Porcine rotavirus G9 type and application thereof
By isolating and purifying the swine rotavirus G9 strain SC01 and its VP7 gene sequence, inactivated vaccines and ELISA kits were prepared, which solved the prevention and control and diagnosis of swine rotavirus G9 disease, and achieved efficient vaccination and accurate virus detection.
Patent Information
- Application Number
- CN202510044011.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-10
- Publication Date
- 2025-05-30
AI Technical Summary
Pig rotavirus G9 type is widely prevalent in my country, resulting in diarrhea and economic losses in piglets. However, it is difficult to separate and expand culture in traditional ways, and the virus titer is not high, the existing vaccine is not effective, and there is a lack of effective diagnostic methods.
A swine rotavirus G9 strain SC01 and its VP7 gene sequence were isolated and purified, and an inactivated vaccine and ELISA kit based on this strain were prepared for the prevention and diagnosis of swine rotavirus G9 disease.
The strain proliferates fast on cells and has low pathogenicity. The inactivated vaccine has good immunogenicity and can induce piglets to produce high levels of neutralizing antibodies, providing effective prevention and control measures; the ELISA kit can sensitively detect antibodies in serum, supporting the effective diagnosis of the virus.
Smart Images

Figure BDA0005237785780000071 
Figure BDA0005237785780000072 
Figure BDA0005237785780000081
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to an isolated and purified porcine rotavirus G9 type and its application. Background Art
[0002] Rotavirus (RV) belongs to the family Reoviridae, genus Rotavirus. The shape of rotavirus resembles a wheel, with a core composed of nucleic acid in the center, showing icosahedral symmetry, being a dense hexagon, and having no envelope. The nucleic acid of rotavirus is rich in a large number of A / T base pairs, with a content of about 65%.
[0003] Porcine rotavirus (PoRV) is a segmented double-stranded RNA virus, encoded by 11 segments to form 6 structural proteins and 6 non-structural proteins. The structural proteins include VP1, VP2, VP3, VP4, VP6, and VP7, and the non-structural proteins include NSP1, NSP2, NSP3, NSP4, NSP5, and NSP6. The virus particle is composed of 3 layers of capsid proteins. The innermost layer is composed of VP2 and a small amount of VP1 and VP3 proteins, and the three together encapsulate the viral genomic RNA, which is an indispensable protein in the process of viral gene transcription and replication; the middle layer is composed of VP6 protein, showing a spoke-like shape; the outermost layer is composed of two proteins, VP7 and VP4, which are the main determinants of the virus serotype. Among them, VP7 protein forms the smooth surface of the virus, and VP4 protein forms the spikes of the virus particle. According to the antigenic characteristics of glycoprotein VP7 (G type) and outer capsid protein VP4 (P type), rotavirus can be divided into G type and P type. G3, G4, G5, G9, and G11 are the most common epidemic genotypes in pigs, and currently G9 type is the most widespread in China. There are 3 antigenic proteins on the surface of the virus particle of porcine rotavirus: neutralizing antigen, group antigen, and hemagglutinin antigen. The hemagglutinin antigen is determined by the outer capsid protein VP4; the group antigen is related to multiple structural proteins, mainly determined by the inner capsid protein VP6; the neutralizing antigen is mainly determined by the outer shell glycoprotein VP7. VP4, VP6, and VP7 proteins are the main antigenic proteins of porcine rotavirus and also important virulence factors causing diarrhea.
[0004] Rotavirus is one of the important intestinal pathogens causing diarrhea in suckling piglets and weaned piglets. In 1981, this virus was first isolated from the feces of diarrhea piglets in China. Currently, PoRV is widespread in China. Infection with this virus not only reduces the survival rate of piglets but also causes a decrease in the daily weight gain of adult pigs.
[0005] This disease has a wide range of prevalence and a high incidence rate. It widely exists in the pig farming industry in China, especially susceptible in intensive pig farms. And large-scale infections and diarrhea caused by this virus in pig farms are not age-specific, often mixed with other pathogens, which exacerbates the condition. Porcine rotavirus infection often occurs in piglets aged 10 - 60 days, with an incidence rate as high as 80%. The higher the incidence rate, the more obvious the symptoms. The mortality rate of neonatal piglets infected can reach 100%. In recent years, more and more piglets have died due to porcine rotavirus infection. Big pigs and breeding pigs often show latent infections. After being infected with porcine rotavirus, it seriously affects the growth and development of pigs. Even adult pigs that recover will stop growing, resulting in a significant increase in the culling rate of pig farms.
[0006] There is currently no specific drug for the treatment of this disease. It is crucial to develop effective drugs or vaccines for the prevention and control of this virus. Vaccination is the most powerful preventive and control measure. Selecting an ideal strain and developing the best virus propagation method are crucial for the development of porcine rotavirus vaccines.
[0007] Currently, porcine rotavirus G9 is showing a widespread epidemic trend in some regions of China, causing greater harm and economic losses to the breeding industry. However, there are certain difficulties in the traditional isolation and large-scale cultivation of porcine rotavirus, and the virus titer is generally not high. Therefore, there is no particularly ideal porcine rotavirus G9 vaccine product on the market currently. The research on porcine rotavirus vaccines and diagnostic methods is also relatively less. Timely developing highly efficient vaccines and diagnostic kits is of great significance for the prevention and control of this disease. Summary of the Invention
[0008] The purpose of the present invention is to provide a strain of porcine rotavirus G9 and its VP7 gene sequence, as well as the application of the inactivated vaccine prepared based on the isolated strain in the prevention and control of porcine rotavirus G9 disease.
[0009] To achieve the purpose of the present invention, the technical solution of the present invention is as follows:
[0010] In the first aspect, the present invention provides a strain of porcine rotavirus G9 (Porcine rotavirus, PoRV) and its VP7 gene sequence.
[0011] The present invention inoculates the ground tissue of pig intestines from a certain pig farm into MA104 or Marc145 cells. After cell passage, purification and identification, a strain of porcine rotavirus G9 strain is obtained, named SC01. It proliferates stably on cells, and the CT value of the fluorescence quantitative determination of porcine rotavirus can reach 12.2, and the TCID 50 can reach 1.0×10 9 TCID 50 / ml, on September 23, 2024, it was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms (Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), and the deposit number is CGMCC No. 46200. The present invention provides the VP7 gene sequence of the porcine rotavirus G9 isolate, as shown in SEQ ID No. 1.
[0012] In a second aspect, the present invention provides a biological product containing the porcine rotavirus G9 strain, and the biological product is used for preventing or diagnosing porcine rotavirus G9 disease.
[0013] The biological product described above can be a vaccine or a diagnostic reagent.
[0014] Among them, the vaccine is a live vaccine or an inactivated vaccine.
[0015] The present invention provides an inactivated vaccine containing the isolated porcine rotavirus G9. The inactivated vaccine is obtained by passaging the porcine rotavirus G9 SC01 in MA104 cells or MARC-145 cells, harvesting the virus solution, measuring the virus titer, and then mixing it with an adjuvant at a weight ratio of 1:1. Available adjuvants include the colloidal water adjuvant self-made by Zhongmu, 201VG from Seppic, and conventional aluminum adjuvants.
[0016] The antigen content of the inactivated vaccine is not less than 1×10 7.0 TCID 50 / ml, and the immunization route is intramuscular injection or nasal inoculation. Preferably, the intramuscular injection route is used.
[0017] The reagent provided by the present invention can be an ELISA kit containing the isolated porcine rotavirus G9, which can detect antibodies in serum well.
[0018] In a third aspect, the present invention also provides the application of the porcine rotavirus G9 strain in the preparation of a vaccine for preventing porcine rotavirus G9 disease; and the application of the porcine rotavirus G9 strain in the preparation of a reagent for diagnosing porcine rotavirus G9 disease.
[0019] The beneficial effects of the present invention are as follows:
[0020] The porcine rotavirus G9 obtained by the present invention proliferates rapidly and has a high proliferation titer on susceptible cells (MA104 or MARC-145 cell lines), up to 1.0×10 9 TCID 50 / ml; the porcine rotavirus G9 strain of the present invention has low pathogenicity, and 1×10 9.0 TCID 50Weaned piglets were intranasally challenged with the virus solution at a dose of / ml and continuously observed for 10 days. None of the challenged weaned piglets showed clinical symptoms such as elevated body temperature or diarrhea and all survived. The inactivated vaccine prepared with the strain of the present invention has good immunogenicity and can induce piglets to produce high levels of neutralizing antibodies, providing important biological materials for the effective prevention and control of porcine rotavirus G9 disease.
[0021] Currently, there is no commercial ELISA kit for detecting porcine rotavirus G9. Therefore, establishing a serum antibody detection method is important for screening negative pigs. ELISA has the characteristics of high sensitivity, good specificity, and batch operation, which is convenient for clinical promotion and application. The present invention provides an ELISA kit containing the isolated porcine rotavirus G9, which can better detect the antibodies against porcine rotavirus G9 in serum, providing an important basis for the effective detection of this disease.
[0022] On this basis, other biological products containing the porcine rotavirus G9 of the present invention for the prevention, control, and diagnosis of porcine rotavirus G9 disease also fall within the protection scope of the present invention.
[0023] In this study, a strain of porcine rotavirus G9, named SC01, was isolated from the intestinal tissues of pigs in a pig farm in Neijiang, Sichuan in 2023 and passaged and purified. This isolated strain has good proliferation ability on passage cells, has no obvious pathogenicity to piglets, and has excellent immunogenicity, capable of inducing piglets to produce high levels of neutralizing antibodies, laying a solid foundation for the effective prevention and control of porcine rotavirus G9. At the same time, the ELISA kit prepared with this isolated strain can better detect the antibodies against porcine rotavirus G9 in serum, laying a technical foundation for the effective diagnosis of porcine rotavirus G9. Brief Description of the Drawings
[0024] Figure 1 This is the cytopathic effect (CPE) (×100) of the isolated strain of porcine rotavirus G9 cultured on MA104 adherent cells. Among them, A shows the CPE of porcine rotavirus G9 on MA104 cells, and B shows the normal MA104 cell control.
[0025] Figure 2 This is the RT-PCR identification result of porcine rotavirus G9. From left to right, they are: 1. The 7th-generation cell culture of porcine rotavirus G9; 2. The 8th-generation cell culture of porcine rotavirus G9; 3. The positive control of porcine rotavirus G9; 4. The negative control of porcine rotavirus G9.
[0026] Biological Material Deposit
[0027] Deposit Number: CGMCC No. 46200
[0028] Name: SC01
[0029] Classification name: Porcine rotavirus
[0030] Deposit date: September 23, 2024
[0031] Depositary institution: China General Microbiological Culture Collection Center (CGMCC)
[0032] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing
[0033] Viability: Yes Detailed implementation methods
[0034] The methods in the following examples are all conventional methods unless otherwise specified.
[0035] The following examples are used to illustrate the present invention, but not to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the reagents used are all commercially available products.
[0036] Example 1 Isolation of Porcine Rotavirus Genotype G9
[0037] 1. Collection and treatment of intestinal tissues
[0038] Collect porcine intestinal tissues, cut them into small pieces, add 10 times the volume of DMEM medium containing 500 units of double antibiotics, grind, centrifuge at 12,000 rpm for 5 min at 4°C, take the supernatant of the grinding solution, and freeze it at -80°C for later use.
[0039] 2. Detection of pathogens in intestinal tissues
[0040] Take 200 μl of the supernatant of the above grinding solution, use the DNA / RNA extraction kit of Beijing TransGen Biotech Co., Ltd. to extract DNA and RNA according to the instructions; then, use the TransGen reverse transcription kit to reverse transcribe RNA into cDNA. Using the extracted DNA and reverse transcribed cDNA as templates, respectively use 9 pairs of detection primers for classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine pseudorabies virus (PRV), porcine circovirus type 2 / 3 (PCV2 / PCV3), porcine parvovirus (PPV), transmissible gastroenteritis virus of swine (TGEV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV) and TransGen 2×EasyTaq PCR SuperMix for PCR detection, and set positive and negative controls at the same time. The detection results show that the ground material solution is positive for porcine rotavirus and negative for other pathogens.
[0041] 3. Isolation of Porcine Rotavirus Genotype G9
[0042] In 2023, intestinal tissues were collected from a diseased pig farm in Neijiang, Sichuan. The intestinal tissue materials that tested positive by RT-PCR. The pigs in the infected pig farm showed clinical symptoms such as watery diarrhea and vomiting. The intestinal tissues of the infected pigs were collected and inoculated into Marc145 cells. After incubation for 1 hour, the incubation fluid was discarded and replaced with serum-free DMEM containing 5 μg / ml of trypsin for maintenance culture. After 84 hours of inoculation, the cells showed shrinkage, syncytium aggregation, and a small amount of detachment, while the normal cells showed no lesions. After 5 days of inoculation, the cell culture was harvested and passaged continuously 3 times on Marc145 cells. The fourth passage was inoculated onto MA104 cells. After 18 hours, the cells showed obvious aggregation, shrinkage, and a small amount of detachment( Figure 1 ), and the virus was harvested after 20 hours of inoculation and passaged continuously 3 times on MA104 cells, and cytopathic effect (CPE) could stably appear.
[0043] The 8th generation product was identified by RT-PCR. Nucleic acids were extracted according to the instructions of the Beijing TransGen Biotech DNA / RNA Extraction Kit, and reverse transcription was carried out according to the instructions of the TransGen Biotech EasyScript First-Strand cDNA Synthesis SuperMix. The primers for porcine rotavirus identification used in PCR were: VP7-Beg9-F: GCCTTTAAAAGAGAGAATTTCCGTCTGG;
[0044] VP7-End9-R: GGTCACATCATACAATTCTAATCTAAG.
[0045] The product was electrophoresed on 1% agarose gel, and a positive band with a size of about 1026 bp appeared, as Figure 2 . Thus, it was confirmed that porcine rotavirus was successfully isolated.
[0046] The amplified product was electrophoresed on 1% agarose gel, and the target band was cut out, recovered, purified, and then sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. The VP7 genomic sequence of porcine rotavirus was obtained by splicing each fragment, as shown in SEQ ID No.1.
[0047] The nucleic acid sequence of the VP7 genome of porcine rotavirus obtained by splicing was aligned online by NCBI Blast, and it was found that the highest homology with the existing porcine rotavirus G9 strain sequence was 98.44% (the online alignment website is https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Therefore, this strain was determined to be a new porcine rotavirus G9 type.
[0048] The isolated virus was passaged and propagated in MA104 adherent cells. The porcine rotavirus G9 type cultured in the 4th generation of adherent cells was inoculated into MA104 adherent cells for propagation at a ratio of 0.2%. Aggregation and fusion lesions appeared 18 hours after inoculating the cells, as Figure 1 , while there were no obvious lesions in normal cells. The cell culture was harvested 20 hours later. The porcine rotavirus G9 type was continuously passaged to the 7th generation. Obvious cytopathic effects appeared 15 hours after culturing. After being identified as positive, a strain of porcine rotavirus G9 type was expanded in culture and named SC01. The porcine rotavirus G9 type SC01 was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms (Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing) on September 23, 2024, with the deposit number CGMCC No. 46200.
[0049] The porcine rotavirus G9 type was inoculated into MA104 adherent cells for culture. Typical cytopathic effects appeared around 18 hours, as Figure 1 . When the cytopathic effects reached about 90%, the culture was harvested and freeze-thawed once. The virus titer was determined to be 1.0×10 9 TCID 50 / ml according to the Reed & Muench method.
[0050] Example 2 Pathogenicity experiment of porcine rotavirus G9 type SC01
[0051] Nine 40-day-old piglets with negative porcine rotavirus pathogens and antibodies were screened and randomly divided into 3 groups, with 3 pigs in each group. The experimental group was inoculated by nasal cavity and intramuscular injection. Each pig was inoculated nasally with 2 ml of 10 7.0 TCID 50 F8 passage virus solution and intramuscularly injected with 1 ml of 10 7.0 TCID 50 F8 passage virus solution; each pig in the control group was inoculated nasally and intramuscularly with an equal volume of sterile PBS solution. The status of the pigs was observed daily, and the rectal temperature was measured and recorded.
[0052] After continuous observation for 10 days, the body temperatures of both the experimental group and the control group fluctuated within the normal range. Through clinical symptom observation, it was found that the pigs in both the experimental group and the control group had normal appetites, no diarrhea occurred, and no pigs died, and all survived. The above data indicate that the isolated strain SC01 of porcine rotavirus G9 type has no obvious pathogenicity to weaned piglets.
[0053] Before virus challenge (day 0) and on days 3, 5, 7, and 10 after virus challenge, blood samples and rectal swabs were collected from each pig in the virus-challenged group and the control group. Serum was separated, and virusemia and virus shedding were detected by RT-PCR. The results of virusemia detection are shown in Table 1. The results of virus shedding detection are shown in Table 2. The data showed that virusemia and virus shedding occurred in the virus-challenged pigs on day 3, and neither virusemia nor virus shedding occurred after day 10.
[0054] Table 1 Results of virusemia detection before and after virus challenge
[0055]
[0056] Table 2 Results of pathogen detection of rectal swabs before and after virus challenge
[0057]
[0058] The data of the virus challenge experiment showed that the isolated strain SC01 of the present invention caused no obvious clinical symptoms after infecting weaned piglets and was a low-virulence strain.
[0059] Example 3 Application of the isolated strain SC01 in the preparation of an inactivated vaccine against porcine rotavirus G9
[0060] 1. Preparation of the inactivated vaccine against porcine rotavirus G9
[0061] The SC01 isolate was inoculated into adherent Marc145 cells or MA104 cells at 1% of the culture volume for continuous passage. The virus solution was harvested, frozen and thawed once, and then centrifuged to collect the supernatant. The virus titer was measured. When the virus titer was greater than 10 7.0 TCID50 / ml, after passing the sterility and exogenous virus tests, formaldehyde with a final concentration of 0.2% was added for inactivation. The inactivated virus solution was formulated into an inactivated vaccine by adding an adjuvant.
[0062] Vaccine formulation method:
[0063] Formula of the colloidal water adjuvant self-made by China Animal Husbandry: 90% aqueous injection solution, 3% poly(lactic-co-glycolic acid) (PLGA), 2% polyvinylpyrrolidone, 2% alkyl polyglycoside (decyl glucoside) (APG0816), 1% polyethylene glycol 6000, 1% polyoxyethylene sorbitan monooleate, 1% cetyl alcohol. Among them, % is the mass percentage.
[0064] Weigh 12 g of the colloidal water adjuvant self-made by China Animal Husbandry and mix it with the inactivated antigen in an equal volume, and shake well.
[0065] 2. Vaccine safety test
[0066] Twelve piglets at about 30 days old that were negative for porcine rotavirus pathogen and antibody were selected and randomly divided into 4 groups, with 3 piglets in each group. The experimental group was injected intramuscularly at multiple points with 2 doses (4 ml) of inactivated vaccine, and the vaccine was inoculated a second time after 14 days; the control group was injected intramuscularly at multiple points with an equal volume of sterile PBS solution, and PBS was inoculated a second time after 14 days; they were continuously observed for 21 days. The results showed that there were no significant differences in the mental state, body temperature and daily weight gain of the piglets in the experimental group compared with the control group, and no adverse reactions occurred.
[0067] 3. Vaccine efficacy test
[0068] Twelve weaned piglets that were negative for porcine rotavirus pathogen and antibody were screened and randomly divided into 4 groups, with 3 piglets in each group. The experimental group was injected intramuscularly with 1 dose (2 ml) of inactivated vaccine, and the control group was injected intramuscularly with an equal volume of sterile PBS solution; they were continuously observed for 35 days. Blood was collected on days 7, 14, 21, 28, and 35, serum was separated, inactivated at 56 °C for 30 min, and the neutralizing antibody against porcine rotavirus genotype G9 was measured. The neutralizing antibody detection results (shown in Table 3) showed that the inactivated vaccine prepared by passage of the strain SC01 of the present invention could produce high-level neutralizing antibodies 28 days after immunization and had good immunogenicity.
[0069] Table 3 Neutralizing antibody detection results after immunization with inactivated vaccine
[0070]
[0071] Application of isolate SC01 in the preparation of an indirect ELISA detection kit
[0072] 1. Propagate the SC01 virus isolate for standby.
[0073] Amplify the SC01 virus using MA104 adherent cells. When obvious cytopathic effects appeared in the cells, the virus was harvested and stored at -80 °C, and freeze-thawed once. Then centrifuge at 6000 r / min for 5 min to remove cell debris. Purify the virus by sucrose density gradient centrifugation. Dilute the purified virus with PBS and measure the protein concentration.
[0074] 2. Specific steps of indirect ELISA.
[0075] (1) Coating with whole virus antigen: Use the purified whole virus as the coating antigen, serially dilute the antigen and serum, and use the square titration method to determine the optimal coating concentration of the virus and the optimal serum dilution. The optimal coating concentration of the virus is 2.8 μg / ml, and the optimal serum dilution is 1:100.
[0076] Dilute the purified virus with the coating solution and coat the ELISA plate with 100 μL per well overnight at 4 °C.
[0077] (2) Discard the coating solution, wash 3 times with PBS, add 200 μL of 5% skim milk powder to each well, and incubate at 37 °C for 2 hours. Discard the skim milk, and then wash 3 - 5 times with PBST, 3 - 5 minutes each time.
[0078] (3) Dilute the serum to be tested with PBS, then add 100 μL to each well, incubate at 37 °C for 1 hour, and set up negative serum and positive serum controls simultaneously. Discard the liquid, and wash 3 - 5 times with PBST, 3 - 5 minutes each time.
[0079] (4) Determine the optimal conditions for the secondary antibody: The optimal dilution of the secondary antibody is 1:10000, and the optimal incubation time is 1 hour.
[0080] Add the diluted horseradish peroxidase - labeled anti - pig IgG secondary antibody, 100 μL to each well, and incubate at 37 °C for 1 hour. Discard the secondary antibody, and wash 3 - 5 times with PBST, 3 - 5 minutes each time.
[0081] (5) Add 100 μL of TMB chromogenic solution to each well and develop color for 10 minutes in the dark.
[0082] (6) Add 50 μL of the termination solution 2M H 2 SO 4 , and read the OD450 value. Cut - off value for positive and negative: OD
[0083] ≥ 0.575 is judged as positive, OD < 0.354 is judged as negative, and 0.354 ≤ OD < 0.575 is suspicious.
[0084] The results of the negative and positive serum controls are valid. Randomly detect 15 porcine sera.
[0085] At the same time, detect by neutralization test synchronously. The specific method is as follows:
[0086] Inactivate the serum to be tested at 56 °C for 30 minutes. Dilute the serum to be tested from 1:4 to 1:64, make 3 replicates for each dilution, add 50 μL to each well, and set up positive control and negative control. Add 50 μL of the virus solution with 100 TCID 50 to each well except the control wells. Incubate at 37 °C in a 5% carbon dioxide incubator for 1 h for neutralization. Add 100 μL of the MA104 adherent cell suspension diluted to 3×10 5 / mL - 4×10 5 / mL to each well after neutralization, and incubate at 37 °C in a 5% carbon dioxide incubator for 48 h - 72 h, and observe CPE every day. The results of the positive control and negative control are valid, and the antibody detection results of 15 porcine sera are shown in Table 4. Note: If lesions appear at 1:8 of the serum to be tested, it is judged as positive; 1:4 is judged as suspicious; < 1:4 is judged as negative.
[0087] 3. The results of porcine serum antibody detection are shown in Table 4.
[0088] 4. Conclusion: The results of detecting porcine serum antibodies with the indirect ELISA kit are consistent with those detected by the neutralization test simultaneously, indicating that the method of detecting porcine serum antibodies with the indirect ELISA kit is established.
[0089] Table 4 Results of Detecting Porcine Serum Antibodies with the Indirect ELISA Kit
[0090]
[0091] Note: "+" represents positive; "-" represents negative.
[0092] 5. Specificity Test of the Indirect ELISA Detection Kit
[0093] Using three batches of the indirect ELISA detection kits in Example 4, according to the usage method described in Example 4, 25 healthy porcine sera (provided by China Animal Husbandry Industry Co., Ltd.), 3 porcine classical swine fever virus (CSFV) positive sera (purchased from China Institute of Veterinary Drug Control), 3 porcine reproductive and respiratory syndrome virus (PRRSV) positive sera (provided by China Animal Husbandry Industry Co., Ltd.), 3 porcine foot-and-mouth disease virus type O (FMDV-O) positive sera (provided by China Animal Husbandry Industry Co., Ltd.), and 3 porcine foot-and-mouth disease virus type A (FMDV-A) positive sera (provided by China Animal Husbandry Industry Co., Ltd.) were detected respectively.
[0094] The specific detection results of the kit are shown in the following table (Table 5). The detection results of 25 healthy porcine sera show that the specificity of all batches of kits is 100.0%. The detection results of 3 porcine classical swine fever virus (CSFV) positive sera, 3 porcine reproductive and respiratory syndrome virus (PRRSV) positive sera, 3 porcine foot-and-mouth disease virus type O (FMDV-O) positive sera, and 3 porcine foot-and-mouth disease virus type A (FMDV-A) positive sera all show negative. Therefore, the specificity of the three batches of kits for detecting these 12 relevant pathogen positive sera is 100%.
[0095] Table 5 Specific Detection Results of the Indirect ELISA Kit for Antibody Detection
[0096]
[0097]
[0098] 6. Sensitivity Test of the Indirect ELISA Detection Kit
[0099] Using the three batches of indirect ELISA test kits in Example 4, 32 porcine sera to be tested collected from pig farms (all sera infected with wild virus, provided by China Animal Husbandry Industry Co., Ltd., inactivated at 56 °C for 30 min) were tested according to the usage method described in Example 4. The experimental results are shown in Table 6. The kit of batch Z1 of the present invention detected 31 in total, and the sensitivity of this kit to the 32 sera to be tested was 96.88%; the kit of batch Z2 of the present invention detected 32 in total, and the sensitivity of this kit to the 32 sera to be tested was 100.00%; the kit of batch Z3 of the present invention detected 32 in total, and the sensitivity of this kit to the 32 sera to be tested was 100.00%.
[0100] Table 6 Detection results of the sensitivity of the indirect ELISA test kit
[0101] Kit batch number Detection rate Sensitivity Z1 31 / 32 96.88% Z2 32 / 32 100.00% Z3 32 / 32 100.00%
[0102] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.
Claims
1. A porcine rotavirus G9 strain, characterized in that: The porcine rotavirus G9 strain is named SC01, classified as porcine rotavirus, and has a collection number of CGMCC No.46200 at the General Microbiological Center of the China Culture Collection Administration.
2. The porcine rotavirus G9 strain according to claim 1, characterized in that: The VP7 gene sequence of porcine rotavirus G9 type is shown in sequence 1 in the sequence table.
3. A biological product containing the porcine rotavirus G9 strain according to claims 1 and 2, wherein the biological product is used to prevent or diagnose viral diseases caused by porcine rotavirus G9.
4. The biological product according to claim 3, characterized in that: The biological product is a vaccine or a diagnostic reagent.
5. The biological product according to claim 4, characterized in that: The vaccine is a live vaccine or an inactivated vaccine, and also includes a pharmaceutically acceptable adjuvant.
6. The biological product according to claim 4, characterized in that: The diagnostic reagent is an ELISA kit, which includes an ELISA plate coated with the whole virus of porcine rotavirus G9 type CGMCC No.46200 and an enzyme-labeled secondary antibody.
7. Use of the porcine rotavirus G9 strain according to claims 1 and 2 in the preparation of a vaccine for preventing porcine rotavirus G9 disease.
8. Use of the porcine rotavirus G9 strain according to claims 1 and 2 in the preparation of reagents for diagnosing viral diseases caused by porcine rotavirus G9.
9. The use according to claim 8, characterized in that: The reagent is an ELISA kit.
10. The use according to claim 8, characterized in that: ELISA kit for detecting porcine rotavirus G9 antibodies in serum.
Citation Information
Cited By
Porcine rotavirus VP8 protein-based IgG and IgA antibody detection kit as well as preparation method and application thereof
CN121208338A