Construction of vIL-10 gene deleted orf vaccine strain and application of vIL-10 gene deleted orf vaccine strain as vaccine

Abstract

The invention belongs to the technical field of preparation of veterinary vaccines, and particularly relates to construction of a vIL-10 gene-deleted ecthyma vaccine strain and application of the vIL-10 gene-deleted ecthyma vaccine strain as a vaccine, a gene engineering homologous recombination method is adopted to delete a vIL-10 virulence gene of an ecthyma OrfVirus HB-TS09F65 vaccine strain virus, and an attenuated ecthyma gene-deleted strain ORFV-HB-TS09F65 delta vIL-10 is obtained; the ORFV-HB-TS09F65 [delta] vIL-10 attenuated orf gene deleted strain has the advantages that compared with clinical virulence and deletion virulence obtained by deleting vIL-10 virulence genes through the virulence, the virulence of the ORFV-HB-TS09F65 [delta] vIL-10 attenuated orf gene deleted strain is obviously weakened, the safety is obviously improved, and compared with artificial passage attenuated vaccine parent virulence, the virulence of the ORFV-HB-TS09F65 [delta] vIL-10 attenuated orf gene deleted strain is weaker, and the safety is further improved; moreover, good immunogenicity is kept, and the gene deletion strain is suitable for being used as a candidate strain of an orf gene deletion vaccine.

Description

Technical Field

[0001] The present invention belongs to the technical field of veterinary vaccine preparation, and particularly relates to the construction of a vIL-10 gene-deleted orf virus vaccine strain and its application as a vaccine. Background Art

[0002] Orfvirus, also known as contagious ecthyma (CE) or contagious pustular dermatitis (CPD) in sheep, is an acute, contagious and epitheliotropic zoonotic disease of goats, sheep and humans caused by Orfvirus (ORFV), a member of the parapoxvirus family. It is characterized by the formation of erythema, papules, pustules, ulcers and verrucous thick crusts on the skin and mucous membranes of the lips, hooves, udders, vulvas, etc. of diseased sheep. In recent years, contagious ecthyma has occurred in flocks all over the world, showing a global epidemic trend. Existing epidemiological investigation and research data show that the incidence of this disease is about 50%, and it can reach 90% in sensitive flocks. Therefore, once this disease occurs, it will cause significant economic losses to sheep farmers and seriously endanger the healthy development of the meat sheep industry. More seriously, this disease can infect breeders through wounds, and it is a relatively serious zoonotic disease.

[0003] At present, there is no effective preventive or therapeutic drug for orf. Vaccination is an effective way to prevent the occurrence and spread of this disease. Traditional attenuated orf vaccines have been developed in China, but they have not been mass-produced due to process and other problems. In addition, existing orf vaccines cannot distinguish between vaccine immunity and virulent infection, and cannot trace the immune effect of the vaccine. At the same time, traditional attenuated vaccines also have the potential risk of reversion to virulence.

[0004] It has been proven that large molecular DNA viruses such as poxviruses are more suitable for developing gene-deleted vaccines, which can effectively solve the problems of reversion to virulence and the inability to distinguish between vaccine immunity and virulent infection. For example, the most successful clinically applied gene-deleted vaccines for bovine herpesvirus (BHV-1) and porcine pseudorabies virus (PRV) have played an important role in the international and domestic bovine infectious rhinotracheitis and porcine pseudorabies immunization eradication programs. Gene deletion of orf virus has been studied both at home and abroad, but most of them focus on the research of gene function, and no functional and effective vaccine has been developed. Therefore, developing a safe, low-toxic and highly effective gene-deleted orf vaccine is an urgent problem to be solved for preventing and controlling the epidemic of orf.

[0005] The ORFV vIL-10 gene is located in the variable region at the end of the ORFV genome and is one of the genes expressed early by the virus. It encodes interleukin 10 (IL-10), which mainly inhibits the Th1-type cellular immune response of ORFV by reducing the synthesis of cytokines such as IL-2, IL-3, IFN-γ, and GM-CSF. In addition, vIL-10 can also inhibit macrophages, lymphocytes, and keratinocytes from secreting TNF-α, IL-8, and IFN-γ, and inhibit the recruitment of monocytes, DC cells, and mast cells to the skin sites infected with ORFV, thereby inhibiting the cellular immune response of ORFV.

[0006] During the research process, the inventors found that by using the method of genetic engineering homologous recombination to delete the vIL-10 virulence gene of the traditional attenuated orf vaccine strain virus, an attenuated orf gene deletion strain ORFV-HB-TS09F65ΔvIL-10 was obtained; compared with the clinical virulent strain and the deletion strain obtained by deleting the vIL-10 virulence gene of the virulent strain, its virulence was significantly weakened and its safety was significantly improved. Compared with the vaccine parental strain attenuated by artificial passage, its virulence was weaker and its safety was further improved; at the same time, compared with the virulent strain and the vaccine parental strain, the ORFV-HB-TS09F65ΔvIL-10 vaccine deletion strain still maintained good immunogenicity. Therefore, this gene deletion strain is suitable as a candidate orf vaccine strain. Summary of the Invention

[0007] The object of the present invention is to use the traditional attenuated orf vaccine strain in the laboratory (OrfVirus HB-TS09F65 strain) (the strain preservation number is CCTCC NO: V201406, patent number: ZL201410160855.0), and use the method of gene recombination to delete its vIL-10 gene, so as to provide a safe, low-toxic, and long-lasting immune vaccine candidate strain for the research and development of orf gene deletion vaccine.

[0008] The present invention is implemented through the following technical solutions:

[0009] The primary object of the present invention is to provide the application of preparing an attenuated orf virus strain by inhibiting the expression of the vIL-10 gene, deleting or conditionally knocking out the vIL-10 gene in the orf virus. The vIL-10 gene sequence is as shown in SEQ ID NO.1. The orf virus is the cell-passaged attenuated virus of orf virus OrfVirus HB-TS09F65 strain, which was deposited in the China Center for Type Culture Collection on March 19, 2014, and the deposit number is CCTCC NO.V201406.

[0010] The vIL-10 sequence of the ORFV HB-TS09F65 strain virulence gene is:

[0011] ATGTCGAACAACAAAATTCTAGTGTGTGTTGCGATTATTCTTACTTATACATTATACAC

[0012] AAATGCGTATTGTGTTGAGTATTTGGAAAGTGAGGAGGATAAACAACAGTGCGGTAGT

[0013] AATGGTGCGTCTTCGAGTTCACCGCACATGCTCAGAGAACTCAGGGCCGCGTTCGGAA

[0014] AGGTAAAAACCTTCTTCCAGATGAAAGACCAACTGAACAGTATGCTACTCACACAGTC

[0015] GCTCCTCGACGACTTCAAAGGCTACCTTGGGTGTCAGGCACTTTCCGAGATGATACAGT

[0016] TTTACTTGGAAGAGGTAATGCCGCAGGCGGAAAATCACGGGCCGGACGTCAAAGAGC

[0017] ACGTTAACTCGCTGGCAGAAAAGCTTAAAACGCTGCGTCTTCGACTGCGTCGCTGCCA

[0018] CCGCTTCCTGCCGTGTGAGAACAAGAGTAAGGCCGTGGAGCAAGTCAAACGCGTGTTC

[0019] AACATGCTGCAGGAACGAGGTGTTTACAAGGCCATGAGCGAGTTCGACATATTCATCAACTACATAGAATCATACATGACTACTAAATCATAA(SEQ ID No.1)

[0020] The second object of the present invention is to provide the application of preparing an attenuated orf vaccine by inhibiting the expression of the vIL-10 gene, deleting or conditionally knocking out the vIL-10 gene in orf virus, wherein the vIL-10 gene sequence is as shown in SEQ ID NO.1, and the orf virus is the attenuated cell passage of orf virus OrfVirus HB-TS09F65 strain, which was deposited in the China Center for Type Culture Collection on March 19, 2014, and the deposit number is CCTCC NO.V201406.

[0021] The third object of the present invention is to provide an attenuated orf virus strain, and the attenuated orf virus strain includes an orf virus strain with inhibited, deleted or conditionally knocked out vIL-10 gene expression. The orf virus is the cell passage-attenuated virulent OrfVirus HB-TS09F65 strain of contagious ecthyma virus of sheep, which was deposited at the China Center for Type Culture Collection on March 19, 2014, and the deposit number is CCTCC NO.V201406.

[0022] Preferably, the attenuated orf virus strain is an orf virus strain with conditionally knocked out vIL-10 gene. The orf virus is the cell passage-attenuated virulent OrfVirus HB-TS09F65 strain of contagious ecthyma virus of sheep, which was deposited at the China Center for Type Culture Collection on March 19, 2014, and the deposit number is CCTCC NO.V201406.

[0023] The fourth object of the present invention is to provide a preparation method for preparing the attenuated orf virus strain. The method is to conditionally knock out the vIL-10 of the cell passage-attenuated virulent OrfVirus HB-TS09F65 strain of contagious ecthyma virus of sheep by genetic engineering means. The vIL-10 gene sequence is shown in SEQ ID NO.1. The cell passage-attenuated virulent OrfVirus HB-TS09F65 strain of contagious ecthyma virus of sheep was deposited at the China Center for Type Culture Collection on March 19, 2014, and the deposit number is CCTCC NO.V201406.

[0024] Preferably, the method includes the following steps: (1) Design and synthesize a gene deletion transfer vector plasmid with the reporter gene being EGFP: pUC57-127L-EGFP-127R;

[0025] (2) Transfect the designed and synthesized transfer vector plasmid: pUC57-127L-EGFP-127R into BT cells inoculated with ORFV HB-TS09F65 strain virus by liposome transfection method;

[0026] (3) Through fluorescence plaque combined with fluorescence single cell screening, screen the monoclonal gene deletion virus with the reporter gene being green fluorescence. After multiple rounds of screening and PCR identification, obtain the recombinant virus strain with deleted vIL-10 gene: ORFV-HB-TS09F65△vIL-10.

[0027] The fifth object of the present invention is to provide the application of the attenuated orf gene deletion virus strain in preparing an orf gene deletion attenuated vaccine.

[0028] The sixth object of the present invention is to provide an attenuated orf virus vaccine, and the attenuated orf virus vaccine includes the attenuated orf virus strain described above.

[0029] The seventh object of the present invention is to provide an orf gene-deleted attenuated vaccine strain. A reporter gene EGFP is introduced into the vIL-10 deletion region of the deleted strain, enabling visual operation during the screening and purification of the deleted virus. Meanwhile, during the vaccine immunization process, the specific marker in this region can serve as an effective target for differentiating vaccine immunization from wild virus infection.

[0030] The beneficial effects of the present invention are as follows: The present invention uses the method of genetic engineering homologous recombination to delete the vIL-10 virulence gene of the orf virus Orf VirusHB-TS09F65 strain, obtaining an attenuated orf vaccine strain ORFV-HB-TS09F65ΔvIL-10. Compared with the clinical virulent strain and the deleted strain with the vIL-10 virulence gene deleted from the virulent strain, its virulence is significantly weakened and its safety is significantly improved. Compared with the vaccine parental strain attenuated by artificial passage, its virulence is weaker and its safety is further improved. At the same time, compared with the virulent strain and the vaccine parental strain, the ORFV-HB-TS09F65ΔvIL-10 vaccine deleted strain still maintains good immunogenicity. A reporter gene EGFP is introduced into the vIL-10 deletion region of the deleted strain, enabling visual operation during the screening and purification of the virus. Meanwhile, during the vaccine immunization process, the specific marker in this region can serve as an effective target for differentiating vaccine immunization from wild virus infection. Therefore, this gene-deleted strain is suitable as a candidate for the orf gene-deleted vaccine. Description of the Drawings

[0031] Figure 1 Schematic diagram of the construction of the ORFVΔvIL-10 gene-deleted strain

[0032] Figure 2 Results of transfection of the recombinant plasmid

[0033] Note: A: Observation of cells with green fluorescence of the recombinant virus ORFV-HB-TS09F65ΔvIL-10 under a fluorescence microscope; B: Superimposed photo of the fluorescence and cells observed under a fluorescence microscope; C: CPE observed under a fluorescence microscope;

[0034] D: Observation of cells with green fluorescence of the recombinant virus ORFV-CFF15ΔvIL-10 under a fluorescence microscope; E: Superimposed photo of the fluorescence and cells observed under a fluorescence microscope; F: CPE observed under a fluorescence microscope

[0035] Figure 3Fluorescent plaque screening of ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus for recombinant virus Note: A, B, C: The first round of screening; D, E, F: The second round of screening; G, H, I: The third round of screening; A, D, G: Green fluorescence produced after recombinant virus infects cells; B, E, H: Photos of the superposition of fluorescence and cells; C, F, I: CPE produced by recombinant virus

[0036] Figure 4 Fluorescent plaque screening of ORFV-CFF15ΔvIL-10 gene-deleted virus for recombinant virus Note: A, B, C: The first round of screening; D, E, F: The second round of screening; G, H, I: The third round of screening; A, D, G: Green fluorescence produced after recombinant virus infects cells; B, E, H: Photos of the superposition of fluorescence and cells; C, F, I: CPE produced by recombinant virus

[0037] Figure 5 Fluorescent single-cell screening of ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus Note: A, B, C: The first round of screening; D, E, F: The second round of screening; G, H, I: The third round of screening; A, D, G: Green fluorescence produced after recombinant virus infects cells; B, E, H: Photos of the superposition of fluorescence and cells; C, F, I: CPE produced by recombinant virus

[0038] Figure 6 Fluorescent single-cell screening of ORFV-CFF15ΔvIL-10 gene-deleted virus

[0039] Note: A, B, C: The first round of screening; D, E, F: The second round of screening; G, H, I: The third round of screening; A, D, G: Green fluorescence produced after recombinant virus infects cells; B, E, H: Photos of the superposition of fluorescence and cells; C, F, I: CPE produced by recombinant virus

[0040] Figure 7 Subculture and expansion of ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus Note: A, B, C: Culture in 96-well plates; D, E, F: Culture in 24-well plates; G, H, I: Culture in 12-well plates; J, K, L: Culture in 12-well plates; M, N, O: Culture in T75 cell flasks

[0041] Figure 8 Subculture and expansion of ORFV-CFF15ΔvIL-10 gene-deleted virus Note: A, B, C: Culture in 96-well plates; D, E, F: Culture in 24-well plates; G, H, I: Culture in 12-well plates; J, K, L: Culture in 12-well plates; M, N, O: Culture in T75 cell flasks

[0042] Figure 9 PCR identification results of gene-deleted recombinant virus

[0043] M: DL5000 DNA Marker; 1: ORFV-HB-TS09F65 parental virus; 2: ORFV-CFF15 parental virus; 3: ORFV-HB-TS09F65 ΔvIL-10 gene-deleted virus; 3: ORFV-CFF15 ΔvIL-10 gene-deleted virus

[0044] Figure 10 Growth curves of the gene-deleted virus and its parental virus

[0045] Figure 11 Genetic stability detection of ORFV-HB-TS09F65 ΔvIL-10 gene-deleted virus Note: M. DNA molecular Marker; 1. The 5th generation of the gene-deleted virus; 2. The 10th generation of the gene-deleted virus; 3. The 10th generation of the gene-deleted virus

[0046] Figure 12 Genetic stability detection of ORFV-CFF15 ΔvIL-10 gene-deleted virus Note: M. DNA molecular Marker; 1. The 5th generation of the gene-deleted virus; 2. The 10th generation of the gene-deleted virus; 3. The 10th generation of the gene-deleted virus

[0047] Figure 13 Detection of antibody levels in rabbits immunized with the gene-deleted virus and its parental virus Specific implementation manners

[0048] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will be clearer with the description of the specific embodiments. However, these embodiments are only exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that the technical solutions and details of the present invention can be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0049] It should be noted that in the following embodiments, unless otherwise specified, the methods used are all conventional methods; the reagents used are all conventional reagents and can be purchased from the market.

[0050] The size of the venom virus particle is about: 220-300nm long and 140-200nm wide. Under the electron microscope, mature venom virus particles are oval or elliptical coil-like structures, while immature virus particles may be cone-shaped or other special coil-like spherical particles. The virus membrane is wrapped with a layer of lipid capsule, which is a spiral "8" structure. The venom virus genome is a linear double-stranded DNA, about 130 to 150kb long, and the two ends of the genome are covalently closed hairpin structures. Most scholars believe that ORFV includes a total of 134 ORFs, of which 127 are linear genes. Similar to other members of the Poxviridae family, the ORFV genome includes variable regions of reverse terminal repeat sequences at both ends (ORF001-008, ORF112-134) and a larger coding conservative region in the middle (ORF009-ORF111). Most of the genes in the middle conserved region are mainly related to ORFV structure, viral morphogenesis and viral replication; the genes in the terminal variable region of the ORFV genome are mainly related to viral virulence, host range, immune regulation and viral assembly and maturation. Therefore, at the molecular level, elucidating the characteristics of ORFV viral genes and the functions of encoded proteins is of great significance for the differential diagnosis and immune prevention of the disease, especially the genes in the terminal variable region.

[0051] It should be noted that the ORFV-HB-TS09F65 parent virus described in the present invention is a vaccine strain obtained by passage of the ORFV-HB-TS09 strain to the 65th generation, and it was deposited in the China Center for Type Culture Collection on March 19, 2014, with the deposit number CCTCC NO: V201406, and an invention patent ZL201410160855.0 has been applied for.

[0052] The Cre / Loxp system consists of two parts: Cre recombinase and Loxp site. Cre recombinase is a specific recombinase found in P1 phage. It is a 38kDa protein that can recognize specific DNA sequences, namely LoxP sites. It mediates specific recombination between two LoxP sites, so that the gene sequence between the LoxP sites is deleted or recombined.

[0053] The LoxP site also comes from the P1 phage and is composed of two 13bp inverted repeat sequences and an 8bp spacer sequence. The spacer sequence determines the direction and is the specific recombination site for the Cre recombinase. Depending on the location and direction of the loxP site, recombination can generally have three results:

[0054] ① Synchronous deletion: If the loxP sites are on the same DNA chain and in the same direction, the sequence between the loxP sites will be deleted (not retained) as a circular DNA fragment.

[0055] ② Reverse inversion: Two opposite Loxp sites are constructed on the same chromosome. Under the action of Cre recombinase, the target gene between the Loxp sites is inverted in the opposite direction.

[0056] ③ Chromosomal translocation between different chromosomes: One Loxp site is constructed on each of different chromosomes. Under the action of Cre recombinase, the genes behind the LoxP sites undergo recombination, and large fragments of genes on different chromosomes exchange with each other, resulting in chromosomal translocation.

[0057] Example 1 Construction and screening of an orf virus vIL-10 gene deletion strain

[0058] 1.1 Construction of a virus with a deleted green fluorescent marker gene using the Cre-Loxp recombinase system

[0059] The ORFV vIL-10 gene is located in the variable region at the end of the ORFV genome and is an early viral gene encoded by the ORFV127 open reading frame (ORFs), encoding interleukin 10 (IL-10). The ORFV vIL-10 gene is a polypeptide composed of 186 amino acid molecules with a molecular weight of approximately 21.7 kDa. This polypeptide has a homology of up to 91% with the amino acids of adult sheep IL-10. Among them, nearly two-thirds of the amino acid sequence of the vIL-10 polypeptide near the C-terminal region is exactly the same as the corresponding amino acid sequence of sheep IL-10; the similarity of the N-terminal region with cellular IL-10 is relatively low but shows a relatively high similarity with Epstein-Barr virus IL-10. vIL-10 can inhibit the Th1-type cellular immune response of the body by reducing the synthesis of cytokines such as IL-2, IL-3, IFN-γ, and GM-CSF. In addition, vIL-10 can also inhibit the secretion of TNF-α, IL-8, and IFN-γ by macrophages, lymphocytes, and keratinocytes, as well as inhibit the recruitment of monocytes, DC cells, and mast cells to the skin sites infected with ORFV. Therefore, vIL-10 plays an important role in downregulating the immune response and inhibiting inflammation after ORFV infects the body. It has now been proven that ORFV mainly initiates immunity through cellular immunity, and mainly Th1-type immunity in cellular immunity. Therefore, deleting this gene can theoretically reduce the virulence of ORFV and also reduce the inhibitory effect of ORFV on Th1-type immunity. Therefore, deleting this gene is expected to be developed into an orf virus gene deletion vaccine. In the deletion of the present invention, vIL-10 is deleted and the EGFP reporter gene is introduced. The specific method is as Figure 1 . Based on the attenuated ORFV-HB-TS09F65 strain and the clinically isolated ORFV-CFF15 virulent strain, LoxP sequences in the same direction are constructed into the gene expression cassette of the transfer vector using homologous recombination for the excision of the EGFP fluorescent tag after the subsequent determination of the vaccine strain.

[0060] 1.2 Construction of ORFV-HB-TS09F65ΔvIL-10 and ORFV-CFF15ΔvIL-10 gene deletion strains

[0061] 1.2.1 Construction of ORFV-HB-TS09ΔvIL-10 and ORFV-CFF15ΔvIL-10 gene deletion transfer vector plasmids

[0062] In the present invention, we simultaneously utilized homologous recombination technology and the Cre-LoxP system to construct an ORFV gene deletion strain (ORFV-HB-TS09F65ΔvIL-10) lacking the vIL-10 gene and carrying a green fluorescent marker.

[0063] According to the whole genome sequencing results of the ORFV-HB-TS09F65 vaccine strain and ORFV-CFF15, 1500 bp were selected upstream and downstream of the vIL-10 gene (ORF127) respectively to design primers for amplifying the homologous arms (see Table 1). According to Figure 1 The pUC57-127L-EGFP-127R transfer vector plasmid was designed and synthesized.

[0064] Table 1 Primer sequences

[0065]

[0066] 1.3 Screening of ORFV-HB-TS09ΔvIL-10 and ORFV-CFF15ΔvIL-10 gene deletion recombinant viruses

[0067] 1.3.1 Cell transfection

[0068] BT cells in good condition were selected and seeded in a 6-well plate. When the cell density reached about 70%, the attenuated ORFV-HB-TS09 strain vaccine and ORFV-CFF15 (a virulent strain isolated from sheep in Chifeng, Inner Mongolia in 2015, the 15th passage of the virulent strain) were inoculated into the monolayer BT cells at an MOI of 0.1. Incubate in a 37 °C, 5% CO 2 cell incubator for 1 h, then supplement with high-glucose DMEM culture medium and place in a 37 °C, 5% CO 2 cell incubator for 6 h.

[0069] Referring to the instruction manual of the ThermoFisher Scientifi Lipo 3000 liposome transfection kit, add 125 μL of Opti-MEM culture medium, 2 μg of pUC57-127L-EGFP into a 1.5 mL sterile EP tube

[0070] -127R transfer vector plasmid and 4 μL of P3000 reagent were pipetted and mixed well. Then, another sterile EP tube was taken, 125 μL of Opti-MEM culture medium was added, and then 4 μL of Lipo3000 was added. The mixture was gently pipetted and mixed well, incubated at room temperature for 5 min, and then the two incubated liquids were mixed and gently pipetted and mixed well, and incubated at room temperature for 20 min. After that, all 250 μL of the mixed solution was added to one well of the above-mentioned 6-well plate inoculated with the virus. It was left standing in an incubator at 37 °C for 6 h, and the medium containing 10% serum was supplemented; at 24 h, 48 h, and 72 h after transfection, fluorescence was observed using an inverted fluorescence microscope. The strong fluorescence area was marked on the back of the 6-well plate with a marker pen, and the culture solution in the 6-well plate was discarded. 2 μL of trypsin digestion solution was added to each marked area to digest the cells in the marked area. After all the cells in the marked area were digested, 2 μL of DMEM culture medium was added to the marked digestion area, and the digested cells in this area were collected together with the liquid and placed in 50 μL of serum-free DMEM culture medium, and stored at -80 °C for later use.

[0071] 1.3.2 Green fluorescence plaque screening

[0072] Previously, 6-well plates were seeded with BT cells. When the cell density reached about 80%, the cell culture medium was discarded, and the 6-well plates were washed 2 - 3 times with PBS. A small amount of serum-free medium was added to each well of the 6-well plates. The virus with green fluorescence harvested in 1.2.2.1 was serially diluted 10-fold and inoculated into the 6-well plates. One well was not inoculated with the virus as a control. After the 6-well plates were taken out after standing in an incubator at 37 °C with 5% CO₂ for 1 h, the cell culture medium containing 2% FBS was supplemented. It was then put back into an incubator at 37 °C with 5% CO₂, and fluorescence was observed every 12 h. 24 h after the appearance of fluorescent cells (to allow the fluorescent cells to grow and aggregate), the liquid medium was discarded. 1.5% agarose and 4% FBS 2×DMEM were mixed at a ratio of 1:1 and added to the 6-well plates, 2 mL was added to each well. After the agarose solidified, it was placed in an incubator at 37 °C. After 72 h, the green fluorescence aggregation area was retrieved under a fluorescence microscope and collected and stored at -80 °C. Such screening was repeated, and the two deleted viruses were recorded separately.

[0073] 1.3.3 Fluorescent single-cell screening

[0074] Previously, 96-well plates were seeded with BT cells. When the cell density reached about 80%, the original cell culture medium was discarded, and the 96-well plates were washed 3 times with PBS. 100 μL of serum-free DMEM was added to the control wells. The fluorescent plaque venom collected in 1.2.2.2 was serially diluted 10-fold, at 10 -1 、10 -2 、10 -3Add 50 μL of the virus inoculum to each well of a 96-well plate at three different dilutions. Incubate the plate in a 37 °C, 5% CO₂ incubator for 1 h. Then, remove the 6-well plate, and add 50 μL of cell culture medium containing 2% FBS to each well. Place the plate back into the 37 °C, 5% CO₂ incubator. Observe for fluorescence every 12 h, and mark the wells with relatively concentrated fluorescence. After 72 h of virus inoculation, select the well with the highest dilution and the highest coincidence of cell cytopathic effect (CPE) and green fluorescence. Aspirate the culture medium, add 100 μL of trypsin to each well, and observe cell digestion under a fluorescence microscope. Stop digestion when the cells become round. Add 100 μL of DMEM and gently pipette to disperse all the digested cells into single cells as much as possible. Transfer the digested single cells into a 35-mm petri dish. Under a fluorescence microscope, use a pipette to pick the fluorescent cells, and transfer the selected fluorescent single cells into an EP tube containing 100 μL of DMEM culture medium. Freeze-thaw the cells three times and store them at -80 °C. Repeat the screening process and record the two gene-deleted viruses separately. 1.3.4 Amplification and passage of gene-deleted viruses without culturing

[0075] Inoculate the fluorescent single-cell viruses selected in 1.2.2.3 into the cultured BT cells in a 96-well plate, and perform passage culture. Observe whether the green fluorescence intensifies with the increase in the number of passages, and whether the green fluorescence aggregation area coincides with the cell CPE. If the green fluorescence of BT cells does not coincide with the CPE, it indicates that the single-cell viruses selected in 1.2.2.3 are not pure enough. Repeat the screening process in 1.2.2.3. Finally, select the single-cell green fluorescent virus whose green fluorescence intensifies with the increase in passages on BT, and the area where the green fluorescence appears coincides with the ORFV-induced BT cell CPE. Collect such culture wells and expand the culture to a 24-well plate. Similar to the 96-well plate, observe whether the green fluorescence coincides with the CPE. Collect the coincident wells and expand the culture to a 12-well plate, a 6-well plate, and a T75 cell flask. Store the viruses at each passage of screening and expansion at -80 °C for future use. Record the two gene-deleted viruses separately.

[0076] 1.4 Identification of gene-deleted recombinant viruses

[0077] Based on the gene sequence of the pUC57-127L-EGFP-127R recombinant plasmid, design upstream and downstream primers located before and after the EGFP green fluorescence gene, respectively. The primer sequences are shown in Table 2.

[0078] Table 2 Primer sequences

[0079]

[0080] The DNA was extracted from the ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus and its parental virus ORFV-HB-TS09, and from the ORFV-CFF15ΔvIL-10 gene-deleted virus strain and its parental virus ORFV-CFF15 using the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver.5.0, and used as templates for PCR reactions respectively. The ORFV-HB-TS09ΔvIL-10 and ORFV-CFF15ΔvIL-10 gene-deleted virus strains were identified.

[0081] 1.5 Results

[0082] 1.5.1 Transfection results of the recombinant plasmid pUC57-127L-EGFP-127R

[0083] The recombinant plasmid pUC57-127L-EGFP-127R was transfected into BT cells inoculated with the ORFV-HB-TS09F65 strain of vaccine virus and the ORFV-CFF15 virulent strain. After 48 h of culture, green fluorescence could be observed under an inverted fluorescence microscope. The green fluorescence in BT cells gradually increased at 72 h, and at the same time, ORFV-induced cytopathic effect (CPE) such as Figure 2 shown could be observed in the fluorescent BT cells. However, the number of BT cells with green fluorescence and lesions was small, indicating that most of the lesioned BT cells were caused by infection with the vaccine parental virus ORFV-HB-TS09F65 strain of vaccine virus and the ORFV-CFF15 virulent strain. The virus-infected transfected cells were blindly harvested, frozen and thawed 3 times, and stored at -80 °C for later use.

[0084] 1.5.2 Screening and purification of the ORFV-HB-TS09F65ΔvIL-10 recombinant virus

[0085] 1.5.2.1 Fluorescent plaque screening results

[0086] The virus obtained after transfection of 1.5.1 was serially diluted 10-fold and inoculated into 6-well plate BT cells for fluorescence plaque screening. Green fluorescence generally appeared in the virus-infected cells of the ORFV-HB-TS09F65ΔvIL-10 group and the ORFV-CF15ΔvIL-10 group about 24 hours after inoculation. At 72 h, the 6-well plate was placed under a fluorescence microscope, and plaques were picked when the green fluorescence was relatively concentrated and the area where the green fluorescence emitted could completely cover the cell CEP area. Compared with the ORFV-CF15ΔvIL-10 group, the deletion virus fluorescence plaques in the ORFV-HB-TS09F65ΔvIL-10 group appeared slightly earlier and the plaques were larger than those in the ORFV-CFF15ΔvIL-10 group. A total of three rounds of screening were performed. The fluorescent monoclonal plaque viruses selected in each round were passaged five generations before the next round of screening. As the number of screening times increased, the green fluorescent plaques that could be screened became stronger and stronger, and the strong fluorescence area basically coincided with the CPE of the cells, as Figure 3 , 4 shown.

[0087] 1.5.2.2 Screening results of fluorescent single-cell recombinant viruses

[0088] The single-cell fluorescence screening was also carried out for 3 rounds. The fluorescent single cells selected in each round were passaged 5 generations. Under an inverted fluorescence microscope, it was shown that the diseased cells in the white light field almost completely coincided with the luminescent area in the green fluorescence field ( Figure 5 , 6). It was preliminarily proved that the screened gene-deleted virus had reached a certain purity. Compared with the ORFV-CFF15ΔvIL-10 deleted virus group, the single-cell fluorescence of the ORFV-HB-TS09F65ΔvIL-10 deleted virus also appeared earlier than that of the ORFV-CFF15ΔvIL-10 deleted virus.

[0089] 1.5.2.3 Amplification culture and passage of gene-deleted recombinant viruses

[0090] The single-cell fluorescence gene-deleted monoclonal recombinant viruses ORFV-HB-TS09F65ΔvIL-10 strain and ORFV-CFF15ΔvIL-10 strain screened in 1.5.2.2 were first passaged in 96-well plates, and monoclonal recombinant viruses with gradually enhanced fluorescence during passage and the fluorescence emission site completely coinciding with the CPE of the virus-infected cells were selected for passage ( Figure 7 : A, B, C; Figure 8 : A, B, C). The monoclonal recombinant viruses passaged in the 96-well plates were collected and freeze-thawed 3 times, and then inoculated into 24-well plates for passage. The fluorescence generation site completely coincided with the CPE of the cells, and fluorescence was generated in all cell areas with CPE ( Figure 7 : D, E, F; Figure 8: D, E, F), and passaged 5 times in total. The pure monoclonal gene-deleted recombinant virus passaged in the 24-well plate was continuously passaged and expanded in culture to the 12-well plate ( Figure 7 : G, H, I; Figure 8 : G, H, I); after the monoclonal gene-deleted recombinant was passaged 5 times in the 24-well plate, the cytotoxin with enhanced fluorescence with passage and completely coinciding with cell CPE was still selected and expanded in culture to the 6-well plate ( Figure 7 : J, K, L; Figure 8 : J, K, L), and finally expanded in culture to the T75 cell flask ( Figure 7 : M, N, O; Figure 7 : M, N, O). Then expand the culture step by step as needed. The gene-deleted recombinant viruses obtained by expansion culture: ORFV-HB-TS09F65ΔvIL-10 strain and ORFV-CFF15ΔvIL-10 strain. From the observation during the passage process, the fluorescence intensity of the recombinant virus gradually increased with the increase of the primary passage times, and completely coincided with the CPE produced by the cells (such as Figure 7 , 8). Thus, it can be seen that the ORFV-HB-TS09F65ΔvIL-10 gene-deleted strain and ORFV-CF15ΔvIL-10 gene-deleted strain constructed and screened are relatively pure.

[0091] 1.6 Identification of ORFV-HB-TS09ΔvIL-10 and ORFV-CFF15ΔvIL-10 gene-deleted viruses

[0092] Using the primers designed at both ends of the EGFP gene in 1.4 to perform PCR identification on the genomic DNA of the ORFV-HB-TS09ΔvIL-10 and ORFV-CFF15ΔvIL-10 deleted virus strains. As Figure 9 shown, the deleted virus strain can amplify a band of 835 bp, and the parental virus can amplify a band of 669 bp, which is consistent with the expected band size. After recovering and purifying this band by gel, it was sent to the company for sequencing. The sequencing results found that the deleted virus amplified the complete EGFP gene (724 bp), and the parental virus amplified the complete vIL-10 (ORF127). Thus, it was proved that the gene-deleted virus successfully deleted the vIL-10 (ORF127) gene and the reporter gene EGFP had been completely inserted. This result is consistent with the green fluorescence observed during the screening process of the deleted virus.

[0093] Example 2 Biological characteristics, safety and immune evaluation of ORFV-HB-TS09F65ΔvIL-10 gene-deleted strain

[0094] 2.1 Proliferation characteristics of ORFV-HB-TS09F65ΔvIL-10 gene-deleted strain

[0095] Cell preparation: Culture BT cells in 60-mm cell culture dishes 1 day in advance. When the cell confluence reaches 80%, they can be used for virus inoculation; culture no less than 20 cell culture dishes to ensure sufficient sampling for TCID50 and virus growth curve determination.

[0096] Virus inoculation: Inoculate the ORFV-HB-TS09F65ΔvIL-10 deletion virus, ORFV-HB-TS09 parental strain, ORFV-CFF15ΔvIL-10 deletion virus, and ORFV-CFF15 virulent parental strain into well-grown BT cells at an inoculation dose of MOI = 0.1. The ORFV-HB-TS09F65ΔvIL-10 deletion virus, ORFV-HB-TS09 parental strain, ORFV-CFF15ΔvIL-10 deletion virus, and ORFV-CFF15 virulent parental strain were each inoculated into 12 cell culture dishes. After incubation in a cell culture incubator at 37°C and 5% CO2 for 1 h, then supplement with DMEM cell culture medium containing 2% FBS and culture in an incubator at 37°C and 5% CO2.

[0097] Virus harvest: After inoculation and culturing of the ORFV-HB-TS09F65ΔvIL-10 deletion virus and its parental virus ORFV-HB-TS09F65, and the ORFV-CFF15ΔvIL-10 deletion virus and its parental virus ORFV-CFF15, start timing. Randomly sample (one culture dish) and harvest the virus at 6 h, 12 h, 24 h, 36 h, 48 h, 60 h, 72 h, 84 h, and 96 h respectively, and make good records. Freeze-thaw the collected virus solution three times in an -80°C refrigerator for standby. In addition, randomly select 3 culture dishes each inoculated with the ORFV-HB-TS09F65ΔvIL-10 deletion virus and its parental virus ORFV-HB-TS09F65, and the ORFV-CFF15ΔvIL-10 deletion virus and its parental virus ORFV-CFF15. Observe the cultured virus 48 h after inoculation. After more than 80% of the cells show cytopathic effect (CPE), harvest the virus and freeze-thaw it three times in an -80°C refrigerator for later virus TCID 50 Determination

[0098] TCID50 determination of virus titer and drawing of virus growth curve: After the virus collected in the previous step is freeze-thawed three times, determine the TCID of the virus collected at each time point 50 . When drawing the virus growth curve, compare the replication levels of the ORFV-HB-TS09F65ΔvIL-10 deletion virus and its parental virus ORFV-HB-TS09F65, and the ORFV-CFF15ΔvIL-10 deletion virus and its parental virus ORFV-CFF15 in BT cells. Determine the TCID of the cell virus with more than 80% of the collected cells showing cytopathic effect (CPE) 50, compare their value-added characteristics.

[0099] 2.2 Genetic stability of ORFV-HB-TS09F65Δ127 gene deletion strain

[0100] The purified and screened ORFV-HB-TS09F65ΔvIL-10 gene deletion virus and ORFV-CFF15ΔvIL-10 deletion virus were serially passaged 15 times on BT cells. The reporter gene EGFP was measured by PCR to detect the genetic stability of the ORFV-HB-TS09F65ΔvIL-10 gene deletion virus during virus passage (primers are shown in Table 3).

[0101] Table 3 EGFP PCR primers

[0102]

[0103] 2.3 Safety evaluation of ORFV-HB-TS09F65ΔvIL-10 gene deletion strain

[0104] 2.3.1 Mice

[0105] Select 154 healthy three-week-old male BALB / c mice, randomly divided into 6 groups, of which 4 groups with 28 mice in each group are experimental groups, and 2 groups with 7 mice in each group are control groups; the purified and expanded ORFV-HB-TS09F65ΔvIL-10 deletion virus and its parental virus ORFV-HB-TS09F65 and ORFV-CFF15ΔvIL-10 deletion virus and its parental virus ORFV-CFF15 were measured for their TCID 50 value (require TCID50≥10 -5.50 ), and according to the measured TCID 50 , convert it to PFU value (plaque-forming unit). The 4 experimental groups were inoculated by intraperitoneal injection, inoculating ORFV-HB-TS09F65ΔvIL-10 deletion virus and its parental virus ORFV-HB-TS09F65 and ORFV-CFF15ΔvIL-10 deletion virus and its parental virus ORFV-CFF15 respectively; each group was inoculated with 10 3 , 10 4 , 10 5 , 10 6 , 10 7 PFU inoculation doses, inoculating 5 dose groups, with 7 mice in each dose group (see Tables 4 and 5). There are 7 control mice, and each mouse was intraperitoneally injected with 0.5 ml of DMEM (see Table 4). For the experimental groups, each group and each dose group were marked, and the incidence, death and recovery of orchitis in male mice were observed and recorded daily.

[0106] Table 4 Safety test of ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus in mice

[0107]

[0108] Table 5 Safety test of ORFV-CFF15ΔvIL-10 gene-deleted virus in mice

[0109]

[0110] 2.3.2 Newborn mice

[0111] Select 126 healthy BALB / c newborn mice with their mothers at 2-3 days old, randomly divide them into 6 groups, 4 experimental groups with 28 mice in each group and 2 control groups with 7 mice in each group. Inject the 4 experimental groups intracranially, and inoculate them with ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus and its parental virus ORFV-HB-TS09F65, and ORFV-CFF15ΔvIL-10 gene-deleted virus and its parental virus ORFV-CFF15 respectively; each group is inoculated with 4 dose groups of 10 3 、10 4 、10 5 、10 6 PFU, and 7 newborn mice are inoculated in each dose group (see Tables 6 and 7). There are 7 mice in the control group, and each is injected intracranially with 0.02 ml of DMEM (see Tables 6 and 7). Those that die within 24 hours after inoculation are treated as inoculation-induced death and are replenished according to the group. Observe daily and record the morbidity and death conditions after 24 hours.

[0112] Table 6 Safety test of ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus in newborn mice

[0113]

[0114]

[0115] Table 7 Safety test of ORFV-CFF15ΔvIL-10 gene-deleted virus in newborn mice

[0116]

[0117] 2.3 Evaluation of immune effect of ORFV-HB-TS09F65ΔvIL-10 gene-deleted strain in immunized rabbits

[0118] Thirty-three healthy New Zealand rabbits aged 5-6 months were selected and randomly divided into 5 groups. Four groups were used as immunization test groups, with 7 rabbits in each group, and were inoculated with ORFV-HB-TS09F65△vIL-10 deletion virus and its parent virus ORFV-HB-TS09F65 and ORFV-CFF15△vIL-10 deletion virus and its parent virus ORFV-CFF15, respectively; one group was used as the control group with 5 rabbits; the test groups were inoculated with the corresponding group of viruses, and the immunization was carried out by lip streaking inoculation and medial thigh intradermal inoculation, with an immunization dose of 10 5 TCID 50 / rabbit, and boost immunization with the same dose 2 weeks after immunization. The control group was inoculated with 0.2 ml of normal saline per rabbit using the same inoculation method (inner lip streak inoculation and inner thigh streak inoculation). Daily observation and recording of clinical symptoms of the experimental rabbits were performed, blood was collected once a week, serum was separated, and changes in antibody levels of the immunized rabbits were tracked.

[0119] 2.4 Results

[0120] 2.4.1 TCID of ORFV-HBTS09F65ΔvIL-10, ORFV-CFF15ΔvIL-10 gene-deficient viruses and their parental viruses 50 Determination

[0121] The TCID of parental virulent ORFV-HB-TS09F65 strain was determined using the Reed-Muench method 50 For 10 -5.91 / 0.1 mL; ORFV-CFF15 strain TCID 50 For 10 -6.10 / 0.1 mL. TCID of gene-deleted recombinant virus ORFV-HBTS09F65ΔvIL-10 50 For 10 -5.12 / 0.1 mL; ORFV-CFF15ΔvIL-10 is 10 -5.42 / 0.1 mL. Compared with the parental virus, the virus titer of ORFV-HBTS09F65△vIL-10 gene deletion virus decreased slightly, indicating that after the ORF127 gene was deleted, the virus's ability to proliferate in BT cells decreased slightly. However, the degree of decrease in virus titer does not affect the requirements for the preparation of attenuated vaccines.

[0122] 2.4.2 Virus growth curve

[0123] The virus infection time is taken as the horizontal axis, and the TCID of virus samples collected at different time points is measured. 50The one-step growth curves of the ORFV-HB-TS09F65ΔvIL-10 and ORFV-CFF15ΔvIL-10 gene-deleted recombinant strains and the parental strains ORFV-HB-TS09F65 and ORFV-CFF15 of ORFV were plotted with the numerical value as the vertical axis ( Figure 10 ). It can be seen from the growth curves that the growth and proliferation of the ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus are basically similar to those of its parental virus, but the virus titer of the ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus is lower than that of the parental virus at each time point. This proves that the replication ability of the ORFV virus decreases after deleting the virulence gene vIL-10 (ORF127), but the decrease is small. If other indicators such as the safety and immunogenicity of the deleted strain meet the vaccine R & D standards, this strain is expected to become a candidate vaccine for the gene-deleted vaccine against contagious ecthyma in sheep. 2.4.3 Determination of virus genetic stability

[0124] The gene-deleted viruses ORFV-HB-TS09F65ΔvIL-10 and ORFV-CFF15ΔvIL-10 were continuously passaged on BT cells. Viral fluids of the F5, F10, and F15 generations were taken respectively, and their DNA was extracted as a template. PCR amplification was performed using the primers in Table 3, and bands of the expected size could be amplified, and the sequencing results were correct ( Figure 11 , 12). This proves that the genetic traits of the ORFV-HB-TS09F65ΔvIL-10 and ORFV-CFF15ΔvIL-10 gene-deleted viruses are stable.

[0125] 2.4.4 Safety evaluation of the gene-deleted strains

[0126] 2.4.4.1 Death status and clinical symptoms of BALB / c male mice:

[0127] In the safety test group of male mice, 10 7 PFU doses of the ORFV-HB-TS09F65ΔvIL-10 deleted virus and its parental virus ORFV-HB-TS09F65, and the ORFV-CFF15ΔvIL-10 deleted virus and its parental virus ORFV-CFF15 were inoculated into BALB / c male mice. All the mice showed orchitis around 7 days after inoculation and all died at 14 days. 10 6From the PFU dose group, the number of male mice with orchitis in each group inoculated with the ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus was less than that of its parental virus; at the same time, compared with the two gene-deleted viruses ORFV-HB-TS09F65ΔvIL-10 and ORFV-CFF15△vIL-10, the pathogenicity rate of the ORFV-HB-TS09F65ΔvIL-10 gene-deleted strain in male mice was lower than that of the ORFV-CFF15ΔvIL-10 gene-deleted strain. Statistical data was used to calculate the ID of the ORFV-HB-TS09F65ΔvIL-10 gene-deleted virus and its parental virus ORFV-HB-TS09F65 virus in BALB / c male mice 50 The ID of the ORFV-HB-TS09ΔvIL-10 gene-deleted virus was 10 4.800 PFU, and that of the parental virus was 10 4.649 PFU; The ID of the ORFV-CFF15△vIL-10 gene-deleted virus and its parental virus ORFV-CFF15 virus in BALB / c male mice 50 The ID of the ORFV-CFF15ΔvIL-10 gene-deleted virus was 10 4.080 PFU, and that of the parental virus was 10 3.150 PFU. This proves that when comparing the ORFV-HB-TS09F65ΔvIL-10 strain gene-deleted virus with the ORFV-CFF15 strain clinically virulent virus and its ORFV-CFF15ΔvIL-10 gene-deleted virus in male mouse experiments, it can be seen that the virulence of the ORFV-HB-TS09ΔvIL-10 strain gene-deleted virus is significantly weakened and the safety is significantly improved after deleting the vIL-10 gene; compared with the traditional attenuated weak virus strain as the parental virus of the ORFV-HB-TS09F65ΔvIL-10 vaccine strain gene-deleted virus, its virulence is further reduced and the safety is further improved.

[0128] 2.4.4.2 Results of safety test in suckling mice

[0129] In the safety test group of suckling mice, 10 6The suckling mice inoculated with the PFU dose of ORFV-HB-TS09F65ΔvIL-10 deletion virus and its parental virus ORFV-HB-TS09F65, and the suckling mice inoculated with ORFV-CFF15ΔvIL-10 deletion virus and its parental virus ORFV-CFF15 all died within 7 days after inoculation; the number of sick and dead suckling mice in each dose group of the gene deletion virus in the remaining experimental groups was less than that in the parental virus group. At the same time, compared with the two gene deletion viruses ORFV-HB-TS09F65ΔvIL-10 and ORFV-CFF15ΔvIL-10, the pathogenic rate of the ORFV-HB-TS09F65ΔvIL-10 gene deletion strain in suckling mice was lower than that of the ORFV-CFF15ΔvIL-10 gene deletion virus. Statistical data were used to calculate the LD 50 of the ORFV-HB-TS09F65ΔvIL-10 gene deletion virus and its parental virus ORFV-HB-TS09F65 virus in suckling mice. The gene deletion virus was 10 4.857 PFU, and the parental virus was 10 4.36 PFU; the LD 50 of the ORFV-CFF15ΔvIL-10 gene deletion virus and its parental virus ORFV-CFF15 virus in suckling mice. The gene deletion virus was 10 3.957 PFU, and the parental virus was 10 3.020 PFU. This proves that, by comparing the ORFV-HB-TS09F65ΔvIL-10 gene deletion virus with the ORFV-CFF15 clinical virulent strain and its ORFV-CFF15ΔvIL-10 gene deletion virus in suckling mice experiments, it can be seen that the virulence of the ORFV-HB-TS09ΔvIL-10 gene deletion virus is significantly weakened and the safety is significantly improved after deleting the vIL-10 gene; compared with the ORFV-HB-TS09F65ΔvIL-10 gene deletion virus and its traditional attenuated virulent strain as the parental virus, its virulence is further reduced and the safety is further improved.

[0130] Proved by the two groups of animal experiments in 2.4.4.1 and 2.4.4.2, compared with the ORFV-CFF15ΔvIL-10 gene deletion virus with the same gene deletion obtained from the clinical virulent strain as the parental virus, the ORFV-HB-TS09F65ΔvIL-10 gene deletion virus obtained from the traditional attenuated ORFV-HB-TS09F65 strain vaccine virus as the parental virus has a more significant attenuation effect and better safety. In addition, a reporter gene EGFP was introduced into the vIL-10 deletion region of this deletion strain, which can be visualized during virus screening and purification. At the same time, during the vaccine immunization process, the specific marker in this region can be used as an effective target to distinguish vaccine immunization from wild virus infection. Therefore, the ORFV-HB-TS09F65ΔvIL-10 gene deletion virus can be used as a vaccine candidate strain.

[0131] Evaluation of the Immunization Effect of the 2.4.5 Gene-Deleted Strain

[0132] The antibody levels of the immunized rabbits were detected by the indirect ELISA method for orf virus antibodies established in the laboratory. The results Figure 13 showed that antibodies could be detected in the immunized group 7 days after immunization. The antibody levels increased rapidly after the booster immunization on day 14 and reached a peak within 21 to 30 days. The antibody levels began to decline after 60 days. Compared with the ORFV-HB-TS09F65ΔvIL-10 strain-deleted virus and its parental virus ORFV-HB-TS09F65 strain, and the ORFV-CFF15V strain-deleted virus and its parental virus ORFV-CFF15 strain, the changes in antibody levels were basically the same. This proved that the ORFV-HB-TS09ΔvIL-10 strain-deleted virus still maintained its good immunogenicity after the deletion of the vIL-10 gene.

[0133] In summary, in the present invention, the vIL-10 virulence gene of the orf virus OrfVirus HB-TS09F65 strain was deleted by the method of genetic engineering homologous recombination, and a live attenuated orf vaccine strain ORFV-HB-TS09F65ΔvIL-10 was obtained; compared with the clinical virulent strain and the deleted virus with the vIL-10 virulence gene deleted, its virulence was significantly weakened and its safety was significantly improved; compared with the vaccine parental strain attenuated by artificial passage, its virulence was weaker and its safety was further improved; at the same time, compared with the virulent strain and the vaccine parental strain, the ORFV-HB-TS09F65ΔvIL-10 vaccine-deleted strain still maintained good immunogenicity. A reporter gene EGFP was introduced into the vIL-10 deletion region of the deleted virus, which could be visualized during the virus screening and purification process. At the same time, during the vaccine immunization process, the specific marker in this region could be used as an effective target to distinguish vaccine immunization from wild virus infection. Therefore, this gene-deleted strain was suitable as a candidate orf vaccine strain.

Claims

1. The use of preparing an attenuated oropharyngeal canker sore virus strain by inhibiting the expression of vIL-10 gene, deleting or conditionally knocking out the vIL-10 gene in oropharyngeal canker sore virus, characterized in that: The vIL-10 gene sequence is shown in SEQ ID NO.1, and the sheep oral sore virus is the sheep infectious pustular virus cell-passaged attenuated OrfVirus HB-TS09F65 strain, which was deposited in the China Center for Type Culture Collection on March 19, 2014, with a deposit number of CCTCC NO.V201406.

2. The use of a method for preparing an attenuated oropharyngeal canker sore vaccine by inhibiting the expression of vIL-10 gene, deleting or conditionally knocking out the vIL-10 gene in oropharyngeal canker sore virus, characterized in that: The vIL-10 gene sequence is shown in SEQ ID NO.1, and the sheep oral sore virus is the sheep infectious pustular virus cell-passaged attenuated OrfVirus HB-TS09F65 strain, which was deposited in the China Center for Type Culture Collection on March 19, 2014, with a deposit number of CCTCC NO.V201406.

3. An attenuated sheep sore virus strain, characterized in that The attenuated orf virus strain includes an orf virus strain with vIL-10 gene expression inhibition, deletion or conditional knockout. The orf virus is an OrfVirus HB-TS09F65 strain attenuated by cell passage of ovine infectious pustular virus, which was deposited in the China Center for Type Culture Collection on March 19, 2014, with a deposit number of CCTCC NO.V201406.

4. The attenuated aphthous stomatitis virus strain according to claim 3, characterized in that The attenuated aphthous tussock virus strain is a vIL-10 gene conditionally knocked-out aphthous tussock virus strain, and the aphthous tussock virus is an attenuated Orf Virus HB-TS09F65 strain of sheep infectious pustular virus cell passage, which was deposited in the China Center for Type Culture Collection on March 19, 2014, with a deposit number of CCTCC NO.V201406.

5. A method for preparing the attenuated aphthous stomatitis virus strain according to claim 3, characterized in that: The method is to conditionally knock out the vIL-10 of the attenuated OrfVirus HB-TS09F65 strain caused by cell passage of sheep infectious pustular virus by genetic engineering means. The vIL-10 gene sequence is shown in SEQ ID NO.

1. The attenuated OrfVirus HB-TS09F65 strain caused by cell passage of sheep infectious pustular virus was deposited in the China Center for Type Culture Collection on March 19, 2014, and the deposit number is CCTCC NO.V201406.

6. The preparation method according to claim 5, characterized in that: The method comprises the following steps: (1) designing and synthesizing a gene deletion transfer vector plasmid with the reporter gene being EGFP: pUC57-127L-EGFP-127R; (2) The designed transfer vector plasmid: pUC57-127L-EGFP-127R was transfected into BT cells inoculated with ORFV HB-TS09F65 virus by lipofectamine transfection method; (3) Through fluorescent plaque combined with fluorescent single cell screening, a monoclonal gene-deficient virus with a green fluorescent reporter gene was screened. After multiple rounds of screening and PCR identification, a recombinant virus strain lacking the vIL-10 gene was obtained: ORFV-HB-TS09F65△vIL-10.

7. Use of the attenuated aphthous stomatitis virus strain according to claim 3 or 4 in the preparation of an attenuated aphthous stomatitis virus vaccine.

8. An attenuated vaccine for oropharyngeal canker sore virus, characterized in that: The attenuated oropharyngeal sore virus vaccine comprises the attenuated oropharyngeal sore virus strain according to claim 3 or 4.

Images