Application of Cassava Mosaic Virus AC2 in Inhibiting Degradation of mRNA Decay Substrates

Abstract

The present invention provides the use of genes such as AC2 for increasing GFP expression and / or inhibiting the degradation of mRNA decay substrates using GFP as a reporter gene. The present invention has discovered that AC2 has mRNA decay inhibition function, inhibiting the degradation of nonsense-mediated mRNA decay substrates using GFP as a reporter gene, as well as the degradation of endogenous nonsense-mediated mRNA decay substrates in Arabidopsis thaliana. It can increase the mRNA expression of genes such as AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, and AT1G36730, while reducing the expression of AT1G72450 and AT2G400. It also interacts with Dcp1 and Dcp2, enhancing yeast growth in nutrient-deficient culture media and reducing Dcp1 expression levels. These findings will lay the foundation for elucidating the functions of AC2.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to application of cassava mosaic virus AC2 in inhibiting degradation of mRNA decay substrates. Background Art

[0002] mRNA decay, as a highly conserved self-protection mechanism, plays an important role in resisting viral invasion (Ge L, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, WangA, Zhou X, Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complexrestricts the infection of potyvirids in plants. Mol Plant. 2023,16(3):632-642.; Wu J, Zhang Y, Li F, Zhang X, Ye J, Wei T, Li Z, Tao X, Cui F, Wang X,Zhang L, Yan F, Li S, Liu Y, Li D, Zhou X, Li Y. Plant virology in the 21stcentury in China: Recent advances and future directions. J Integr Plant Biol.2023a, doi: 10.1111 / jipb.13580.). mRNA decay includes nonsense-mediated mRNA decay (NMD), Staufen1-mediated mRNA decay (SMD), and structure-mediated RNA decay (SRD). Upstream frameshift 1 (UPF1) is a key component of the three mRNA decay pathways (GeL, Cao B, Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X,Li F. SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts the infection of potyvirids in plants. Mol Plant. 2023,16(3):632-642.).Studies have found that NMD, SMD and SRD are all involved in antiviral defense (May JP, Simon AE. Targeting of viral RNAs byUpf1-mediated RNA decay pathways. Curr Opin Virol. 2021,47:1-8.;Ge L, Cao B,Qiao R, Cui H, Li S, Shan H, Gong P, Zhang M, Li H, Wang A, Zhou X, Li F.SUMOylation-modified Pelota-Hbs1 RNA surveillance complex restricts theinfection of potyvirids in plants. Mol Plant. 2023,16(3):632-642.). Among them, NMD plays an important regulatory role in the gene expression, growth and development and adversity defense response of organisms by rapidly degrading unstable and defective mRNAs to achieve quantitative regulation and quality monitoring of mRNA. Viruses are obligate parasites that have evolved to evade or tolerate various immune defense mechanisms of the host in the process of mutual game with the host to achieve infection. Exploring the various immune defense mechanisms by which different viruses evade or tolerate their hosts has become a research frontier and hotspot in this field (Sun H, Jing X, WangC, Wang P, Huang Z, Sun B, Li P, Li H, Zhang C. The Great Game between Plantsand Viruses: A Focus on Protein Homeostasis. Int J Mol Sci. 2023,24(16):12582.). The research results not only have important theoretical value, but also provide new technologies for the green prevention and control of viral diseases.

[0003] Cassava mosaic disease (CMD), caused by cassava mosaic geminiviruses (CMVs), poses a serious threat to the development of my country's cassava industry and food security. CMD was first reported in Hainan and Fujian, my country in 2018, and has since been reported in other growing areas (Wang et al., 2018). Therefore, basic research on virus-resistant breeding is urgently needed. Sri Lankan cassava mosaic virusSLCMV (Cassava mosaic virus) is a strain of cassava mosaic virus, classified as a member of the genus Begomovirus in the family Geminiviridae. It is a typical two-component single-stranded DNA virus, with its genome consisting of two circular components, DNA-A and DNA-B. The positive-sense strand of the DNA-A component encodes two proteins, AV1 and AV2, while the antisense strand encodes four proteins, AC1, AC2, AC3, and AC2. The DNA-B component encodes BV1 and BC1 (Patil et al., 2009; Chen et al., 2019).

[0004] The virus has an extremely small genome, so most of the proteins it encodes are multifunctional. AC2 is not only a transcriptional activator of SLCMV but also a suppressor of viral silencing, inhibiting host PTGS and enhancing viral pathogenicity (Vanitharani et al., 2004; Chen et al., 2019). Whether AC2 has other functions has not yet been reported and remains to be studied. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies in the prior art and provide an application of cassava mosaic virus AC2 in inhibiting the degradation of mRNA decay substrates. The present invention has found that AC2 interacts with DCP1 and DCP2, which form process-bodies in Arabidopsis thaliana, and downregulates DCP1 expression, thereby inhibiting the degradation of nonsense-mediated mRNA decay substrates using GFP as a reporter gene and endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana, indicating that AC2 has the function of inhibiting mRNA decay.

[0006] The first aspect of the present invention is to provide the use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in increasing the expression level of GFP and / or inhibiting the degradation of an mRNA attenuation substrate using GFP as a reporter gene; wherein the nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1.

[0007] The second aspect of the present invention is to provide the use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in inhibiting the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana; wherein the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO: 1; or the use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in inhibiting the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana without affecting the phenotype of transgenic Arabidopsis thaliana; wherein the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO: 1.

[0008] Wherein, the target transcripts of the Arabidopsis endogenous nonsense-mediated mRNA attenuation are mRNAs of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570.

[0009] The third aspect of the present invention is to provide an AC2 gene, or a protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in regulating the mRNA expression of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400, wherein the nucleotide sequence of the AC2 gene is as shown in SEQ ID NO: 1; or the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in regulating the mRNA expression of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400 without affecting the phenotype of transgenic Arabidopsis thaliana; wherein the nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1.

[0010] Among them, the AC2 gene, or the protein encoded by the AC2 gene, or the recombinant vector or host bacteria containing the AC2 gene coding region increases the mRNA expression level of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570.

[0011] The AC2 gene, or the protein encoded by the AC2 gene, or the recombinant vector or host bacteria containing the AC2 gene coding region reduces the expression levels of AT1G72450 and AT2G400.

[0012] The fourth aspect of the present invention is to provide the use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in reducing the expression level of DCP1; wherein the nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1, and the nucleotide sequence of the corresponding gene of DCP1 is shown in SEQ ID NO: 2.

[0013] The fifth aspect of the present invention is to provide the use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in interacting with DCP1 and / or DCP2; wherein, the nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1, the nucleotide sequence of the corresponding gene of DCP1 is shown in SEQ ID NO: 2; the nucleotide sequence of the corresponding gene of DCP2 is shown in SEQ ID NO: 3.

[0014] Among them, AC2 interacts with DCP1 or DCP2 to enhance the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium containing the autoactivation inhibitor 3-AT.

[0015] Among them, AC2 interacts with DCP1 to reduce the expression level of DCP1.

[0016] The present study found that AC2 has an mRNA decay inhibitory function and can inhibit the degradation of nonsense-mediated mRNA decay substrates using GFP as a reporter gene and the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana. It can increase the mRNA expression levels of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570, and reduce the expression levels of AT1G72450 and AT2G400. It also interacts with DCP1 and DCP2, and can enhance the growth ability of yeast in SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium or SD / -Ade / -His / -Leu / -Trp nutrient-deficient medium containing the autoactivation inhibitor 3-AT, and can reduce the expression level of DCP1. The research results will lay a foundation for clarifying the function of AC2. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1AC2 interacts with host UPF1, DCP1, and DCP2 in cells. Yeast two-hybrid analysis of AC2 with Arabidopsis PARN, UPF1, DCP1, and DCP2.

[0018] Figure 2 Confocal microscopy was used to observe the GFP fluorescence results of Nicotiana benthamiana leaves 5 dpa after the vector DCP1-GFP and the empty vector pF1300 (EV) or p1300-AC2-Flag (AC2) were co-infiltrated.

[0019] Figure 3 Western blot analysis of GFP protein accumulation in Nicotiana benthamiana leaves 5 dpa after co-infiltration of the DCP1-GFP vector with either the empty vector Vec or the p1300-AC2-Flag (AC2). DCP1-GFP: plant expression vector expressing the DCP1-GFP fusion protein; Vec: empty vector; AC2: p1300-AC2-Flag, a plant expression vector expressing AC2-Flag; GFP: GFP antibody; Rubisco: Rubisco stained with Coomassie Brilliant Blue.

[0020] Figure 4 Schematic diagram of injection into Nicotiana benthamiana leaves. Reporter is the expression vector pG1300abc or pG1300; Vec is the empty vector pF1300; AC2 is p1300-AC2-Flag; and P19 is the expression vector pZP-p19.

[0021] Figure 5 This figure shows the effect of AC2 on GFP expression at the transcriptional level. Different GFP reporter expression vectors (pG1300abc or pG1300) were mixed with equal volumes of the empty vector pF1300 or p1300-AC2-Flag and pZP-p19, respectively, and injected into Nicotiana benthamiana leaves. GFP expression was observed five days after injection. Vec represents the empty vector pF1300; AC2 represents p1300-AC2-Flag; and P19 represents the expression vector pZP-p19.

[0022] Figure 6 Figure 3 Quantitative PCR analysis of known NMD target transcripts: (a) premature termination codon genes (PTC: AT1G01060, RPS6, and SMG7); (b) upstream open reading frame genes (uORFs: AT5G35490, AT5G64430, and ATG36730); (c) unknown NMD target genes (AT4G13900, AT5G22570); and (d) ARE target genes of AU-rich instability elements (AT1G72450, AT2G4000). DETAILED DESCRIPTION

[0023] The present invention will be further described below with reference to the accompanying drawings and in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not specified in the examples, the methods are based on those described in the literature in this field or on the product specifications. Where the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional products.

[0024] 1 Plant material

[0025] Wild-type Nicotiana benthamiana N. benthamiana and Arabidopsis thaliana A. thaliana .

[0026] 2 Experimental methods and results

[0027] 2.1 Construction of plant expression vectors

[0028] (1) pG1300abc vector

[0029] Shanghai Sangon Biotechnology Co., Ltd. was commissioned to artificially synthesize the target fragment abc-SacI & SacI (see Table 2 for the specific sequence). The target fragment was digested with SacI and ligated with pG1300 (Liu, L., Wang, H., Fu,Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnipcrinkle virus-encoded suppressor of RNA silencing interacts with ArabidopsisSGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166) that had been digested with the same enzyme. The ligation product was transformed into Escherichia coli, and the positive clone was identified as a forward insertion by sequencing and named pG1300abc.

[0030] (2) AD-DCP1, AD-DCP2, and AD-UPF1 vectors

[0031] DCP1 (SEQ ID NO: 2), DCP2 (SEQ ID NO: 3), and UPF1 were amplified using Arabidopsis cDNA as template using primers DCP1-1F SfiI and DCP1-1104R BamHI, DCP2-1F SfiI and DCP2-1161RBamH, and Upf1-1F SfiI and Upf1-3765R BamHI (see Table 1 for specific sequences). The PCR amplification system consisted of 1 μL of each primer (10 μmol / L) and 10 μL of 2*Magic Green Taq SuperMix, which was made up to 20 μL with ddH2O. The amplification program was pre-denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 60 s, annealing at 56°C for 30 s, and extension at 72°C for 90 s, with a final extension at 72°C for 10 min. The amplified product was double-digested with SfiI and BamHI and ligated with the large fragment of the yeast expression vector pGADT7 recovered by the same double-digestion. The ligation product was transformed into Escherichia coli. The positive clones were identified by PCR and sequencing and named AD-DCP1, AD-DCP2 and AD-UPF1.

[0032] (3) DCP1-GFP vector

[0033] DCP1 was amplified using the AD-DCP1 template with DCP1-1F MluI and DCP1-1104R KpnI (sequences are shown in Table 1). The PCR amplification system consisted of 1 μL of each primer (10 μmol / L) and 10 μL of 2* Magic Green Taq SuperMix, made up to 20 μL with ddH2O. The amplification program was a 94°C initial denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 60 s, annealing at 56°C for 30 s, and extension at 72°C for 90 s, with a final extension at 72°C for 10 min. The amplified product was double-digested with MluI and KpnI and ligated with the large fragment of the plant expression vector pG1300, which had been recovered after the same double-digestion. The ligation product was transformed into Escherichia coli, and positive clones were confirmed by PCR and sequencing and named DCP1-GFP.

[0034] (4) p1300-AC2-Flag

[0035] With reference to the reported SLCMV sequence (GenBank: KT861468.1), the target fragment AC2-SpeI & KpnI (specific sequences are shown in Table 2) was artificially synthesized by Shanghai Sangon Biotechnology Co., Ltd. The synthetic fragment and the pF1300 vector (Wu, K., Fu, Y., Ren, Y., Liu, L., Zhang, X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing suppresses mRNA decay by interacting with Arabidopsis XRN4. The Plant journal : for cell and molecular biology , 116 (3), 744–755.) were double-digested with SpeI and KpnI and then ligated. The ligation products were transformed into Escherichia coli, and the positive clones were identified by PCR and sequencing and named p1300-AC2-Flag.

[0036] Table 1 Primers used

[0037] Primer name Sequence AtUpf1-1F SfiI ATGGATTCTCAACAGAGCGATCT AtUpf1-3765R BamHI TCAGCCATTGTAAGGATGTTTTG DCP1-1F SfiI CATATGGGCCATGGAGGCCATGTCTCAAAACGGGAAGATAAT DCP1-1104R BamHI GGCCTGCCAGGTCGACGGATCCTCATTGTTGAAGTGCATTTTGTA DCP2-1F SfiI CATATGGGCCATGGAGGCCATGTCGGGCCTCCATCGAT DCP2-1161R BamHI GGCCTGCCAGGTCGACGGATCCTCAAGCTGAATTACCAGATTCCAAC DCP1-1F MluI TATGTCTCAAAACGGGAAGATAAT DCP1-1104R KpnI GGTACCTTGTTGAAGTGCATTTTGTA DCP2-1F MluI ATGTCGGGCCTCCATCGAT DCP2-1161R KpnI AGCTGAATTACCAGATTCCAAC qNbActin-128F AAAGACCAGCTCATCCGTGG qNbActin-256R CCAGCAGCTTCCATTCCGAT qsGFP-306F GGACGACGGCAACTACAAGA qsGFP-519R TTCGATGTTGTGGCGGATCT

[0038] Table 2 Target fragment sequences

[0039] Fragment name Sequence (5′–3′) abc-SacI & SacI GAGCTCGCCCAGCTTCGCCACCTCCTTCACATTCAATATCGACGTTCCCAACAATTCAGGACCCGCCGATGGCCTTGCCTTTGTTCTCCTCCCCGTGGGCTCTCAGCCCCAAAGACAAAGGCGGTCTTCTAGGTCTGTCAACAACTACAAATACGACAGCAATGCCCATACTGTGGCTGTGGAGTTCGACACCCTCTACAACGTTCACTGGGACCCAAACCGGTCATATTGGCATCGACGTGAACTCCATCAAGTCTATCAAAACGACGACGTGGGATTTTGTCAAAGGA GAAAACGCGGAGGTTCTGATCACCTATGACTCCTCCACGAAGCTCTTGGTGGCTTCTCTGGTTTACCCTTCCTGAAAAACAAGCTTCATCGTCTCTGACACAGTGGACCTGAAGAGCGTTCTTCCCGAGTGGTGATCGTTGGGTTCACTGCCACCACTGGGATTACTAAAGGGAACGTTGAAACGAACGACATCCTCTCTTGGTCTTTTGCTTCCAAGCTCTCCGATGGCACCACATCTGAAGCTTTGAATCTTGGCAACTTCGCCCTCAACCAAATCCTCTAGGAGCTC AC2-SpeI & KpnI ATGCGACCTTCATCTCCCTCAGCGAGCCGCTCTACTCAGGTTCCAATCAAGGTCCAACACAGGGCAGCTAAGCGTAAGGCCATTCGGCGACGGAGAGTAGACCTCAATTGCGGCTGCTCATACTACGTGCACATCAACTGCCACAACCATGGATTCACGCACAGGGGAACTCATCACTGCAGCTCAGGCGATGAATGGCGTA TATATCTGGGAGGTTCCAAATCCCCTCTATTTCAGGATCATCCAGCACGACAGCCGGCCGTTCAACAGGCCGTGGGACATAATAACCATCCAGATACGCTTCAACCACAACCTGAGGAAAGCGTTGGGACTACATCAATGCTGGATGGATTTCAAGGTCTGGACGACCTTACAGCCTCAGACCTGGCGTTTCTTGAGGGTATT

[0040] 2.2 Yeast two-hybrid analysis to identify the interaction between AC2 and DCP1 / DCP2 / / UPF1

[0041] For ease of description, during the co-transformation process, the "pGADT7" vector is abbreviated as "AD" and the "pGBKT7" vector is abbreviated as "BD". The yeast expression vectors pGADT7, pGBKT7, AD-T (pGADT7-T), BD-53 (pGBKT7-53), BD-lam (pGBKT7-lam), BD-AC2 (pGBKT7-AC2), AD-UPF1, and AD-PARN (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC2 protein and AtPARN [J]. Chinese Journal of Tropical Crops, 2024, 45(01): 197-204.) are all stored in this laboratory.

[0042] Yeast vectors were co-transformed into competent yeast cells using different yeast expression vectors as described in Table 3. Single colonies identified as positive by PCR were picked and resuspended in 25 μL of sterile water to prepare a suspension. Sterile water was used to serially dilute the suspension to 10-fold, 100-fold, and 1000-fold. 2 μL of each suspension was inoculated into SD / -Leu / -Trp (SD-LW) nutrient-deficient medium, SD / -Leu / -Trp / -His / -Ade (SD-LWHA), and SD-LWHA medium supplemented with 5 mM autoactivation inhibitor 3-AT. Yeast co-transformed with AD-T and BD-Lam and AD-T and BD-53 served as negative and positive controls, respectively. These yeast cells, along with the target plasmid-transformed yeast, were inoculated onto solid culture medium and cultured in an inverted incubator at 28°C for 3 days. Growth was observed and recorded to determine protein interactions.

[0043] Table 3 Pairing combinations of yeast bait plasmids and prey plasmids

[0044] combination Bait carrier prey carrier 1 (positive control) AD-T BD-53 2 (negative control) AD-T BD-lam 3 BD-AC2 AD 4 BD-AC2 AD-PARN 5 BD-AC2 AD-UPF1 6 BD-AC2 AD-DCP1 7 BD-AC2 AD-DCP2

[0045] The results are as follows Figure 1 As shown (1, 10 in the figure -1 , 10 -2 , 10 -3 (The expression "(" represents 1-fold, 10-fold, 100-fold, and 1000-fold dilutions of the bacterial suspension, respectively) indicates that AC2 interacts with UPF1, DCP1, and DCP2 within yeast cells.) Transformants co-transformed with BD-AC2 and AD-UPF1, AD-DCP1, or AD-DCP2 grew on SD / -Trp / -Leu (SD-LW) and 3-AT-supplemented SD-LWHA-deficient medium. However, transformants co-transformed with BD-AC2 and the AD empty vector or with AD-PARN failed to grow. This indicates that AC2 interacts with UPF1, DCP1, and DCP2 within yeast cells. The results suggest that AC2 interacts with UPF1, AC2 with DCP1, and AC2 with DCP2.

[0046] AC2 downregulates DCP1 expression

[0047] 2.3.1 Confocal microscopy

[0048] Empty vector pF1300 (EV) and expression vector pZP-p19 containing the silencing suppressor p19, which does not interfere with mRNA decay (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinklevirus suppresses posttranscriptional gene silencing at an early initiation step. Journal of Virology , 77 (1), 511–522.) are all preserved in our laboratory.

[0049] Refer to the GV3101 Chemically Competent Cell product instructions to transform Agrobacterium tumefaciens GV3101 competent cells with the plant expression vectors DCP1-GFP, p1300-AC2-Flag, EV, and pZP-p19, respectively. Resuspend the cells after transformation and spread them evenly on LB plates containing the corresponding antibiotics. For DCP1-GFP, p1300-AC2-Flag, and EV, spread them on LB plates containing Kan and Rif resistances. For pZP-p19, spread them on LB plates containing Spec and Rif resistances. Incubate the cells upside down at 28°C in a constant temperature incubator for 72-90 hours. After 2-3 days, grow 2-3 mm Agrobacterium colonies, and select individual colonies for PCR identification.

[0050] The resuspended Agrobacterium containing the recombinant vector was mixed and injected into transgenic wild-type Nicotiana benthamiana leaves. The operation steps are as follows:

[0051] (a) Use a pipette tip to pick a single colony that has been identified as positive by colony PCR and transfer it to 5 ml of LB liquid medium containing the corresponding antibiotics. Place it in a constant temperature shaker at 28°C and 200 rpm for overnight culture.

[0052] (b) The bacterial solution was centrifuged at 7000 rpm for 15 min and the supernatant was discarded.

[0053] (c) Prepare injection buffer: Take 2 mL of 1 mol / L MgCl2, 2 mL of 1 mol / L MES, and 200 μL of 100 mg / mL AS, and finally make up to 200 mL with ultrapure water.

[0054] (d) Resuspend the bacterial pellet in 5 mL of injection buffer, vortex thoroughly to evenly distribute the pellet, measure the OD600 value of the bacterial pellet, and dilute the pellet to an OD600 of 0.5.

[0055] (e) The diluted bacterial solution was placed at room temperature for 2-3 hours.

[0056] (f) Select wild-type Nicotiana benthamiana at the 5-7 leaf stage with good growth, and inject approximately 2 cm 2 The vector DCP1-GFP and EV or p1300-AC2-Flag were injected into the same leaf, and 10 leaves were injected. The injected Nicotiana benthamiana were kept in the dark overnight and then cultured under normal conditions.

[0057] On the 5th day after injection, confocal microscopy was performed and the results were as follows: Figure 2 The number of DCP1-GFP fluorescent particles co-injected with p1300-AC2-Flag was significantly less than that co-injected with EV, indicating that AC2 down-regulates DCP1 expression.

[0058] 2.3.2 Western blot analysis of the effect of AC2 on DCP1 protein expression

[0059] Total protein was extracted from tobacco leaves injected with the above different combinations on the 5th day, and Western Blot was performed to detect GFP protein expression to verify the fluorescence observation results. Plant total protein extraction and Western Blot were performed according to the literature (Liu Linyu's master's thesis "Cassava mosaic virus silencing suppressor AC4 hijacks UPF1 to promote virus infection". The results are as follows Figure 3 As shown in the figure above, the expression level of DCP1-GFP in the sample co-injected with AC2 was significantly lower than that in the sample co-injected with the empty vector. Rubiso Coomassie Brilliant Blue staining showed that the loading amount was basically the same ( Figure 3 (Figure 2). WB results confirmed the fluorescence observation results, indicating that AC2 downregulated DCP1 expression.

[0060] 2.4 Detection of AC2’s mRNA degradation inhibitory function

[0061] 2.4.1 AC2 inhibits the degradation of mRNA substrates using GFP as a reporter gene

[0062] Empty vector pF1300 (EV) and expression vector pZP-p19 containing the silencing suppressor p19, which does not interfere with mRNA decay (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnip crinklevirus suppresses posttranscriptional gene silencing at an early initiation step. Journal of Virology , 77(1), 511–522.) are all preserved in our laboratory.

[0063] Transform Agrobacterium GV3101 competent cells with pG1300abc, pG1300, p1300-AC2-Flag, EV, and pZP-p19 according to the GV3101 Chemically Competent Cell product instructions. Resuspend the cells after transformation and spread them evenly on LB plates containing the corresponding antibiotics. For pG1300abc, pG1300, p1300-AC2-Flag, and EV, spread them on LB plates containing Kan and Rif resistances. For pZP-p19, spread them on LB plates containing Spec and Rif resistances. Incubate the cells upside down at 28°C in a constant temperature incubator for 72-90 hours. After 2-3 days, grow 2-3 mm Agrobacterium colonies, select individual colonies for PCR identification.

[0064] The resuspended Agrobacterium containing the recombinant vector was mixed and injected into transgenic wild-type Nicotiana benthamiana leaves. The operation steps are as follows:

[0065] (a) Use a pipette tip to pick a single colony that has been identified as positive by colony PCR and transfer it to 5 ml of LB liquid medium containing the corresponding antibiotics. Place the culture in a constant temperature shaker at 28°C and 200 rpm overnight.

[0066] (b) The bacterial solution was centrifuged at 7000 rpm for 15 min and the supernatant was discarded.

[0067] (c) Prepare injection buffer: Take 2 mL of 1 mol / L MgCl2, 2 mL of 1 mol / L MES, and 200 μL of 100 mg / mL AS, and finally make up to 200 mL with ultrapure water.

[0068] (d) Resuspend the bacterial pellet in 5 mL of injection buffer, vortex thoroughly to evenly distribute the pellet, measure the OD600 value of the bacterial pellet, and dilute the pellet to an OD600 of 0.5.

[0069] (e) After the diluted bacterial solution has been allowed to stand at room temperature for 2-3 h, mix it in equal volumes according to the desired mixing system (see Table 4 for specific combinations).

[0070] Table 4 Combinations of wild-type Nicotiana benthamiana injected with different plasmids by Agrobacterium

[0071] Group Recombinant plasmid Combination 1 pG1300abc + pF1300 + pZP-p19 Combination 2 pG1300abc + p1300-AC2-Flag + pZP-p19 Combination 3 pG1300 + pF1300 + pZP-p19 Combination 4 pG1300 + p1300-AC2-Flag + pZP-p19

[0072] (f) Combine the four combinations in Table 4 according to Figure 4 The injection was simultaneously performed on a Nicotiana benthamiana leaf. Ten leaves were injected, and the injected Nicotiana benthamiana leaves were kept in the dark overnight and then cultured under normal conditions.

[0073] (g) Five days after injection, total RNA was extracted from tobacco plants according to the instructions for Tiangen's TRNzol Universal Total RNA Extraction Reagent. Then, the RNA sample was reverse transcribed using a two-step method according to the instructions for the reverse transcription kit. Real-time fluorescence quantitative PCR (qRT-PCR) was performed using the resulting cDNA sample as a template, qNbActin-128F and qNbActin-256R as internal reference primers (Table 1), and qsGFP-306F and qsGFP-519R as GFP detection primers (Table 1).

[0074] The results are as follows Figure 5 As shown, when AC2 was co-expressed with pG1300abc containing a long 3'UTR, the GFP expression level was increased, while there was no obvious effect on the GFP expressed by pG1300. The transient expression results showed that AC2 significantly inhibited the degradation of mRNA decay substrates with long sequences at the 3' end and GFP as the reporter gene, indicating that SLCMV AC2 has the function of inhibiting host mRNA decay.

[0075] AC2 inhibits the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis

[0076] To further confirm the inhibitory effect of AC2 on host mRNA decay, the expression vector p1300-AC2-GFP was transformed into wild-type Arabidopsis by the pollen tube pathway to obtain transgenic Arabidopsis overexpressing AC2-GFP, named 35S:AC2-GFP. Four-week-old seedlings were collected, including 35S:AC2-GFP, Col-0, and a mutant with partial loss of function of the key mRNA decay gene UPF1. upf1-5RNA was extracted and real-time quantitative PCR (RT-qPCR) was performed to study the effect of overexpression of AC2 on the mRNA expression levels of NMD substrates and AU-rich instability elements (AREs) in transgenic plants. RT-qPCR was used to detect and analyze eight known NMD target transcripts in three major categories (Wu, K., Fu, Y., Ren, Y., Liu,L., Zhang, X., & Ruan, M. (2023). Turnip crinkle virus-encoded suppressor ofRNA silencing suppresses mRNA decay by interacting with Arabidopsis XRN4. ThePlant journal : for cell and molecular biology, 116(3), 744–755.): (A) AT1G0106020 containing a premature stop codon (Gloggnitzer, J., Akimcheva, S., Srinivasan, A.,Kusenda, B., Riehs, N., Stampfl, H. et al. (2014) Nonsense-mediated mRNA decay modulates immune receptor levels to regulate plant antibacterialdefense. Cell Host & Microbe, 16(3), 376–390.), RPS6 (Garcia, D., Garcia, S. &Voinnet, O. (2014) Nonsense-mediated decay serves as a general viralrestriction mechanism in plants. Cell Host & Microbe, 16(3), 391–402.) or SMG7 with long 3'UTR (Kerényi, Z., Mérai, Z., Hiripi, L., Benkovics, A., Gyula, P.,Lacomme, C. et al. (2008) Inter-kingdom conservation of mechanism ofnonsense-mediated mRNA decay.The EMBO Journal, 27(11), 1585–1595.); (B) AT5G35490, AT5G64430, and AT1G36730 with upstream open reading frames (uORFs) (Rayson, S., Arciga-Reyes, L.,Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) Arole for nonsense-mediated mRNA decay in plants: pathogen responses areinduced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.); and (C) mRNAs of two genes carrying unknown NMD cis-elements, AT4G3900 and AT5G22570 (Rayson, S., Arciga-Reyes,L., Wootton, L., De Torres Zabala, M., Truman, W., Graham, N. et al. (2012) Arole for nonsense-mediated mRNA decay in plants: pathogen responses are induced in Arabidopsis thaliana NMD mutants. PLoS One, 7(2), e31917.). .

[0077] Two target transcripts (AT1G72450 and AT2G400) containing AU unstable elements were analyzed by RT-qPCR (Gutierrez, RA, Ewing, RM, Cherry, JM & Green, PJ (2002) Identification of unstable transcripts in Arabidopsis by cDNA microarray analysis: rapid decay is associated with a group of touch- and specific clock-controlled genes. Proceedings of the National Academy of Sciences of the United States of America, 99(17), 11513–11518.).

[0078] The results are as follows Figure 6 As shown, compared with Col-0 plants, AC2-overexpressing plants showed significantly increased mRNA expression levels for AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570. In contrast, the mRNA expression levels of two other target transcripts containing AU-instability elements (AT1G72450 and AT2G400) were sharply decreased in AC2-overexpressing plants. This suggests that AC2 inhibits the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis and functions as an mRNA decay suppressor. The phenotype of transgenic Arabidopsis plants remained unchanged.

[0079] The above detailed description of the specific embodiments of the present invention is intended only as an example, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the practical embodiments are also within the scope of the present invention. Therefore, any equivalent changes and modifications made without departing from the spirit and scope of the present invention should be included within the scope of the present invention.

Claims

1. Use of the AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region in inhibiting the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana or in inhibiting the degradation of endogenous nonsense-mediated mRNA decay (NMD) substrates in Arabidopsis thaliana without affecting the phenotype of transgenic Arabidopsis thaliana; wherein: The nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; the target genes of the Arabidopsis endogenous nonsense-mediated mRNA attenuation are AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570.

2. AC2 gene, or the protein encoded by the AC2 gene, or a recombinant vector or host bacteria containing the AC2 gene coding region regulates the expression of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400. The invention relates to an enzyme that is capable of regulating the mRNA expression of AT1G0106020, and / or RPS6, and / or SMG7, and / or AT5G35490, and / or AT5G64430, and / or AT1G36730, and / or AT4G3900, and / or AT5G22570, and / or AT1G72450, and / or AT2G400 without affecting the phenotype of transgenic Arabidopsis thaliana; the nucleotide sequence of the AC2 gene is shown in SEQ ID NO: 1; the regulation is to increase the mRNA expression of AT1G0106020, RPS6, SMG7, AT5G35490, AT5G64430, AT1G36730, AT4G3900, and AT5G22570, or to reduce the mRNA expression of AT1G72450 and AT2G400.

Images