Preparation and application of biosensor capable of efficiently distributing electric control reducing power to improve electrosynthesis yield

Abstract

The invention discloses preparation and application of a biosensor capable of intelligently distributing electric control reducing power to improve electrosynthesis yield, and relates to the technical field of biological energy sources. The invention designs and constructs an electric control dynamic regulation system based on a biosensor so as to realize the conversion of isobutanol production between high potential (+ 0.5 V) start and low potential (-0.6 V) stop. The constructed recombinant shewanella bacterial strain RK capable of autonomously and dynamically controlling reduction equivalent to be timely and efficiently distributed to a metabolic pathway can effectively decouple cell growth and electrosynthesis stages and eliminate metabolic load caused by premature expression of an isobutanol pathway and premature supply of reducing power under the potential of + 0.5 V; and efficient supply of reduction equivalent of an isobutanol synthesis route under the potential of-0.6 V is realized, so that the yield of isobutanol is increased.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioenergy, and particularly relates to the preparation and application of a biosensor for efficiently allocating electro-controlled reducing power to improve the production of isobutanol. Background Art

[0002] Microbial electrosynthesis can utilize waste electrical energy for carbon and nitrogen fixation to achieve the production of high-value chemicals, thereby realizing green circular development. As a new generation of biofuel with high energy density, compared with traditional biofuel ethanol, isobutanol has advantages such as high energy density and low hygroscopicity as a gasoline substitute. With the development of metabolic engineering and synthetic biology, modifying microbial hosts by designing gene circuits and metabolic pathways to synthesize products required by humans has gradually replaced low-efficiency and highly polluting chemical production. The isobutanol synthesis pathway requires excessive reducing power, and microbial electrosynthesis can uptake electrons from the electrode and convert them into intracellular reducing power, thereby decoupling the supply of reducing power and the formation of carbon skeletons and increasing the final yield.

[0003] Shewanella oneidensis MR-1, as a model electrogenic microorganism, can utilize lactate as an electron donor to achieve extracellular electron transfer, and its electron transfer mechanism has been systematically studied and clarified, and is expected to be used in microbial electrosynthesis systems to achieve efficient synthesis of isobutanol. However, during the electrosynthesis process, insufficient supply of reducing power will lead to low yield of target products; on the other hand, premature and excessive supply of reducing power will lead to imbalance of intracellular cofactors, thereby causing growth and metabolic burdens and reducing the final yield. Therefore, the timely and appropriate supply of reducing power is an important factor for improving electrosynthesis. Biosensors can intelligently respond to effectors to dynamically regulate gene expression, and have been widely used in the regulation of metabolic pathways in metabolic engineering to increase the yield of target products. Summary of the Invention

[0004] 1. The object of the present invention is to:

[0005] Provide the preparation and application of a biosensor for efficiently allocating electro-controlled reducing power to improve the production of electrosynthesis. The biosensor contains the transcription factor gene rex and the promoter gene P IP , by replacing the LacI and the inducible promoter P tac coding fragments in pHG12-KAACD, the plasmid pHG12-Rex-KAACD is obtained, and it is combined and transferred into Shewanella oneidensis MR-1 to construct the RK strain. The biosensor provided by the present invention can dynamically control the timely and efficient allocation of reducing equivalents to the metabolic pathway, thereby effectively decoupling the cell growth and electrosynthesis stages to increase the production of the electrosynthesis product isobutanol.

[0006] 2. To achieve the above-mentioned invention object, the present invention is implemented by the following technical solutions:

[0007] (1) The present invention provides a biosensor, which contains a transcription factor, a promoter, and a fluorescent protein.

[0008] The transcription factor is Rex, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.1; the promoter is P IP , and its nucleotide sequence is shown in SEQ ID NO.2; the fluorescent protein is FBFP, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.3; the biosensor has the function of intelligently responding to intracellular reducing power and dynamically regulating its efficient distribution.

[0009] (2) The present invention also provides a preparation method of the biosensor, including the following steps:

[0010] Using the PCR method to amplify the sequences of the transcription factor encoding gene rex and the promoter P IP from the genome of Bacillus subtilis, purifying and recovering them, obtaining the rex-P IP fragment through overlap extension PCR, connecting it with the fluorescent protein FBFP gene to obtain the rex-P IP -fbfp gene circuit, connecting it to the vector pCM containing chloramphenicol resistance by seamless cloning to obtain the pCM-Rex-PIP-FBFP plasmid, transferring it into Escherichia coli and then conjugating and transferring it into the wild-type Shewanella oneidensis MR-1 to obtain the biosensor strain Rex.

[0011] (3) The present invention also provides a verification method of the biosensor, including the following steps:

[0012] By comparing the fluorescence intensities of cells grown under aerobic (low NADH / NAD + ratio) and anaerobic (high NADH / NAD + ratio) conditions, the efficacy of the biosensor is verified. Further, the strain Rex is observed for fluorescence by shake flask culture (aerobic) and anaerobic bottle culture respectively, and the fluorescence values under different conditions are measured. The results show that the NADH / NAD + ratio under aerobic conditions is 0.41 ± 0.01, and the fluorescence / OD 600 value is 2047.07 ± 172.03 au, while the NADH / NAD + ratio under anaerobic conditions is 3.14 ± 0.08, and the highest fluorescence / OD 600 value is 11694.20 ± 828.20 au, further proving that the biosensor responds to high NADH / NAD+ Proportional response.

[0013] (4) The present invention also provides the application of the biosensor in increasing the yield of electro-synthesized product isobutanol, including the following steps:

[0014] Amplify the rex-P IP fragment from the pCM-Rex-P IP -FBFP plasmid, purify and recover it; amplify, purify and recover the pHG12-ΔlacI-ΔP tac -KAACD linearized backbone from the vector pHG12-KAACD plasmid, and ligate the rex-P IP fragment to the pHG12-ΔlacI-ΔP tac -KAACD backbone by seamless cloning, transform the ligation product into competent E. coli WM3064 cells, screen positive clones on an LD solid plate containing kanamycin resistance, and obtain the engineered strain 3064 / pHG12-Rex-KAACD; transfer the engineered strain 3064 / pHG12-Rex-KAACD by conjugation into Shewanella oneidensis MR-1 to obtain the high-yield isobutanol biosensor strain RK. Transfer the plasmid pHG12-KAACD into Shewanella oneidensis MR-1 by the same method to obtain the control strain KA.

[0015] Incubate overnight at 30 °C and 200 rpm in an LB medium containing kanamycin resistance. Transfer 1 mL of the culture into a 250 mL shake flask containing 100 mL of YEM9, antibiotic kanamycin (1:1000), and inducer IPTG (1:1000). Place the control strain KA and the experimental strain RK cultured in the shake flask into the electro-synthesis monopolar chamber for cultivation. Provide different potentials (high potential: +0.5 V, 2 days; low potential: -0.6 V, 8 days) through an electrochemical workstation, sample daily, and measure the isobutanol yield by gas chromatography.

[0016] 3. Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0017] The present invention uses the NADH biosensor to dynamically regulate the electro-synthesis pathway. The positive potential responds to NAD + to inhibit the electro-synthesis pathway, enabling the strain to grow concentratedly to form a biofilm, thereby relieving the metabolic burden brought by the premature supply of reducing power; the negative potential responds to NADH to activate the expression of the isobutanol pathway, efficiently utilize the reducing power to synthesize isobutanol, ultimately realizing the decoupling of the cell growth and product synthesis stages, as well as realizing the dynamic regulation and efficient intelligent distribution of the reducing power, and improving the synthesis of the product isobutanol. Brief Description of the Drawings

[0018] Figure 1 It is the plasmid map of pCM-Rex-P IP -FBFP;

[0019] Figure 2 It is the plasmid map of pHG12-KAACD;

[0020] Figure 3 It is the plasmid map of pHG12-Rex-KAACD;

[0021] Figure 4 It is the fluorescence measurement of the strain under aerobic and anaerobic culture conditions;

[0022] Figure 5 It is the comparison chart of the electro-synthesis isobutanol production - time of the sensor strain RK. Figure 6 It is the gene circuit design and mechanism for the dynamic regulation of the two-stage MES process of the strain RK based on the NADH biosensor Embodiments

[0023] The present invention will be further described below in conjunction with specific embodiments, but the present invention is not limited by the embodiments.

[0024] For those not specifying specific techniques or conditions in the embodiments, they shall be carried out according to the techniques described in the literature in this field or according to the product specifications. For those reagents or instruments not specifying the manufacturer, they are all conventional products that can be obtained by purchase.

[0025] Example 1: Vector Construction

[0026] The Bacillus subtilis transcription factor Rex and promoter P were obtained by PCR method IP , after codon optimization of the fluorescence protein FBFP sequence, it was synthesized by GenScript; the gene fragments were ligated by overlap extension PCR and ligated to the pCM vector by seamless cloning technology to obtain the pCM-Rex-P IP -FBFP plasmid; the rex-P IP fragment was amplified from the pCM-Rex-P IP -FBFP plasmid by PCR method, and the linearized backbone of pHG12-ΔlacI-ΔPtac-KAACD was amplified from the pHG12-KAACD vector by PCR method and ligated by seamless cloning technology to obtain the pHG12-Rex-P IP -KAACD plasmid, which was transferred into the competent cells of Escherichia coli E.coli WM3064 and conjugatively transferred into the wild-type Shewanella oneidensis MR-1 to obtain the experimental strain RK. The specific steps are as follows:

[0027] 1. Primer design (synthetic)

[0028] Obtain the genomic sequence of Bacillus subtilis from the NCBI database. Design two pairs of fragment primers based on the gene rex and the promoter sequence P IP and its upstream and downstream gene sequences. After codon optimization of the fluorescent protein FBFP sequence, it was synthesized by Genewiz. Design a pair of vector primers based on the upstream and downstream gene sequences of the complete pCM plasmid, and design upstream and downstream primers respectively according to the plasmid map information of the gene fragment rex-P IP -fbfp and the vector pHG12-KAACD. There are 20 bp of homologous complementary sequences at the 5' ends of both the vector primers and the fragment primers.

[0029] 2. Gene amplification and construction of expression vector

[0030] Use the fragment PCR technique to obtain the gene rex, the promoter P IP fragment and the FBFP gene fragment respectively, and keep the gene sequence unchanged. The steps are as follows:

[0031] Table 1-1 Fragment PCR reaction system for gene rex

[0032] Name Phanta Buffer dNTPMixture Template rex-Frex-R Phanta DNA Polymerase <![CDATA[ddH 2 O]]> all Volume μL 10 1 1 2 each 1 33 50

[0033] Table 1-2 Fragment PCR reaction program for gene rex

[0034]

[0035] The primer sequences are as follows:

[0036] rex-F: 5'-TCCCTCTAGAATGAACAAAGATCAATCTAAAATCCCACAA-3'

[0037] rex-R: 5'-CCTTACTCGAGTTATTCGATTTCTTCTAAAACAGAGTAGTG-3'

[0038] Identify the amplification product by 1% agarose gel electrophoresis.

[0039] Table 2-1 Fragment PCR reaction system for gene P IP

[0040] Name Phanta Buffer dNTPMixture Template <![CDATA[P IP -FP IP -R]]> Phanta DNA Polymerase <![CDATA[ddH 2 O]]> all Volume μL 10 1 1 2 each 1 33 50

[0041] Table 2-2 Fragment PCR reaction program for gene P IP

[0042] ​​

[0043] The primer sequences are as follows:

[0044] P IP -F: 5'-AAGAAGCCATGCTAAACCTCCTAATAGATTTTATAAGA-3'

[0045] P IP -R: 5'-CTTTGTTCATTCTAGAGGGAAACCGTTGTGGACTCCCTAT-3'

[0046] The amplified products were identified by 1% agarose gel electrophoresis.

[0047] Using the intact circular plasmid pCM as a template, the linearized vector pCM was obtained by inverse PCR technology. The steps are as follows:

[0048] Table 3-1 Inverse PCR reaction system of plasmid pCM

[0049] Name Phanta Buffer dNTPMixture Template pCM-FpCM-R Phanta DNA Polymerase <![CDATA[ddH 2 O]]> all Volume μL 10 1 1 2 each 1 33 50

[0050] Table 3-2 Inverse PCR reaction of plasmid pCM

[0051]

[0052] The primer sequences are as follows:

[0053] pCM-F: 5'-AATCGAATAACTCGAGTAAGGATCTCCAGGCATCAAATAAAAC -3'

[0054] pCM-R: 5'- ATTAGAATAACTTAAGCTGGCGCGAGGACCAACGTATCAG -3'

[0055] Using the above three gene fragments as templates, the target gene fragment rex-P IP -fbfp was obtained by overlap extension PCR technology while keeping the gene fragment sequence unchanged. The steps are as follows:

[0056] Table 4-1 rex, P IP、 Overlap extension PCR reaction system of fbfp

[0057] Name Phanta Buffer dNTPMixture Template rex-Ffbfp-R Phanta DNA Polymerase <![CDATA[ddH 2 O]]> all Volume μL 10 1 1 each 2 each 1 31 50

[0058] Table 4-2 rex, P IP、 Overlap extension PCR reaction of fbfp

[0059]

[0060] The primer sequences are as follows:

[0061] rex-F: 5’-TCCCTCTAGAATGAACAAAGATCAATCTAAAATCCCACAA-3’

[0062] fbfp-R: 5’- GGTTTATAGCATGGCTTCTTTCCAATCTTTCGGTATCCCA -3’

[0063] The amplified products were identified by 1% agarose gel electrophoresis.

[0064] Using seamless cloning and ligation technology, the target gene fragment rex-P IP -fbfp was ligated with the linearized vector pCM to obtain the expression vector pCM-Rex-P IP -FBFP. The steps are as follows:

[0065] Table 5 Seamless cloning system

[0066] Name <![CDATA[Gene fragment rex-P IP -fbfp]]> Linearized backbone pCM SeamlessCloning Kit all Volume μL 3 2 5 10

[0067] Water bath heating at 50℃ for 15 min

[0068] Using plasmid pCM-Rex-P IP -FBFP as a template, the gene fragment rex-P IP was obtained by fragment PCR technology respectively, and the gene sequence was kept unchanged;

[0069] Table 6-1 Fragment PCR reaction system of gene rex-P IP

[0070] Name Phanta Buffer dNTPMixture Template RP-FRP-R Phanta DNA Polymerase <![CDATA[ddH 2 O]]> all Volume μL 10 1 1 2 each 1 33 50

[0071] Table 6-2 Fragment PCR reaction program of gene rex-P IP

[0072]

[0073] The primer sequences are as follows:

[0074] RP-F: 5’- TGCGTTGCGCTTATTCGATTTCTTCTAAAACAGAGTAGTG-3’

[0075] RP-R: 5’-TCCCTCTAGAATGAACAAAGATCAATCTAAAATCCCACAA -3’

[0076] The amplified products were identified by 1% agarose gel electrophoresis. ​​

[0077] Using the complete circular plasmid pHG12-KAACD as a template, the linearized backbone pHG12-ΔlacI-ΔPtac-KAACD was obtained by inverse PCR. The steps are as follows:

[0078] Table 7-1 Inverse PCR reaction system of plasmid pHG12-KAACD

[0079] Name Phanta Buffer dNTPMixture Template 12KA-F12KA-R Phanta DNA Polymerase <![CDATA[ddH 2 O]]> all Volume μL 10 1 1 2 each 1 33 50

[0080] Table 7-2 Inverse PCR reaction of plasmid pHG12-KAACD

[0081]

[0082] 12KA-F: 5’- CTTTGTTCATTCTAGAGGGAAACCGTTGTGGACTCCCTATG-3’

[0083] 12KA-R: 5’-AATCGAATAAGCGCAACGCAATTAATGTAAGTTAGCTCAC-3’

[0084] The amplified products were identified by 1% agarose gel electrophoresis.

[0085] Using seamless cloning and ligation technology, the target gene fragment rex-P IP was ligated with the linearized backbone pHG12-ΔlacI-ΔPtac-KAACD to obtain the expression vector pHG12-rex-P IP -KAACD. The steps are as follows:

[0086] Table 8 Seamless cloning system

[0087] Name <![CDATA[Gene fragment rex-P IP > Linearized backbone pHG12-ΔlacI-ΔPtac-KAACD SeamlessCloning Kit all Volume μL 3 2 5 10

[0088] Water bath heating at 50°C for 15 min.

[0089] 3. Construction of experimental strain RK

[0090] First, using the chemical transformation method, the constructed expression vector pHG12-Rex-KAACD was transferred into the competent cells of E. coli WM3064; further, the E. coli MW3064 strain containing the expression vector pHG12-Rex-KAACD was conjugally transferred with the wild-type Shewanella oneidensis MR-1 to construct the electro-synthesis strain RK containing the biosensor.

[0091] (1) The chemical transformation steps of E. coli WM3064 are as follows:

[0092] Take 50 μL of WM3064 competent cells from an -80 °C refrigerator and place them on ice to thaw.

[0093] Mix the constructed expression vector pHG12-Rex-KAACD with E. coli WM3064 competent cells in a 1.5 mL centrifuge tube and incubate on ice for 25 - 30 min.

[0094] Heat shock in a 42 °C water bath for 90 s, then immediately incubate on ice for 3 - 5 min.

[0095] Add 1 mL of LD medium (add 0.059 g of DAP to 1 L of LB medium) to the above system and culture at 37 °C and 180 rpm for 45 - 60 min.

[0096] Centrifuge the above bacterial suspension at 5000 rpm for 5 - 8 min and discard the supernatant.

[0097] Resuspend the cells in 100 μL of LD medium.

[0098] Spread 100 μL of the bacterial suspension on an LD solid medium supplemented with 50 μg / mL kanamycin resistance and culture at 37 °C for 12 h.

[0099] Verify the transformants by colony PCR, and sequence the plasmids extracted from the strains with correct bands for verification.

[0100] Preserve the recombinant WM3064 strains with correct sequencing verification for subsequent conjugation transfer experiments.

[0101] (2)The steps for conjugation transfer between the recombinant WM3064 strain and the wild-type S. oneidensis MR-1 are as follows:

[0102] Take out the WM3064 recombinant bacteria containing the expression vector pHG12-Rex-KAACD and the S. oneidensis MR-1 glycerol bacteria from an -80 °C refrigerator, streak them in three zones on the corresponding solid media respectively, and incubate them in an incubator at 37 °C and 30 °C for 12 h (the WM3064 recombinant bacteria need to use LD solid medium, while S. oneidensis MR-1 uses LB solid medium).

[0103] Pick single colonies from the solid media respectively and inoculate them into test tubes containing 5 mL of the corresponding liquid medium, and culture them overnight in a shaker at the corresponding temperature and rotation speed (for the WM3064 recombinant bacteria, 37 °C, 220 rpm; for S. oneidensis MR-1, 30 °C, 200 rpm).

[0104] Transfer 500 μL each of the recombinant bacterium WM3064 containing the expression vector pHG12-Rex-KAACD and S. oneidensis MR-1 into a 1.5 mL EP tube, mix well, centrifuge at 5000 rpm for 5 - 8 min, discard the supernatant, resuspend the cells in 1 mL of LD liquid medium, and incubate statically in a 30 °C incubator for 2 h;

[0105] Centrifuge the above cell suspension at 5000 rpm for 5 - 8 min, discard the supernatant, resuspend the cells in 1 mL of fresh LB liquid medium, centrifuge under the same conditions and discard the supernatant;

[0106] Resuspend the cells in 500 μL of fresh LB liquid medium, pipette 80 μL of the mixed cell suspension and spread it on an LB solid medium supplemented with 50 μg / mL kanamycin resistance, and incubate statically in a 30 °C incubator for 12 h;

[0107] Wait for single colonies to grow, verify the correctness of the conjugants by colony PCR, and sequence the conjugants with correct bands for the next experiment.

[0108] Example 2: Fermentation method

[0109] The experimental strain RK was cultured in an LB medium containing kanamycin resistance at 30 °C on a 200 rpm shaker. Transfer 1 mL of the overnight culture to a 250 mL shake flask containing 100 mL of YEM9 (1 g / L yeast extract, 40 mM DL-sodium lactate, M9 salts, 1 M MgSO 4 and 0.1 mM CaCl 2 ), kanamycin resistance and the inducer IPTG (1 mM) for overnight culture;

[0110] Incubate the overnight culture in a three-electrode monopolar bioelectrochemical reaction chamber with Ag / AgCl as the reference electrode, a carbon felt (2.5 × 3 cm 2 as the working electrode, and a platinum mesh (area 4 cm 2 as the counter electrode. Apply a predetermined potential of +0.5 V for 2 days and -0.6 V for 10 days (relative to Ag / AgCl) provided by a CHI1000 C multi-channel potentiostat for electrosynthesis, and add a magnetic stir bar for agitation. Ferment the KA strain in the same way.

[0111] Example 3: Product analysis

[0112] First, collect 1 mL of the bacterial culture in a shake flask of a single-chamber bioelectrochemical reactor and mix it with 1 mL of ethyl acetate. Use a pipette to collect the organic phase (top layer) and transfer it to a container containing Na 2 SO 4in a clean borosilicate glass tube;

[0113] These samples were injected into a gas chromatograph Trace 1300 (Thermo Fisher Scientific, USA) equipped with a capillary column (TG-WAXMS, 30 m × 0.32 mm × 0.25 μm, Thermo Fisher Scientific, USA), with helium as the carrier gas. 2 μL aliquots of the organic phase were injected using an autosampler. The inlet was maintained at 250 °C;

[0114] It was held at 60 °C for 5 min, heated to 230 °C at 20 °C / min, and then held at 220 °C for 1 min. Peak detection was carried out using a flame ionization detector, which was maintained at 250 °C;

[0115] The control strain KA was subjected to two-stage electrosynthesis at potentials of +0.5 V and -0.6 V, and the isobutanol production was 400.0 ± 4.2 mg / L. The experimental strain RK achieved an intelligent conversion of growth and product synthesis by dynamically responding to NADH. At positive potentials, NAD + combined with Rex to inhibit the expression of the isobutanol synthesis gene, enabling the strain to focus on growth and the OD was increased; while at negative potentials, NADH combined with Rex to relieve its inhibitory effect, and the electrosynthesis pathway was overexpressed, and the final yield reached 773.0 mg / L ± 9.3 mg / L, which was 93% higher than that of the starting strain KAACD.

[0116] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Preparation and application of a biosensor for efficiently distributing electro-reducing power to improve electro-synthesis output, Characterized in that, It includes the following steps: The biosensor contains a transcription factor, a promoter, and a fluorescent protein gene. The transcription factor is Rex, and the nucleotide sequence of its coding gene is as shown in SEQ ID NO. 1; the promoter is P IP , and its nucleotide sequence is as shown in SEQ ID NO. 2; the fluorescent protein is FBFP, and the nucleotide sequence of its coding gene is as shown in SEQ ID NO. 3; the isobutanol biosensor has the function of intelligently responding to intracellular reducing power and dynamically regulating its efficient distribution.

2. The construction method according to claim 1, Characterized in that, The transcription factor-encoding gene rex and the promoter P were amplified from the genome of Bacillus subtilis by PCR IP and ligated with the fluorescent protein FBFP gene by overlap extension PCR to obtain the rex-P IP -fbfp gene circuit.

3. The construction method according to claim 1, Characterized in that, For rex-P IP After codon optimization of the sequence of -fbfp, it was ligated into the vector pCM containing chloramphenicol resistance by seamless cloning to obtain the pCM-Rex-P IP -FBFP plasmid.

4. The construction method according to claim 1, Characterized in that, Transfer the plasmid pCM-Rex-P IP -FBFP into Escherichia coli, and then combine and transfer it with wild-type Shewanella oneidensis MR-1 to obtain the biosensor strain Rex.

5. The construction method according to claim 1, Characterized in that, Amplify rex-P IP fragment from pCM-Rex-P IP -FBFP plasmid by PCR method.

6. The construction method according to claims 2-5, Characterized in that, The vector is the pHG12-KAACD vector, which includes an inducible promoter P tac driving the expression of five genes in the isobutanol synthesis pathway and P tac -alsS-ilvC-ilvD and P tac -kivD-adhA, the kanamycin resistance encoding gene kana, the lactose operon encoding gene lacI, and a multiple cloning site.

7. The construction method according to claim 6, Characterized in that, Including by seamless cloning, using rex-P IP to replace LacI and P in pHG-12-KAACD with a tac promoter-encoding fragment lacI-P tac , to obtain plasmid pHG12-Rex-KAACD, whose nucleotide sequence is shown in SEQ ID NO.

4.

8. The construction method according to claim 7, Characterized in that, The plasmid pHG12-Rex-KAACD is transferred into Escherichia coli, and then combined and transferred with wild-type Shewanella oneidensis MR-1 to obtain an electro-synthesis strain RK with a biosensor.

9. Use of the sensor strain RK according to claim 8 in electro-synthesis.

Images