July 2023, soil sterilization)
[0095]
[0096] Table 8 Injury index of buckwheat after seed dressing with strains and spraying with Jinduer (December 2023, soil not sterilized)
[0097]
[0098] Table 9: The rate of reduction of phytotoxicity of buckwheat after spraying with Jinduer by seed dressing with bacterial strains (%) (December 2023, soil not sterilized)
[0099]
[0100] The results are shown in Tables 6, 7, 8, and 9. The herbicide was applied at 80, 100, 120, 140, and 160 mL / 667 m 2 When the soil was sterilized or not, the strain TXB2 could alleviate the damage of Jinduer to buckwheat to varying degrees. 2 The best effect was achieved when the herbicide dosage was 55.4% when sterilized and 35.2% when not sterilized.
[0101] Example 6
[0102] Effect of strain TXB2 on alleviating Jindul phytotoxicity in field trials
[0103] Buckwheat seeds were mixed with strain TXB2 and then sprayed with herbicides of different concentrations. The effect of strain TXB2 in degrading Jindul and alleviating herbicide damage was analyzed by changing the herbicide damage index.
[0104] The experiment was conducted at the Inner Mongolia Agricultural University teaching base in Hailiutu, Tumote Left Banner, Hohhot, Inner Mongolia. 2 The seed pretreatment method of dressing with bacterial solution was the same as that in Example 5.
[0105] The seeds were sown on July 20, 2023, with a row spacing of 40 cm. A furrow opener was used to open a furrow with a depth of 4 to 5 cm. The seeds mixed with the bacterial solution were sown and immediately covered with soil. Then, different concentrations of soil-sealed herbicide Jindul were immediately applied. The herbicide was diluted at 1000 rpm per 667 m 2 Water consumption: 60kg, herbicide: 0, 80, 100, 120, 140, 160mL / 667m 2 6 different concentrations were used. 15 days after sowing, the level of phytotoxicity was investigated according to the phytotoxicity grading standard (Table 5), and the phytotoxicity index and the phytotoxicity reduction ratio were calculated using the same calculation formula as in Example 5.
[0106] The effect of strain TXB2 in alleviating phytotoxicity to buckwheat seedlings can be seen in Tables 10 and 11.
[0107] Table 10 Injury index of buckwheat after seed dressing with bacterial strains and spraying with Jinduer in field trials
[0108]
[0109] Table 11 Effect of bacterial strain seed dressing on reducing the damage of buckwheat after spraying with Jinduer in field trials (%)
[0110]
[0111] From Table 10 and Table 11, we can see that the application of herbicide 80, 100, 120, 140, 160mL / 667m 2 When the strain TXB2 was used, it could alleviate the damage of Jinduer to buckwheat to varying degrees. 2 The herbicide dosage was 140mL / 667m, and the herbicide damage alleviation rates were 47.2% and 40.5% respectively. 2 When the herbicide was used at a certain dosage, the rate of phytotoxicity alleviation was 33.5%.
[0112] Example 7
[0113] Effects of strain TXB2 on improving buckwheat yield and 1000-grain weight in field trials
[0114] Buckwheat seeds were mixed with strain TXB2 and then sprayed with different concentrations of herbicides. The yield-increasing effect of the isolated strain was analyzed by changes in yield and 1000-grain weight.
[0115] The experiment was conducted at the Inner Mongolia Agricultural University teaching base in Hailiutu, Tumote Left Banner, Hohhot, Inner Mongolia. 2 Six concentrations of the herbicide Jindul and one manual weeding control were used, with three replicates. The seed pretreatment method for dressing with bacterial solution was the same as in Example 5.
[0116] The seeds were sown on July 20, 2023, with a row spacing of 40 cm. A furrow opener was used to open a furrow with a depth of 4 to 5 cm. The seeds mixed with the bacterial solution were sown and immediately covered with soil. Then, different concentrations of soil-sealed herbicide Jindul were immediately applied. The herbicide was diluted at 1000 rpm per 667 m 2 Water consumption: 60kg, herbicide: 0, 80, 100, 120, 140, 160mL / 667m 2 Six different concentrations were used. Yield and 1000-grain weight were measured after harvest. The yield-increasing effect of strain TXB2 is shown in Tables 12 and 13.
[0117] Table 12 Effect of bacterial strain seed dressing on buckwheat yield after spraying Jinduer in field trials (kg / 667m2 )
[0118]
[0119] Table 13 Effect of bacterial strain seed dressing on buckwheat thousand-grain weight (g) after spraying Jinduer in field trials
[0120]
[0121] As shown in Table 12, when the fungicide CK was not applied, the dosage of the herbicide Jindul was 100 mL / 667 m 2 The output is 84.1kg / 667m 2 , and the yield of the manual weeding control was 85.2kg / 667m 2 There is no significant difference, indicating that the dosage of Jindul is 100mL / 667m 2 When the dosage of Jinduer is greater than 100mL / 667m 2 The yield was significantly lower than that of the manual weeding control, indicating that it was greater than 100mL / 667m 2 When applying the fungicide TXB2, the dosage of Jinduer is 80~160mL / 667m 2 The output of CK is greater than that of CK.
[0122] As shown in Table 13, when the fungicide CK was not used, the dosage of the herbicide Jindul was 80 mL / 667 m 2 When the 1000-grain weight was 22.2 g, there was no significant difference from the 1000-grain weight of 22.6 g in manual weeding, indicating that the dosage of Jindul was 80 mL / 667 m 2 It is safe for buckwheat and does not reduce the thousand-grain weight. When the dosage of Jinduer is greater than 100mL / 667m 2 , the thousand-grain weight was significantly lower than that of the manual weeding control, indicating that it was greater than 100mL / 667m 2 The amount of herbicide used will reduce the thousand-grain weight of buckwheat. When using TXB2 fungicide, the dosage of Jinduer is 100mL / 667m 2 There was no difference in yield between the control group and the manual weeding group, indicating that the fungicide could alleviate the weeding problem of 100mL / 667m 2 The phytotoxicity of Jindul to buckwheat slowed down the reduction of thousand-grain weight.
[0123] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.
[0124] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A strain of Bacillus subtilis TXB2, characterized in that: The Bacillus subtilis is named TXB2, and its classification name is Bacillus subtilis. It was deposited in the China Center for Type Culture Collection on May 19, 2022, with the deposit number CCTCC NO: M 2022679, and the deposit address is Wuhan University, Wuhan, China.
2. Use of the Bacillus subtilis TXB2 according to claim 1 in degrading the herbicide Kindol.
3. Use of the Bacillus subtilis TXB2 according to claim 1 in alleviating Jindul pesticide damage to plants.
4. Use of the Bacillus subtilis TXB2 according to claim 1 in increasing plant yield and thousand-grain weight.
5. The use according to any one of claims 3 or 4, characterized in that: The plant is buckwheat.
6. A herbicide Jindul degrading bacterial agent, characterized in that: Comprising the Bacillus subtilis TXB2 described in claim 1.
Citation Information
Cited By
Sorghum straw biochar for saline-alkali soil improvement and preparation method thereof
CN122321806A