DsRNA for preventing and controlling pest mites and application thereof

Abstract

The invention discloses dsRNA for preventing and controlling pest mites and application of the dsRNA, and belongs to the technical field of agricultural biology. According to a specific fusion gene segment obtained by comparative analysis of a plurality of pest mite FTZ-F1 genes, and by evaluating the application potential of the gene in pest mite prevention and control, the result shows that tetranychus urticae and tetranychus ilosi can die due to ecdysis failure by injecting artificially synthesized FTZ-F1 gene fusion dsRNA into the tetranychus, and the tetranychus urticae and tetranychus ilosi can die due to ecdysis failure of the artificially synthesized FTZ-F1 gene fusion dsRNA. An artificially synthesized FTZ-F1 gene fusion dsRNA is fed, off-target risk assessment is performed on the neoseiulus californicus which is the natural enemy of the spider mites, and the neoseiulus californicus is found to be capable of normally molting to enter an adult stage without influencing the survival of the natural enemy of the spider mites. The method can efficiently and accurately prevent and control pest mites, is high in pest killing efficiency and has a good application prospect.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biotechnology, and in particular to a dsRNA for preventing and controlling harmful mites and an application thereof. Background Art

[0002] Spider mites are a major economic pest worldwide. Adults, nymphs, and juveniles primarily gather on the undersides of plant leaves and suck, causing chlorotic spots on the leaves. In severe cases, leaves may become oily, dry, and fall off, or even die entirely. As extreme r-strategists, spider mites have a high reproductive capacity and can rapidly increase from low to high densities, making them explosive pests. Natural enemies often have little control before a major outbreak, so chemical control remains the primary approach. However, the sole use of chemical pesticides will make it difficult to overcome the problem of insecticide resistance in insecticide-resistant plants. This also leads to a series of negative impacts, such as a decrease in natural enemy populations and increased environmental pollution, significantly impacting food safety and ecological security, and severely restricting the sustainable development of modern agricultural production in my country. Given the increasing development of insecticide resistance in insecticide-resistant plants, the cost of control is increasing, and the pace of chemical agent development and synthesis is far behind the rate of elimination. Therefore, it is extremely important and urgent to utilize scientific and efficient research methods or technologies to identify and screen new control targets and provide new ideas for the development of new acaricides.

[0003] The overuse of traditional chemical pesticides has had a detrimental impact on the environment and human health. The discovery of RNA interference (RNAi) provides a new and sustainable development opportunity for pest (mite) management methods. Since its discovery, the RNA interference mechanism has been widely used in the fields of gene function, biomedicine, and crop pest and disease control. RNAi technology is also considered a very promising agricultural pest (mite) control technology. Using RNA interference technology to silence key genes that control the development or important behaviors of pests and diseases can hinder the normal growth, development, and reproduction of pests, and even directly cause the death of pests, thereby effectively controlling pest damage.

[0004] RNA interference (RNAi) essentially refers to mRNA degradation triggered by endogenous or exogenous double-stranded RNA (dsRNA), which specifically inhibits the transcription or translation of target genes, thereby inhibiting gene expression. This leads to loss of physiological functions related to the target gene, or even functional defects. It is a gene expression regulation mechanism. In the development of new pesticides, RNAi, due to its high efficiency and specificity, has become one of the most active areas in the screening and identification of new targets. Selecting appropriate RNAi target genes is crucial for the effective control of pests and diseases using RNAi technology. RNAi target genes must not only have a good interference effect but also a high safety profile. This strategy shifts from the broad-spectrum approach of traditional pesticides to a more specific approach. Molting, a physiological process unique to arthropods, ensures population growth and rapid adaptation to environmental changes. Ecdysteroids in spider mites play a crucial role in regulating their molting process. The recent development and application of insect growth regulators has provided new insights and insights for the control of pest mites. Because ecdysteroids are crucial for the survival and development of pest mites, they are viable molecular targets for their control. Finding new targets and developing spider mite growth regulators related to ecdysone are of great significance for solving the biological control of spider mites. Summary of the Invention

[0005] The purpose of the present invention is to provide a dsRNA for controlling pest mites and its application to solve the problems existing in the above-mentioned prior art. The dsRNA can inhibit the molting of pest mites and effectively reduce the population density of pest mites, but has no effect on the natural enemies of predatory mites. It has the potential to serve as a target for future RNA pesticide control.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a dsRNA for controlling pest mites, wherein the nucleotide sequence of the dsRNA is shown in SEQ ID NO.1:

[0008] GCCAAUGUACAAAAGAGAUCGAGCUCGACGAUUACAGUUGAUGAGGCAACGUCAAAUGGUGCGUGGCGGUUCACUUGGUGGUCAUUCGGGUAACCAUAGUCCUGGUGAAGUUGCAUCACUUGCCAUGGUAGCCUCCAACAGUAACGGUGGACUGGGAGGUGGUUCAAUUUACACACCGGACGGGAUCAAGCAAGAACUUAUUCAAAUUCCUCAGAAGUUGAUCUAUUUGAAUUGAUGUGCAAAGUUAUUGAUCAAUCACUUUUUGCUCAAGUCGAUUGGGCAAGGAAUAGUAUUUUCUUUAAAGAUCUAAAAGUGGACGUGAAACAACAUUACCCAAUGGGCAAAAGUUUGAUCUCUUAGGUUUAGCUUUGCUCGGUGUUCCAACCGCAUCUGAUAAUUUGAUUCAAUGUCAAGCAAAA。

[0009] The present invention also provides a DNA molecule encoding the dsRNA, and the nucleotide sequence of the DNA molecule is as shown in SEQ ID NO.2:

[0010] GCCAATGTACAAAAGAGATCGAGCTCGACGATTACAGTTGATGAGGCAACGTCAAATGGTGCGTGGCGGTTCACTTGGTGGTCATTCGGGTAACCATAGTCCTGGTGAAGTTGCATCACTTGCCATGGTAGCCTCCAACAGTAACGGTGGACTGGGAGGTGGTTCAATTTACACACCGGACGGGATCAAGCAAGAACTTATTCAAATTCCTCAGAAGTTGATCTATTTGAATTGATGTGCAAAGTTATTGATCAATCACTTTTTGCTCAAGTCGATTGGGCAAGGAATAGTATTTTCTTTAAAGATCTAAAAGTGGACGTGAAACAACATTACCCAATGGGCAAAAGTTTGATCTCTTAGGTTTAGCTTTGCTCGGTGTTCCAACCGCATCTGATAATTTGATTCAATGTCAAGCAAAA。

[0011] The present invention also provides the use of the dsRNA or the DNA molecule in any of the following:

[0012] (1) Application in the prevention and control of pest mites;

[0013] (2) Application in inhibiting molting of harmful mites;

[0014] (3) Application in reducing the survival rate of pest mites;

[0015] (4) Application in assessing the off-target risk of natural enemies of harmful mites.

[0016] Optionally, the dsRNA is fed to pest mites to control the pest mites, inhibit the molting of the pest mites, or reduce the survival rate of the pest mites; and / or the pest mites include spider mites.

[0017] The present invention also provides a method for controlling pest mites, comprising introducing the dsRNA into the pest mites to achieve the control of the pest mites.

[0018] The present invention also provides a method for inhibiting molting of pest mites, comprising introducing the dsRNA into the pest mites to inhibit molting of the pest mites.

[0019] The present invention also provides a method for reducing the survival rate of harmful mites, comprising introducing the dsRNA into harmful mites to reduce the survival rate of harmful mites.

[0020] Optionally, the harmful mites include spider mites. The introduction method may be feeding or injection.

[0021] The present invention also provides a product for preventing and controlling harmful mites, inhibiting harmful mites from molting, or reducing the survival rate of harmful mites, wherein the active ingredient of the product is the dsRNA.

[0022] Optionally, the harmful mite includes spider mites; and / or the product includes an inhibitor or a drug. Further, the drug may be a biopesticide, and further, may be an RNA insecticide, an RNA inhibitor, etc.

[0023] The present invention discloses the following technical effects:

[0024] The present invention provides a synthetic cDNA sequence of a dsRNA fragment fused to the FTZ-F1 gene of a mite pest. This fusion dsRNA can effectively reduce the population density of mite pests without affecting their natural enemies, predatory mites. More specifically, the present invention utilizes a method of injecting synthetic FTZ-F1 gene fusion dsRNA to cause molting failure and death in two-spotted spider mites and Tetranychus urticae. Furthermore, by feeding synthetic FTZ-F1 gene fusion dsRNA to the pest mite, a natural enemy, Neoseiulus californicus, an off-target risk assessment is performed, thereby achieving the goal of efficient and precise control of mite pests. This method has many advantages, including high insecticidal efficiency and being friendly to natural enemies and the environment. It lays a theoretical foundation for the development of new biopesticides and has promising application prospects for achieving efficient and green control of mite pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 The 419-bp DNA sequence of the artificially designed and synthesized specific FTZ-F1 gene fragment is shown in Figure 1. The italicized and underlined sequences are the primers used for amplification, namely the forward primer and the reverse primer, respectively. The arrows indicate the directions of the upstream and downstream primers.

[0027] Figure 2 Effects of injection of fusion dsFTZ-F1 and dsEGFP on the molting of Tetranychus urticae and Tetranychus usevansi; A: Molting rates of Tetranychus urticae and Tetranychus usevansi after injection of fusion dsFTZ-F1 and dsEGFP; B: Phenotypic observations of Tetranychus urticae after injection of fusion dsFTZ-F1 and dsEGFP; C: Phenotypic observations of Tetranychus usevansi after injection of fusion dsFTZ-F1 and dsEGFP;

[0028] Figure 3 The molting rate (A) and phenotype (B) of Neoseiulus californicus after injection of fusion dsFTZ-F1 and dsEGFP. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1

[0035] 1. Design and synthesis of fusion dsRNA

[0036] (1) The complete ORF of the candidate gene TuFTZ-F1 (ID: tetur08g06490, https: / / bioinformatics.psb.ugent.be / orcae / overview / Tetur) was cut into 100 base pair (bp) fragments to produce more 22 bp small interfering RNA (siRNA) within a limited length (usually about 300 bp).

[0037] (2) A customized script and MUSCLE software were used to calculate the number of conserved nucleotides between the 100 bp fragment and the homologous genes of the four pest mite species.

[0038] (3) Off-target effect analysis of predatory mites was performed by determining the total number of 16 bp perfect match sites, 21 bp perfect match sites, and 26 bp almost perfect match sites (allowing 1-2 mismatches) in a 100 bp fragment.

[0039] (4) The designed gene fragments were sent to Sangon Biotech (Shanghai) Co., Ltd. to prepare the template (plasmid) by chemical synthesis.

[0040] 2. In vitro transcription, synthesis and purification of fusion dsRNA

[0041] 2.1 dsRNA primer design and synthesis

[0042] Based on the artificially designed and synthesized specific FTZ-F1 gene sequence, dsRNA synthesis primers were designed using the Primedesigning tool on the NCBI online website (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ); based on the selected dsRNA primers, the primers shown in Table 1 below were synthesized by Bioengineering.

[0043] Table 1

[0044]

[0045] 2.2 PCR product recovery

[0046] Using the plasmid prepared by chemical synthesis as a template, a DNA fragment with a T7 promoter sequence was obtained by specific PCR amplification (see Figure 1 ), and reverse transcription was performed to synthesize cDNA using the StarScript II RT Mix with gDNA Remover kit from Genstar. The reaction system is shown in Table 2 below.

[0047] Table 2

[0048]

[0049] PCR reaction program: 95°C pre-denaturation for 2 min, 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 40 s, set 35 cycles, 72°C final extension for 5 min;

[0050] The amplified product was subjected to gel electrophoresis using an agarose gel concentration of 1%, a voltage of 130V, and an electrophoresis time of 25 minutes. The amplified product was then recovered using the SanPrep Column DNA Gel Recovery Kit (Shanghai) Co., Ltd. instructions. The specific steps are as follows:

[0051] (1) Gel cutting: Use a clean scalpel to cut out the gel block containing the target fragment from the agarose gel, discard the agarose gel without the target fragment as much as possible, place it in a 1.5 mL centrifuge tube, and weigh it;

[0052] (2) Sol: Add 0.3 mL of Buffer B2 per 0.1 g of agarose gel. Place the centrifuge tube in a 50°C water bath for 5-10 min, mixing occasionally until the gel is completely dissolved.

[0053] (3) Pipetting onto the column: pipette the sol solution onto the column several times until all the solution is transferred to the adsorption column. Centrifuge at 8000 × g for 30 seconds. Discard the liquid in the collection tube.

[0054] (4) Add 300 μL of Buffer B2 and centrifuge at 9000 × g for 30 seconds. Discard the liquid in the collection tube.

[0055] (5) Add 500 μL of Wash Solution and centrifuge at 9000 × g for 30 seconds. Discard the liquid in the collection tube.

[0056] (6) Repeat the previous experimental steps;

[0057] (7) Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 9000 × g for 1 min.

[0058] (8) Place the adsorption column in a clean 1.5 mL centrifuge tube, add 20 μL of Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 1 min, and then centrifuge at 9000 × g for 1 min;

[0059] (9) Take 1 μL of DNA solution for concentration detection and store the remaining DNA solution in the tube at -20°C.

[0060] 2.3 Synthesis and purification of fusion dsRNA

[0061] Using the PCR-purified product as a template, dsRNA was synthesized and purified according to the TranscriptAid T7 High Yield Transcription Kit instructions to obtain a fusion dsFTZ-F1 molecule targeting the FTZ-F1 gene of the mite pest. The reaction system is shown in Table 3 below.

[0062] Table 3

[0063]

[0064] (1) Incubate the mixed solution at 37°C for 5-8 h. After the reaction is complete, add 2 μL of DNase I and react at 37°C for 15 min. Then, add 2 μL of EDTA and react at 65°C for 10 min.

[0065] (2) After the reaction is completed, add 15 μL of 3M Sodium Acetate Solution and 115 μL of nuclease-free water to the reaction product, mix thoroughly, and transfer the mixed solution to a new nuclease-free centrifuge tube;

[0066] (3) Add 150 μL of a mixture of phenol and chloroform (phenol:chloroform = 1:1), then add 300 μL of chloroform, shake and mix, and centrifuge at 12,000 rpm and 4°C for 10 min;

[0067] (4) Pipette the supernatant into a new centrifuge tube without nuclease, add 350 μL of anhydrous ethanol, mix thoroughly, and let stand at -20°C for 2 h;

[0068] (5) The mixture was centrifuged at 12000 rpm and 4°C for 10 min. After removing the supernatant, 500 μL of pre-cooled 70% ethanol was added and the mixture was centrifuged at 7500 rpm and 4°C for 5 min.

[0069] (6) After removing the supernatant, air-dry for 5-10 min, add 20 μL of nuclease-free water and repeatedly pipette to dissolve the dsRNA;

[0070] (7) Take 1 μL of dsRNA for concentration detection and another 1 μL of dsRNA for gel electrophoresis to detect the integrity of the product.

[0071] 3. Efficiency evaluation of dsFTZ-F1 fusion

[0072] 3.1 Experimental study on the effect of fusion of dsFTZ-F1 on the molting of Tetranychus urticae and Tetranychus iridii

[0073] Exogenous dsRNA was injected into the test mites. A control group was injected with dsEGFP, with 30 nymphs injected per group. Four biological replicates were set up for each experimental and control group. The dsRNA concentration injected was 10 μg / μL. The specific steps are as follows:

[0074] (1) Pulling needle. Place the glass capillary on a PUL-1000 microprocessor-controlled capillary tip puller to pull out a short-scale tapered glass capillary. The instrument parameters are heating index 590, pulling force 250g, distance 1.50mm, and delay 100.

[0075] (2) Grinding the needle. Place the drawn glass capillary on a GRIND-1000 microelectrode grinding machine to grind off the tip of the glass capillary to complete the preparation of the glass capillary for injection;

[0076] (3) Make agarose gel strips. Prepare a 2% agarose solution and pour it onto a plate. Allow it to cool and solidify, then cut into strips for later use.

[0077] (4) Microinjection. Fix the test mite on a 2% agarose gel block, manually operate the air pump injection device, insert the glass capillary from the back of the test mite and inject the dsRNA into the test mite to complete the introduction of dsRNA;

[0078] The mites injected with dsRNA were placed on bean leaves for feeding. The leaves were placed in an artificial intelligence climate chamber (temperature 27±1°C, relative humidity 60%, photoperiod 14L:10D), and their molting rate and mortality were observed and counted every 12 hours.

[0079] 3.2 Experimental Results

[0080] like Figure 2 As shown, the results showed that after the injection of fused dsFTZ-F1 to silence FTZ-F1, both the two-spotted spider mite and the ivory spider mite could enter the molting period normally at the 36th hour, but the molting period was prolonged. The molting rate of the two-spotted spider mite in the experimental group after 72 hours was only 5.6%, and the molting rate of the ivory spider mite after 72 hours was 37.5%. The results of the phenotypic observation experiment showed that both mites were eventually trapped in the old epidermis and died; while in the control group, 94.4% of the two-spotted spider mite nymphs successfully molted to the adult stage, and all the ivory spider mite nymphs successfully molted to the adult stage.

[0081] 4. Safety evaluation of fusion dsFTZ-F1

[0082] 4.1 Effect of fusion of dsFTZ-F1 on molting of Neoseiulus californicus

[0083] (1) Feeding of fusion dsFTZ-F1

[0084] The droplet feeding method was used. The control group was fed dsEGFP, with 30 nymphs per group. Four biological replicates were set up for each experimental group and control group. The dsRNA concentration fed was 10 μg / μL.

[0085] The specific feeding method is as follows: newly molted Neoseiulus californicus queen nymphs are placed in a feeding chamber and starved for 24 hours. 10 μL of a prepared feed solution containing a target gene dsRNA solution, 20% sucrose solution, and 6% blue food coloring is then dispersed throughout the chamber. The sucrose solution and blue food coloring solution are boiled for 10 minutes to eliminate nuclease contamination.

[0086] The californica mites, whose intestines turned blue after feeding with dsRNA, were picked up and placed on bean leaves. The leaves were placed in an artificial intelligence climate chamber (temperature 27±1°C, relative humidity 60%, photoperiod 14L:10D). Sufficient two-spotted spider mite larvae were picked up and fed daily. The molting rate and mortality rate were observed and counted every 12 hours.

[0087] 4.2 Experimental Results

[0088] like Figure 3As shown in the figure, there was no significant difference between the control group fed with dsEGFP and the experimental group fed with fusion dsFTZ-F1, and all the nymphs of Neoseiulus californicus could molt normally and enter the adult stage.

[0089] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art shall fall within the scope of protection defined by the claims of the present invention.

Claims

1. A dsRNA for controlling harmful mites, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

1.

2. A DNA molecule encoding the dsRNA according to claim 1, characterized in that: The nucleotide sequence of the DNA molecule is shown as SEQ ID NO.

2.

3. Use of the dsRNA according to claim 1 or the DNA molecule according to claim 2 in any of the following: (1) Application in the control of pest mites; (2) Application in inhibiting the molting of harmful mites; (3) Application in reducing the survival rate of harmful mites; (4) Application in assessing off-target risks of natural enemies of harmful mites.

4. The use according to claim 3, characterized in that By feeding the dsRNA to the pest mites, the pest mites are controlled, the molting of the pest mites is inhibited or the survival rate of the pest mites is reduced; and / or the pest mites include spider mites.

5. A method for controlling harmful mites, characterized in that: The method comprises introducing the dsRNA of claim 1 into the pest mites to achieve control of the pest mites.

6. A method for inhibiting molting of harmful mites, characterized in that: The method comprises introducing the dsRNA of claim 1 into the pest mite to inhibit the molting of the pest mite.

7. A method for reducing the survival rate of harmful mites, characterized in that: The method comprises introducing the dsRNA of claim 1 into the pest mite to reduce the survival rate of the pest mite.

8. The method according to any one of claims 5 to 7, characterized in that: The harmful mites include spider mites.

9. A product for preventing and controlling pest mites or inhibiting the molting of pest mites or reducing the survival rate of pest mites, characterized in that: The active ingredient of the product is the dsRNA according to claim 1.

10. The product according to claim 9, characterized in that The harmful mites include spider mites; and / or the product includes an inhibitor or a drug.

Images