Monoterpenoid-tolerant engineering escherichia coli as well as construction method and application thereof

By overexpressing the deubiquitin protease gene elaD in E. coli, an engineered strain that tolerates monoterpenes was constructed, solving the problem of E. coli's low tolerance to monoterpenes and achieving efficient monoterpenes synthesis.

CN120060109AActive Publication Date: 2025-05-30BEIJING INST OF TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510510071.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-05-30
Estimated Expiration
2045-04-23

AI Technical Summary

Technical Problem

In the prior art, E. coli has low tolerance to monoterpenoid compounds and has cytotoxicity problems, making it difficult to achieve industrial production.

Method used

By systematically digging out the endogenous stress-resistant elements of E. coli, an engineered strain with a stable tolerant phenotype was constructed, and the tolerance was improved by overexpressing the deubiquitin protease gene elaD.

Benefits of technology

The engineering E. coli that tolerate monoterpenes was successfully constructed, which significantly improved its tolerance to monoterpenes and geraniol yield, breaking through the trade-offs between tolerance and yield in traditional strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060109A_ABST
    Figure CN120060109A_ABST
Patent Text Reader

Abstract

The invention discloses an Escherichia coli engineering strain with monoterpenoid tolerance as well as a construction method and application of the Escherichia coli engineering strain. The invention discloses the function of the gene elaD in improving the monoterpenoid tolerance of escherichia coli for the first time. On the basis, a gene overexpression engineering strain is constructed in combination with a metabolic engineering strategy, the engineering strain realizes broad-spectrum tolerance (the tolerance concentration is increased by 4-6 times) to monoterpenoids such as geraniol and limonene, and the yield of geraniol is remarkably increased (the maximum yield is increased by 115.3%). The method can solve the problem of poor tolerance of current escherichia coli to monoterpenoids, is beneficial to construction of a robust escherichia coli engineering strain, provides an innovative solution with robustness and high yield for efficient microbial synthesis of monoterpenoids, and has important industrial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering. More specifically, the present invention relates to an engineered Escherichia coli resistant to monoterpenoids, and a method for constructing the same and applications thereof. Background Art

[0002] Monoterpenoids are terpene substances composed of two isoprene units. As the members of the terpene family with the smallest molecular weight, they are widely present in plant secondary metabolites. Such compounds (such as myrcene, α-terpineol, nerol, geraniol, etc.) not only have significant aromatic odor characteristics, but also show important application values in the fields of food additives, spice manufacturing and daily chemical products. Recent studies have further revealed that monoterpenoids have multiple pharmacological activities, including immunomodulation, antibacterial and anti-inflammatory, analgesic, hypoglycemic and lipid-lowering, and anti-tumor effects, and can be applied to the fields of preventive medicine and clinical treatment.

[0003] The breakthrough of synthetic biology technology provides a new path for the heterologous synthesis of plant natural products by microorganisms. At present, model microorganisms such as Escherichia coli and Saccharomyces cerevisiae have been successfully transformed into biosynthesis chassis for monoterpenoids. However, the inherent cytotoxicity of such compounds severely restricts their industrial production process: when the intracellular and extracellular monoterpene concentrations reach the threshold, cell proliferation can be inhibited. For example, 0.03% limonene or 0.05% geraniol can completely inhibit the growth of Escherichia coli, and 0.6 mM limonene can completely inhibit the growth of Saccharomyces cerevisiae. In addition, the irreversible damage to the membrane system caused by the product toxicity will lead to a sharp decline in the product yield and production intensity during the fermentation process.

[0004] To address the problem of product inhibition, currently mainly two strategies of in-situ extraction and adaptive evolution are adopted, but they have significant limitations: the former relies on exogenous extractants (such as resins, organic solvents) to construct a two-phase fermentation system, although it can reduce the extracellular product concentration, but faces problems such as high cost, significant scale-up effect and low product recovery rate; the latter screens tolerant strains through long-term stress, but the evolved phenotypes have a high decline rate and narrow substrate specificity, and random mutations may lead to the inactivation of key genes in the metabolic pathway. Summary of the Invention

[0005] In order to solve the problem of the lack of acid-resistant elements in the prior art, the present invention proposes to construct an engineered strain with a stable tolerance phenotype by systematically mining endogenous stress-resistant elements in Escherichia coli. This strategy can not only avoid the metabolic interference caused by the introduction of exogenous genes and fundamentally solve the cytotoxicity problem, but also obtain broad-spectrum resistance gene elements, providing an innovative solution for breaking through the toxicity bottleneck of monoterpenoids and realizing the efficient synthesis of compounds.

[0006] Therefore, on the one hand, the present invention provides an engineered Escherichia coli with tolerance to monoterpenoids, and the engineered Escherichia coli overexpresses the deubiquitinating protease geneelaD 。

[0007] In a specific embodiment in this regard, the deubiquitinating protease gene elaD has the amino acid sequence shown in SEQ ID NO. 1.

[0008] In a specific embodiment in this regard, the deubiquitinating protease gene elaD (GeneID: 946742) has the nucleotide sequence shown in SEQ ID NO. 2.

[0009] In a specific embodiment in this regard, the Escherichia coli is Escherichia coli BL21(DE3), BL21, BL21 Star(DE3), BL21(DE3)pLysS, DH5a, JM109, Top10, Rosetta(DE3) or Origami(DE3).

[0010] In a specific embodiment in this regard, the monoterpenoid compound is selected from: geraniol, nerol, linalool, myrcene, limonene, α-terpineol, menthol, (-)-carvone and (-)-borneol.

[0011] Another aspect of the present invention also provides a method for constructing the engineered Escherichia coli according to the present invention, and the method includes the following steps: 1) Connect the deubiquitinating protease gene elaD to an expression plasmid (such as pET28a-tac with the sequence shown in SEQ ID NO. 3) to obtain a recombinant plasmid (such as pET28a-tac-elaD); 2) Introduce the recombinant plasmid obtained in step 1) into an Escherichia coli host by electrotransformation or chemical transformation (such as E.coli BL21(DE3)); and 3) Screen for positive clones (such as on an LB plate containing kanamycin) to obtain the engineered Escherichia coli.

[0012] In a specific embodiment, the expression vector pET28a-tac contains a Ptac inducible promoter, a T7 terminator and a KanR resistance marker.

[0013] Another aspect of the present invention also provides the use of the engineered Escherichia coli according to the present invention in the production of monoterpenoid compounds.

[0014] In a specific embodiment, the monoterpenoid compound is selected from: geraniol, nerol, linalool, myrcene, limonene, α-terpineol, menthol, (-)-carvone and (-)-borneol.

[0015] Another aspect of the present invention also provides a method for improving the tolerance of Escherichia coli to monoterpenoids, which method comprises overexpressing a deubiquitinating protease gene in the Escherichia coli elaD (GeneID: 946742).

[0016] In a specific embodiment of this aspect, the amino acid sequence of the deubiquitinating protease gene elaD is shown in SEQ ID NO. 1.

[0017] In a specific embodiment of this aspect, the nucleotide sequence of the deubiquitinating protease gene elaD (GeneID:946742) is shown in SEQ ID NO. 2.

[0018] In a specific embodiment of this aspect, the Escherichia coli is Escherichia coli BL21(DE3), BL21, BL21 Star(DE3), BL21(DE3)pLysS, DH5a, JM109, Top10, Rosetta(DE3) or Origami(DE3).

[0019] In a specific embodiment of this aspect, the monoterpenoids are selected from: geraniol, nerol, linalool, myrcene, limonene, α-terpineol, menthol, (+)-carvone and (-)-borneol.

[0020] In a specific embodiment of this aspect, the overexpression is achieved by expressing the deubiquitinating protease gene on a plasmid elaD to achieve. Description of the Drawings

[0021] From the following detailed description in conjunction with the drawings, the above features and advantages of the present invention will become more apparent, wherein:[[]]END]] Figure 1 is the OD 600 value of the engineered strain BL21-elaD and the starting strain BL21-pET28a under different monoterpenoid stresses; Figure 2 is the process of Escherichia coli producing geraniol using the mevalonate (MVA) pathway or the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway; and Figure 3 is a graph comparing geraniol yields, SG1 is a control strain producing geraniol using the MVA+MEP pathway, and SG2 is a strain overexpressing the gene elaD on the basis of SG1.

[0022] Description of the Sequence Listing.

[0023] SEQ ID NO. 1 - Deubiquitinating protease gene elaD Amino acid sequence SEQ ID NO. 2 - Deubiquitinating protease gene elaD Nucleotide sequence SEQ ID NO. 3 - pET28a-tac full sequence SEQ ID NO. 4 - Nucleotide sequence of pSC101 ori empty plasmid SEQ ID NO. 5 - Primer elaD-F SEQ ID NO. 6 - Primer elaD-R SEQ ID NO. 7 - Primer Zai-elaD-F SEQ ID NO. 8 - Primer Zai-elaD-R Specific implementation manners

[0024] Next, in combination with the implementation manners of the present invention, the technical solutions in the implementation manners of the present invention will be clearly and completely described. Obviously, the described implementation manners are only a part of the implementation manners of the present invention, rather than all of the implementation manners. Based on the implementation manners in the present invention, all other implementation manners obtained by those of ordinary skill in the art without making creative efforts fall within the scope of protection of the present invention.

[0025] The experimental methods used in the examples are all conventional methods unless otherwise specified.

[0026] Unless otherwise specified, the reagents involved in the examples of the present invention are all commercially available products and can be obtained through commercial channels.

[0027] Unless otherwise indicated, the terms used herein have the general technical meanings understood by those skilled in the art. For the definitions and terms in this field, those skilled in the art are particularly recommended to refer to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999).

[0028] As used herein, the term "comprising" or "including" is an open-ended description that includes all specified components or steps described, as well as other specified components or steps that do not materially affect; when used to describe the sequence of a protein or nucleic acid, the protein or nucleic acid may consist of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the activity described in the present invention.

[0029] As used herein, the term "and / or" includes all combinations of the items connected by this term, and each combination should be considered to be listed separately herein. For example, "A and / or B" includes "A", "A and B", and "B". Another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".

[0030] As used herein, the term "overexpression" means that when the strict control of gene / protein expression (transcription) is disrupted, the gene may not be "turned off", or may be transcribed at a high rate. High-speed transcription results in the production of a large amount of mRNA. For the overexpression of the "endogenous gene (such as the deubiquitinating protease gene elaD )" in the present invention, it means that its DNA or RNA or protein expression level in the engineered Escherichia coli described in the present invention is at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 200% or 300% higher than that of the control (not overexpressing the endogenous gene (such as the deubiquitinating protease gene elaD )) in the present invention), or even 4, 5, 6, 7, 8, 9, 10 times or more of the DNA or RNA or protein expression level of the endogenous gene (such as the deubiquitinating protease gene elaD ) in the control. Techniques and reagents for detecting gene / protein expression levels are well known to those skilled in the art.

[0031] There is no particular limitation on the type of Escherichia coli host in the present invention, as long as it can overexpress the deubiquitinating protease gene elaD That's it. Typical commercially available Escherichia coli used for protein expression in the art include Escherichia coli BL21(DE3), BL21, BL21 Star(DE3), BL21(DE3)pLysS, DH5a, JM109, Top10, Rosetta(DE3) or Origami(DE3).

[0032] When expressing foreign proteins, due to mutations in the lon and ompT genes, the BL21 strain reduces the degradation of recombinant proteins and increases the yield of recombinant proteins. However, BL21 does not express T7 RNA polymerase, so it is not suitable for use with plasmid vectors based on the T7 promoter.

[0033] The BL21(DE3) strain was created by integrating the genome of phage λ DE3 into the genome of BL21. This strain contains the T7 RNA polymerase gene controlled by the lacUV5 promoter and is suitable for the high-efficiency expression of genes cloned into expression vectors containing the T7 promoter (such as the pET series). It can be activated by adding inducers such as IPTG and is used for expressing toxic proteins or for high-level expression in Escherichia coli.

[0034] BL21 Star(DE3) has an additional rne131 mutation (RNase E coding gene) based on BL21(DE3), resulting in defective RNase E expression, enhancing mRNA stability, and further increasing the expression level of foreign proteins.

[0035] BL21(DE3)pLysS is a BL21(DE3) strain carrying the pLysS plasmid and having chloramphenicol resistance, which can express both toxic and non-toxic proteins.

[0036] DH5a is a strain commonly used for plasmid cloning. When transforming with pUC series plasmid vectors, it can achieve α-complementation with the amino terminus of the β-galactosidase encoded by the vector, and is used for blue-white screening to identify recombinant strains.

[0037] When using pUC series plasmid vectors for DNA transformation or transfection with M13 phage vectors in the JM109 strain, due to α-complementation between the LacZa polypeptide produced by the vector DNA and the LacZΔM15 encoded by JM109, β-galactosidase activity is shown, and thus it is very easy to identify recombinant strains. It is suitable for plasmid cloning and genetic engineering operations.

[0038] The Top10 strain is suitable for efficient DNA cloning and plasmid amplification, and can ensure the stable inheritance of high-copy plasmids.

[0039] Rosetta(DE3) is a derivative of the BL21(DE3) strain, used for expressing recombinant proteins with rare codons, providing tRNAs corresponding to Escherichia coli rare codons (such as AGG, AGA, AUA, CUA, CCC, GGA), and solving the problem of codon bias.

[0040] Origami(DE3) is a modified strain, especially suitable for the expression of proteins that require correct disulfide bond formation.

[0041] In view of the core bottlenecks in the prior art, such as the low tolerance of Escherichia coli to monoterpenoid compounds and the lack of broad-spectrum resistance gene elements, the present invention provides the following innovative solutions: 1) Key tolerance gene element: Systematically identify and verify the broad-spectrum monoterpenoid tolerance function of the deubiquitinating enzyme gene elaD (GeneID: 946742) for the first time; 2) Modular engineered strain: Construct an Escherichia coli engineered strain with significantly improved tolerance through gene overexpression strategy; 3) Application in geraniol fermentation: The tolerance gene is used for the production of geraniol, and the yield is increased by 115.3%, breaking through the toxicity threshold of microbial synthesis.

[0042] The purpose of the present invention is to provide an Escherichia coli engineered strain with high tolerance to monoterpenoid compounds. This engineered strain uses Escherichia coli E.coli BL21(DE3) as the expression host, and overexpresses the deubiquitinating protein elaD in Escherichia coli.

[0043] The acquisition of the said gene elaD is achieved by exposing Escherichia coli in the logarithmic growth phase to high concentrations of monoterpenoid compounds. After the cells grow to the stationary phase, the bacterial cells are collected, total RNA is extracted for transcriptome sequencing (RNA-seq), differentially expressed genes are screened, and candidate genes with significantly increased expression levels are locked elaD , and then its function of improving the tolerance of Escherichia coli to monoterpenoid compounds is verified and identified by means such as gene knockout, gene complementation, and gene overexpression.

[0044] Preferably, the Escherichia coli is E.coli BL21(DE3).

[0045] The monoterpenoid compounds are geraniol, nerol, linalool, myrcene, limonene, α-terpineol, menthol, (-)-carvone, and (-)-borneol.

[0046] The present invention provides a method for constructing an Escherichia coli engineered strain with the ability to tolerate monoterpenoid compounds. This construction method includes the following steps: 1) Using the genome of Escherichia coli BL21(DE3) as a template, amplify the target fragment of the deubiquitin protease gene elaD by PCR, and recover the target fragment using a gel recovery kit; 2) Connect the target fragment obtained in step 1) elaD to the expression vector pET28a-tac by Gibson assembly to obtain the recombinant plasmid pET28a-tac-elaD; 3) Introduce the recombinant plasmid pET28a-tac-elaD obtained in step 2) into E.coli BL21(DE3) to obtain the engineered Escherichia coli BL21-elaD.

[0047] The present invention also provides the application of the above-mentioned genes tolerant to monoterpenoid compounds in constructing an engineered strain for producing geraniol.

[0048] Preferably, the method for transforming the host cell with the recombinant plasmid of the present invention is the commonly used heat shock transformation method, and positive transformants are screened using an antibiotic screening plate.

[0049] Beneficial effects of the present invention: The present invention has first confirmed the function of the elaD protein in improving the tolerance of Escherichia coli to monoterpenoid compounds. By overexpressing the genes encoding these proteins in Escherichia coli respectively, an engineered Escherichia coli tolerant to monoterpenoid compounds has been successfully constructed.

[0050] Test the OD of the engineered strain BL21-elaD under different monoterpenoid compound stresses 600 , compared with the starting strain BL21-pET28a, the tolerance of the engineered strain to monoterpenoid compounds has increased by up to 6.23 times, proving that these engineered strains have good tolerance effects on linear monoterpenoid compounds: geraniol, nerol, linalool and myrcene; monocyclic monoterpenoid compounds: limonene, α-terpineol, menthol and carvone; bicyclic monoterpenoid compounds: (-)-borneol, etc.

[0051] The tolerance genes identified in the present invention elaD have the ability to increase the production of monoterpenoid compounds in Escherichia coli. Taking the production of geraniol as an example, after overexpressing elaD the tolerance genes in Escherichia coli with a geraniol synthesis pathway, the production of geraniol has increased, and it can be increased by up to 115.3% compared with the control, and the shake flask production is 945.3 mg / L.

[0052] All patents and publications mentioned in this application are incorporated into the present invention by reference as a whole. Those skilled in the art should recognize that certain changes can be made to the present invention without departing from the concept or scope of the present invention. The following examples further illustrate the present invention in detail and should not be considered as limiting the present invention or the scope of the specific methods described in the present invention. Examples

[0053] Example 1. Mining and identification of tolerance genes elaD for.

[0054] Use an inoculation loop to streak and activate the control strain on an LB solid plate E.colitrans1T1, and the evolved strains with tolerance to monoterpenes acquired through adaptive evolution E.coli TS, pick a single colony and inoculate it into 20 mL LB medium, and culture it in a shaker at 37°C and 200 rpm. After the end, collect the bacteria by low-temperature centrifugation at 5000 rpm, and quickly freeze them with liquid nitrogen to extract total RNA. Purify and fragment the RNA, connect the products, and purify and amplify the connected products to obtain the final cDNA library. Finally, sequence the constructed sequencing library using the HiSeq / MGI sequencing platform, and analyze the expression level. Among them, the gene elaD The expression levels in the evolved bacteria were significantly upregulated compared with the control, and these genes were functionally verified to confirm that they have monoterpene compound tolerance function.

[0055] Example 2. Construction of engineered strains tolerant to monoterpenoids.

[0056] From NCBI elaD The gene sequence (GeneID: 946742) was obtained, and the corresponding primers were designed to amplify the target gene and the vector pET28a-tac (sequence as shown in SEQ ID NO. 3) (pET28a was purchased from Novagen, and the present invention replaced the promoter to obtain pET28a-tac, which includes a Ptac inducible promoter, a T7 terminator and a KanR resistance marker) (specific primer nucleotide sequences are shown in Table 1), and the amplified target fragment and vector were recovered using a gel recovery kit. The recovered and purified target fragment and vector with homologous ends were added to the same tube of Master Mix, pipetted 5-10 times, and then the reaction solution was placed in a 50°C metal bath for reaction for 5-15 min to obtain the recombinant plasmid pET28a-tac-elaD.

[0057] The recombinant plasmid was transformed into E.coli BL21(DE3) competent cells were used to obtain the engineered strain BL21-elaD with monoterpenoid tolerance function.

[0058] The specific nucleotide sequences of the primers used in the construction of the engineering strains are shown in Table 1.

[0059] Table 1 Primer sequences.

[0060] Sequence Listing No. Primer Primer Sequence (5’→ 3’) SEQ ID NO.5 elaD-F gaggagaaaatgatggttacagttgtcagc SEQ ID NO.6 elaD-R cgggctttgttaactcactcttttgccggatgc SEQ ID NO.7 Zai-elaD-F gagttaacaaagcccgaaaggaagctg SEQ ID NO.8 Zai-elaD-R ccatcattttctcctcttttgtgtgaaattgttat Example 3. Growth of tolerant engineered strains under monoterpenoid stress.

[0061] Pick up the cells containing the pET28a-tac empty plasmid E.coliSingle colonies of BL21(DE3) and the engineered strain BL21-elaD were activated in LB liquid medium containing kanamycin resistance to obtain seed cultures. The seed cultures were transferred to 20 mL of LB medium, and the initial OD 600 value was controlled to be 0.1. The cultures were continued to be incubated until the OD 600 value of the strain reached 0.8 - 1. Then, isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to induce the expression of tolerance genes, and 0.2 g / L of monoterpenoid compounds such as geraniol (the commercial sources and product catalog numbers of monoterpenoid compounds are shown in Table 2) were added externally for stress. The temperature of the shaker was controlled and the cultures were incubated until the stationary phase. An appropriate amount of the bacterial solution was taken out, and the absorbance value (OD 600 ) of each sample at 600 nm was measured with a spectrophotometer to monitor the growth of bacteria. Table 2 Commercial sources and product catalog numbers of monoterpenoid compounds

[0062] Compound CAS Commercially Available Source Catalog Number Geraniol 106-24-1 Aladdin G107517 Nerol 106-25-2 Aladdin N101447 Myrcene 123-35-3 Aladdin M101322 Limonene 5989-54-8 Aladdin L157739 α-Terpineol 10482-56-1 Aladdin T111437 Menthol 2216-51-5 Aladdin M107059 (+)-Carvone 6485-40-1 Aladdin C117707 (-)-Borneol 464-45-9 Aladdin B141262 Figure 1 Yes elaD are the absorbance values of the overexpressed engineered strain BL21-elaD and the starting strain BL21-pET28a under different monoterpenoid compound stresses. According to the measurement results, it can be known that: compared with the starting strain, the tolerance ability of the engineered strain BL21-elaD to geraniol increased by 251.8%; the tolerance ability to nerol increased by 474.0%; the tolerance ability to linalool increased by 142.9%; the tolerance ability to myrcene increased by 142.8%; the tolerance ability to limonene increased by 76.5%; the tolerance ability to α-terpineol increased by 91.4%; the tolerance ability to menthol increased by 310.4%; the tolerance ability to (+)-carvone increased by 53.3%; the tolerance ability to (-)-borneol increased by 95.1%. Example 4. Application of tolerance genes in geraniol production.

[0063] There is a natural MEP pathway in Escherichia coli: using glucose as a carbon source, the key intermediate metabolites isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) are synthesized. The substrates IPP and DMAPP are catalyzed by farnesyl diphosphate synthase (ispA) to generate geranyl diphosphate (GPP), and then monoterpenoid compounds are generated by expressing exogenous monoterpene synthases. Figure 2 is the process of Escherichia coli producing geraniol using the mevalonate (MVA) pathway or the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. In this study, geraniol synthase (GES) from Ocimum basilicum was selected to be introduced. To strengthen the precursor supply, the MVA pathway and geranyl diphosphate synthase (GPPS) from Abies were further introduced, and plasmids were constructed by Gibson assembly.

[0064] Geraniol production plasmid: The production plasmid pET28a-tac-GES-tac-GPPS, including the promoter tac and the gene GES (GenBank Accession No. AY362553.1) 、GPPS (GenBank Accession No. AF513112.1), named pG1.

[0065] MVA pathway: Includes plasmids pMH1 and pFZ81, plasmid pMH1 (overexpressing atoB-erg13-thmg1), plasmid pFZ81 (overexpressing erg12-erg8-mvd1-idi).

[0066] Tolerance plasmid: Plasmid pG2 (empty plasmid, pSC101 ori) (sequence shown in SEQ ID NO. 4), plasmid pG3 (overexpressing elaD ) through the promoter tac in plasmid pG2.

[0067] Transform plasmids pG1, pMH1, pFZ81 and pG2 into E.coli DH5α to obtain strain SG1; transform plasmids pG1, pMH1, pFZ81 and pG3 into E.coli DH5α to obtain strain SG2. All plasmids, strains and their characteristics are listed in Table 3.

[0068] Table 3 Strains and Plasmids Description Source Plasmid pET28a <![CDATA[Kan, pBR322 ori, P T7 > Novagen pET28a-tac <![CDATA[Kan, pBR322 ori, P tac > This invention pET28a-tac- <![CDATA[Kan, pBR322 ori, P tac , elaD > This invention pMH1 <![CDATA[Cm, p15A ori, P lac , atoB-erg13-thmg1 > (Zhu et al., 2014) pFZ81 <![CDATA[Amp, pBBR1 Rep, P lac , erg12-erg8-mvd1-idi > (Zhu et al., 2014) pG1 <![CDATA[Kan, pBR322 ori, P tac , GES-GPPS > This invention pG2 <![CDATA[Spec, pSC101 ori, P tac > This invention pG3 <![CDATA[Spec, pSC101 ori, P tac , elaD > This invention Strain BL21(DE3) Gene Expression Strain Biomed DH5α Geraniol Production Strain Biomed BL21-pET28a BL21(DE3)+ pET28a-tac This invention BL21-elaD BL21(DE3)+ pET28a-tac- This invention SG1 DH5α+pG1+pMH1+ pFZ81+pG2 This invention SG2 DH5α+pG1+ pMH1+ pFZ81+pG3 This invention In Table 3 (Zhu et al., 2014) is In vitro reconstitution of mevalonate pathway and targeted engineering of farnesene overproduction in Escherichia coli. Biotechnology and Bioengineering. 111, 1396-1405. Pick colonies of engineered strain SG2 and control strain SG1 from fresh plates, inoculate them into LB medium containing the corresponding resistance, and culture overnight to obtain seed liquid. Transfer the above seed liquid to a 100 mL conical flask containing 20 mL of TB medium, control the initial OD 600 value, and culture at 37 °C and 200 rpm. Wait until it grows to the appropriate OD 600When the value reached, IPTG was added for induction, and isopropyl myristate was added as the organic phase for two-phase fermentation. The temperature and rotation speed were controlled for culturing for 48 h. After the fermentation ended, 2 mL of the upper organic phase was taken into an EP tube and centrifuged at 12000 rpm for 10 min to separate the organic phase. The upper clear organic phase was carefully aspirated into a clean EP tube, an appropriate amount of anhydrous sodium sulfate was added, and it was left standing for 10 min to remove water. It was centrifuged at 12000 rpm for 5 min, and the sample was filtered through a 0.22 μm organic filter membrane and then transferred to a liquid phase vial sleeve. The concentration was detected by gas chromatography. The model of the gas chromatograph was Shimadzu GC-2010, and an RTX-5 chromatographic column (30 m × 0.25 mm × 0.25 μm) was selected to separate geraniol. The detection program was set as follows: the column oven temperature was 70 °C, the detector temperature was 280 °C, and the split ratio was 4:1. The initial temperature of the oven was 70 °C, held for 1 min, heated at a rate of 30 °C / min to 180 °C, held for 1 min, heated at a rate of 30 °C / min to 270 °C, and held for 2 min. By detecting geraniol standard solutions with different concentration gradients, a standard curve of yield and peak area was plotted.

[0069] Figure 3 The fermentation results showed that: the tolerance gene elaD Overexpression in the production chassis could further increase the geraniol yield. The yield was 945.3 mg / L, which was 115.3% higher than that of the strain SG1 before overexpressing the tolerance gene, that is, the yield was increased to 2.15 times. Thus, it can be proved that the tolerance gene elaD mined in the present invention can not only be used as a general tool element to improve the tolerance of Escherichia coli to different monoterpene compounds, but also synchronously enhance the geraniol synthesis flux, breaking through the "tolerance-yield" trade-off contradiction in traditional strategies.

[0070] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0071] In addition, it should be noted that, among the various specific technical features described in the above specific embodiments, they can be combined in any appropriate way without contradiction. To avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.

[0072] Furthermore, any combination can be made between various different embodiments of the present invention as long as it does not violate the idea of the present invention, and it should also be regarded as the content disclosed by the present invention.

Claims

1. An engineered Escherichia coli with tolerance to monoterpenoid compounds, wherein the engineered Escherichia coli overexpresses a deubiquitinating protease gene eLaD .

2. The engineered Escherichia coli according to claim 1, wherein: 1) The deubiquitinating protease gene eLaD The amino acid sequence is shown in SEQ ID NO. 1; 2) The deubiquitinating protease gene eLaD The nucleotide sequence is shown in SEQ ID NO. 2; and / or 3) The Escherichia coli is Escherichia coli BL21(DE3), BL21, BL21 Star(DE3), BL21(DE3)pLysS, DH5a, JM109, Top10, Rosetta(DE3) or Origami(DE3).

3. The engineered Escherichia coli according to claim 1 or 2, wherein the monoterpene compound is selected from the group consisting of geraniol, nerol, linalool, myrcene, limonene, α-terpineol, menthol, L-carvone and (-)-borneol.

4. A method for constructing the engineered Escherichia coli according to claim 1, the method comprising the following steps: 1) Deubiquitinating protease gene eLaD Connect to the expression plasmid to obtain a recombinant plasmid; 2) introducing the recombinant plasmid obtained in step 1) into an E. coli host by electroporation or chemical transformation; and 3) Screening positive clones to obtain the engineered Escherichia coli.

5. The method according to claim 4, wherein the expression plasmid is pET28a-tac as shown in SEQ ID NO. 3, and / or the E. coli host is Escherichia coli BL21(DE3).

6. Use of the engineered Escherichia coli according to any one of claims 1 to 3 in producing monoterpenoid compounds.

7. The use according to claim 6, wherein the monoterpene compound is selected from the group consisting of geraniol, nerol, linalool, myrcene, limonene, α-terpineol, menthol, L-carvone and (-)-borneol.

8. A method for improving the monoterpenoid tolerance of Escherichia coli, the method comprising overexpressing a deubiquitinating protease gene in the Escherichia coli eLaD .

9. The method according to claim 8, wherein 1) The deubiquitinating protease gene eLaD The amino acid sequence is shown in SEQ ID NO. 1; 2) The deubiquitinating protease gene eLaD The nucleotide sequence is shown in SEQ ID NO. 2; 3) The Escherichia coli is Escherichia coli BL21(DE3), BL21, BL21 Star(DE3), BL21(DE3)pLysS, DH5a, JM109, Top10, Rosetta(DE3), or Origami(DE3); and / or 4) The monoterpene compound is selected from the group consisting of: geraniol, nerol, linalool, myrcene, limonene, α-terpineol, menthol, L-carvone and (-)-borneol.

10. The method according to claim 8 or 9, wherein the overexpression is by expressing the deubiquitinating protease gene on a plasmid. eLaD To achieve.

Citation Information

Patent Citations

  • Recombined saccharomyces cerevisiae bacterial strain of high-yield monoterpene geraniol and application of recombined saccharomyces cerevisiae bacterial strain

    CN105420135A

  • Terpenoid production and strain

    CN119736218A

  • Synthesis of monoterpenoid ester compounds

    WO2019092388A1