Gordonia sp. capable of degrading multiple phthalic acid esters and its application in repairing phthalic acid ester-polluted soil

Abstract

The present invention discloses Gordonia for degrading various phthalic acid esters and its application in repairing phthalic acid ester-polluted soil. A strain of Gordonia FV1 was isolated from contaminated soil, and its microbial preservation number is: CGMCC No. 30310. This strain still has excellent degradation ability for phthalic acid esters within the temperature range of 10-60 °C or within the pH value range of 5.0-11.0, and has strong environmental adaptability. The Gordonia FV1 can degrade 14 phthalic acid esters, covering short-chain PAEs, medium-chain PAEs, long-chain PAEs, and complex-chain PAEs. Applying the Gordonia FV1 to bioremediate soil can effectively remove bis(2-ethylhexyl) phthalate in the soil. The present invention has application prospects in aspects such as microbial degradation of phthalic acid esters and bioremediation of soil.

Description

Technical Field

[0001] The present invention relates to microbial strains for bioremediating soil, and particularly to Gordonia for degrading phthalate esters and its application in remediating PAEs-polluted soil, belonging to the field of Gordonia and its application in soil bioremediation. Background Art

[0002] Phthalate ester acids (PAEs) are widely used as plasticizers. Although PAEs can improve the flexibility and durability of plastics, they are easily released into the environment, causing serious environmental pollution. PAEs have environmental estrogen effects, interfering with the human endocrine system, nervous system, etc., and threatening human health. Six PAEs (DMP, DEP, DBP, BBP, DOP, and DEHP) are listed as priority environmental pollutants. Currently, researchers at home and abroad have isolated many PAEs-degrading bacteria from various environmental samples. However, these PAEs-degrading bacteria have a narrow substrate spectrum, cannot degrade PAEs with complex side chains, or have poor environmental adaptability, affecting their application in environmental remediation. For example, Gordonia LUNF6 can only degrade six PAEs with relatively simple side chain structures in neutral or alkaline sewage conditions (Publication No.: CN 118308275 A). Therefore, it is urgent to screen PAEs-degrading bacteria with a wider substrate spectrum, capable of degrading PAEs with complex side chains, and stronger environmental adaptability for application in the remediation of phthalate ester-polluted soil. Summary of the Invention

[0003] One of the objectives of the present invention is to provide a strain of Gordonia for degrading various phthalate esters (PAEs).

[0004] Another objective of the present invention is to apply the Gordonia to degrade phthalate esters.

[0005] A third objective of the present invention is to apply the Gordonia to bioremediate soil polluted by phthalate esters.

[0006] To achieve the above objectives, the main technical solutions adopted by the present invention include:

[0007] On the one hand, the present invention provides a strain of Gordonia ( Gordonia sp. ) FV1, whose microbial deposit number is CGMCC No. 30310; its taxonomic name is: Gordonia Gordonia sp. ; the deposit time is: April 11, 2024; the deposit unit is: China General Microbiological Culture Collection Center; the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The colony morphology of Gordonia described in the present invention is as follows: the colony is round and red.

[0009] The Gordonia FV1 isolated in the present invention still has excellent degradation ability for phthalate esters within the temperature range of 10 - 60 °C or within the pH value range of 5.0 - 11.0; this Gordonia FV1 can degrade 14 phthalate esters, covering short-chain PAEs, medium-chain PAEs, long-chain PAEs, and complex-chain PAEs; this Gordonia FV1 can be used for bioremediation of soil to degrade phthalate esters in the soil.

[0010] Another aspect of the present invention is to apply the described Gordonia to degrade phthalate esters or bioremediate soil.

[0011] In a preferred specific embodiment of the present invention, the described Gordonia is applied to degrade phthalate esters.

[0012] In a preferred specific embodiment of the present invention, the phthalate esters include dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, butyl benzyl phthalate, dicyclohexyl phthalate, bis(2-ethylhexyl) phthalate, or diisobutyl phthalate, etc.

[0013] In a preferred specific embodiment of the present invention, the described Gordonia is applied to bioremediate contaminated soil.

[0014] In a preferred specific embodiment of the present invention, the contaminated soil contains phthalate esters.

[0015] In a preferred specific embodiment of the present invention, the phthalate esters include dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, butyl benzyl phthalate, dicyclohexyl phthalate, bis(2-ethylhexyl) phthalate, diisobutyl phthalate.

[0016] Another aspect of the present invention is to provide a method for bioremediation of soil, including: preparing the described Gordonia into a microbial inoculant; inoculating the microbial inoculant into contaminated soil for microbial degradation.

[0017] A Gordonia sp. strain FV1 was isolated from contaminated soil. This strain can efficiently degrade phthalic acid esters within a wide temperature range (10 - 60 °C) and pH value range (5.0 - 11.0), and has strong environmental adaptability. The Gordonia sp. strain FV1 can degrade a variety of phthalic acid esters, including dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, benzyl butyl phthalate, dicyclohexyl phthalate, bis(2-ethylhexyl) phthalate, diisobutyl phthalate, etc., a total of 14 phthalic acid esters, covering short-chain PAEs, medium-chain PAEs, long-chain PAEs, and complex-chain PAEs. Applying the Gordonia sp. strain FV1 to bioremediate soil can effectively remove phthalic acid esters from the soil, and has application potential in bioremediating soil. Description of the Drawings

[0018] Figure 1 It is a colony morphology diagram of Gordonia sp. strain FV1.

[0019] Figure 2 It is a phylogenetic analysis of Gordonia sp. strain FV1.

[0020] Figure 3 It is a statistical chart of the degradation of DEHP by Gordonia sp. strain FV1 at different temperatures.

[0021] Figure 4 It is a statistical chart of the degradation of DEHP by Gordonia sp. strain FV1 at different pH values.

[0022] Figure 5 It is the PAEs substrate spectrum of Gordonia sp. strain FV1.

[0023] Figure 6 It is a statistical chart of the degradation of DEHP in soil by Gordonia sp. strain FV1. Detailed Embodiments

[0024] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, it should be understood that the described embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that without departing from the spirit and scope of the present invention, modifications or substitutions can be made to the details and forms of the technical solutions of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.

[0025] Example 1 Isolation and Identification of Gordonia sp. Strain ( Gordonia sp. ) FV1

[0026] 1 Experimental methods

[0027] Composition of TEM medium: CaCl2 0.01 g / L, K2HPO4 1.5 g / L, (NH4)2SO4 (2.0), MgSO4·7H2O 0.2 g / L, Na2HPO4·12H2O 1.5 g / L, TES 100 μL.

[0028] Composition of TES: FeSO4·7H2O 5 g / L, MnSO4·2H2O 1.43 g / L, ZnSO4·7H2O 0.022 g / L, CuSO4·5H2O 0.03 g / L, Na2WO4·2H2O 0.023 g / L, Na2MoO4·2H2O 0.02 g / L, CoSO4·7H2O 0.12 g / L.

[0029] Add 10 g of plastic-polluted soil to 100 mL of TEM liquid medium, and then add DEHP to a final concentration of 0.5 mM. Incubate at 180 rpm and 30 °C for 7 days. Take 1 mL of the culture solution and transfer it to TEM liquid medium containing 0.5 mM DEHP, and incubate under the same conditions. Repeat the transfer 5 times. Spread the cultured bacterial solution on a TEM solid plate (containing 0.5 mM DBP) and incubate at 30 °C for 5 days. Select the single colony with a clear zone around it and name it FV1, and perform molecular identification on strain FV1. Extract the genome of strain FV1, use the genomic DNA as a template, and amplify the 16S rRNA gene fragment using primers 27F and 1492R. Send the amplification product to the company for sequencing, retrieve homologous sequences in NCBI, and construct a phylogenetic tree using MEGA11.

[0030] The nucleotide sequences of primers 27F and 1492R are as follows:

[0031] 27F: AGTTTGACMTGGCTCAG (SEQ ID No.1);

[0032] 1492R: CGGTTACCTTGTTACGACTT (SEQ ID No.2).

[0033] Experimental results

[0034] Through the enrichment and domestication of PAEs-degrading bacteria in the contaminated soil samples, there is a clear zone around the single colony of strain FV1 on the plate. The colony morphology of strain FV1 is as Figure 1 shown, the colony is round and red. According to the sequencing results of the 16S rRNA gene fragment and the phylogenetic tree ( Figure 2 ), it is confirmed that strain FV1 belongs to GordoniaGenus, and it was named Gordonia ( Gordonia sp. ) FV1.

[0035] Test Example 1 Degradation Characteristics Test of Gordonia FV1 on PAEs

[0036] 1 Degradation Test of Gordonia FV1 on PAEs at Different Temperatures

[0037] DEHP was added to 10 mL of TEM liquid medium (pH value 8.0) to a final concentration of 0.5 mM, and 200 μL of Gordonia FV1 bacterial solution was inoculated. No bacterial solution was added to the control group. Three independent replicates were set up and cultured with shaking at 180 rpm for 24 h at different temperatures (10°C, 20°C, 30°C, 40°C, 50°C, 60°C). The residual amount of DEHP in the sample was determined by HPLC.

[0038] After 24 hours of culture, Gordonia FV1 maintained a high degradation activity on DEHP under different temperature conditions and had good adaptability to temperature. The test results are as Figure 3 shown. In the range of 20 - 60°C, Gordonia FV1 maintained a degradation rate of more than 90% on DEHP. At 20 - 40°C, Gordonia FV1 almost completely degraded DEHP. At 10°C, Gordonia FV1 still degraded more than 50% of DEHP, showing excellent degradation ability of Gordonia FV1 on DEHP in a wide temperature range.

[0039] Degradation Test of Gordonia FV1 on PAEs at Different pH Values

[0040] DEHP was added to 10 mL of TEM liquid medium (pH values 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0) to a final concentration of 0.5 mM, and 200 μL of Gordonia FV1 bacterial solution was inoculated. No bacterial solution was added to the control group. Three independent replicates were set up and cultured with shaking at 180 rpm for 24 h at 30°C. The residual amount of DEHP in the sample was determined by HPLC.

[0041] After 24 hours of culture, Gordonia FV1 maintained a high degradation activity on DEHP under different pH value conditions and had good adaptability to pH value. The test results are as Figure 4As shown in the figure, when the pH value is 5.0 - 7.0, with the increase of the pH value, the degradation rate of Gordonia sp. FV1 to DEHP gradually increases from 34.52% to 89.84%. When the pH value is 8.0 - 11.0, Gordonia sp. FV1 can almost completely degrade DEHP. The results show that Gordonia sp. FV1 can efficiently degrade DEHP in both acidic and strongly alkaline environments, especially with better degradation performance in alkaline environments, indicating its potential in environmental remediation applications.

[0042] Experimental Example 2 Determination Test of the Degradation Substrate Spectrum of Gordonia sp. FV1

[0043] 1 Test Method

[0044] Dimethyl phthalate (DMP), diethyl phthalate (DEP), dipropyl phthalate (DPrP), di-n-butyl phthalate (DBP), di-n-pentyl phthalate (DPeP), dihexyl phthalate (DHP), diheptyl phthalate (DHeP), di-n-octylphthalate (DOP), dinonyl phthalate (DNP), didecyl phthalate (DDP), butylbenzyl phthalate (BBP), dicyclohexyl phthalate (DCHP), di(2-ethylhexyl) phthalate (DEHP), and diisobutyl phthalate (DiBP) were added to 10 mL of TEM liquid medium (pH value 8.0) to a final concentration of 0.5 mM. 200 μL of Gordonia sp. FV1 was inoculated, and no bacterial solution was added to the control group. Three independent replicates were set. The culture was shaken at 30 °C and 180 rpm for 7 days. The content of PAEs in the samples was determined by HPLC to determine the degradation ability of Gordonia sp. FV1 to different PAEs substrates.

[0045] Degradation rate of PAEs = 100% × ( C 0 -C t ) / C0 ( C 0 is the initial concentration of PAEs, C t and is the concentration of PAEs after treatment with strain FV1).

[0046] Test results

[0047] PAEs are highly hydrophobic and difficult to degrade, especially some species with complex side chain structures such as DEHP, DCHP, BBP, etc. Gordonia sp. FV1 can degrade 14 PAEs molecules, including PAEs with short side chains, medium-length side chains, long side chains, and complex side chains ( Figure 5 ). Except for DMP, Gordonia sp. FV1 can almost completely degrade the other 13 PAEs, showing a strong degradation ability.

[0048] Test Example 3 Soil remediation test of Gordonia sp. FV1

[0049] 1 Test method

[0050] A control group (CK) and a treatment group (T) were set up. DEHP was added to 10 mL of TEM liquid medium (pH value 8.0) to a final concentration of 0.5 mM, and Gordonia sp. FV1 was inoculated. Gordonia sp. FV1 was cultured and a bacterial suspension was prepared, with a bacterial concentration of 3×10 8 cfu / mL. In the treatment group (T), 20 g of soil (dry weight) was placed in a conical flask, DEHP was added to the soil to a final concentration of 100 mg / kg, 2 mL of the bacterial suspension was added, and the soil water content was adjusted to 50%. In the control group (CK), 2 mL of inactivated bacterial suspension was added, and other conditions were the same as those in the treatment group. The samples were cultured in a biochemical incubator at 30 °C for 1, 3, 6, 10, 20, and 30 days, and the content of DEHP in the soil was measured by HPLC.

[0051] Test results

[0052] To evaluate the potential of Gordonia sp. FV1 in environmental remediation, the degradation effect of Gordonia sp. FV1 on DEHP in soil was studied. DEHP was added to the soil to a final concentration of 100 mg / kg, and Gordonia sp. FV1 was inoculated. The samples were cultured at 30 °C for 1 - 30 days respectively.

[0053] The test results are as Figure 6 shown. After 1 day, the DEHP in the soil decreased by 19.48%. As time increased, the degradation rate of DEHP in the soil gradually increased, and DEHP was completely degraded after 30 days. The above results indicate that Gordonia sp. FV1 can effectively remove DEHP from the soil and has great potential for soil remediation applications.

Claims

1. A Gordonia bacterium ( Gordonia sp. ), characterized in that Its microbial preservation number is: CGMCC No. 30310.

2. The application of the Gordonia sp. according to claim 1 in degrading phthalate esters, wherein the phthalate esters are dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, benzyl butyl phthalate, dicyclohexyl phthalate, bis(2-ethylhexyl) phthalate or diisobutyl phthalate.

3. The application of the Gordonia sp. according to claim 1 in bioremediating contaminated soil, wherein the soil contains phthalate esters, and the phthalate esters are dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, benzyl butyl phthalate, dicyclohexyl phthalate, bis(2-ethylhexyl) phthalate or diisobutyl phthalate.

4. A bacterial agent composition for degrading phthalate esters, comprising: The bactericide for degrading phthalate esters and the auxiliary materials or carriers for the preparation of the preparation, characterized in that the bactericide for degrading phthalate esters is prepared from the Gordonia sp. according to claim 1.

5. A microbial agent composition for repairing contaminated soil, comprising: The bactericide for degrading phthalate esters and the auxiliary materials or carriers for the preparation of the preparation, characterized in that the bactericide for degrading phthalate esters is prepared from the Gordonia sp. according to claim 1.

6. A bioremediation method for contaminated soil, characterized in that, Comprising: Preparing the Gordonia sp. according to claim 1 into a microbial bactericide; inoculating the microbial bactericide into contaminated soil for microbial degradation of phthalate esters, wherein the phthalate esters are dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, benzyl butyl phthalate, dicyclohexyl phthalate, bis(2-ethylhexyl) phthalate or diisobutyl phthalate.

Images