Fraxinus mandshurica FmGSK3 gene VIGS silencing system and application thereof

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a fraxinus mandshurica FmGSK3 gene VIGS silencing system and application thereof. According to the invention, a silence vector and a silence system of the fraxinus mandshurica FmGSK3 gene are constructed, and the silence system is introduced into leaves and stems of fraxinus mandshurica in a needle injection manner, so that silence of the fraxinus mandshurica FmGSK3 gene is induced. According to the method, the expression level of the fraxinus mandshurica FmGSK3 gene is effectively reduced, and a virus-induced gene silencing plant is successfully obtained. The technology can be used for rapidly verifying the function of the fraxinus mandshurica FmGSK3 gene, and has application value in the research of the fraxinus mandshurica functional gene.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a VIGS silencing system of the Manchurian ash FmGSK3 gene and an application thereof. Background Art

[0002] Manchurian ash is a dioecious, deciduous, large tree of the genus Fraxinus in the family Oleaceae, primarily distributed in Northeast China. As one of the three most valuable hardwoods in the region, its wood, with its high quality and fine grain, is used for furniture and specialized building materials, possessing significant economic value. With its broad crown, graceful form, and strong resilience, Manchurian ash is well-adapted to cold, humid, and hot climates, and has gradually become widely used as a street tree and in landscaping, possessing high landscape value. Although research has explored the mechanisms of wood formation and stress tolerance breeding in Manchurian ash, traditional hybrid breeding methods for developing new ash varieties with superior wood properties and strong stress tolerance typically require a long breeding cycle, potentially 30 years or more. Therefore, establishing an effective genetic transformation system is crucial for validating gene function in Manchurian ash, shortening breeding cycles, and accelerating the development of new varieties. However, Manchurian ash's own genetic transformation system is still underdeveloped, resulting in low transformation efficiency and long development cycles, leading to a relative lag in gene expression analysis and functional studies. Therefore, molecular biology research on elm is still relatively scarce, and there is an urgent need to further explore and improve the corresponding genetic transformation technology and research system.

[0003] Virus-induced gene silencing (VIGS) is an RNA-mediated post-transcriptional gene silencing defense mechanism and a ubiquitous genetic immunity mechanism in plants. This technique utilizes viruses carrying the cDNA of a functional plant gene to induce gene silencing and phenotypic changes, thereby reflecting the gene's function. Compared with transgenic methods, VIGS offers advantages such as simplicity and efficiency, a short cycle time, the ability to silence gene families, the lack of the need to obtain transgenic plants, and high throughput. Furthermore, functional comparisons can be made in plants with different genetic backgrounds, making it an effective tool for studying functional genomics and specific gene functions. Although VIGS has been widely used in many plant species, its application in Fraxinus mandshurica has not yet been explored. Summary of the Invention

[0004] The present invention aims to provide a VIGS silencing system for the FmGSK3 gene in Manchurian ash and its application for rapid verification of gene function in this plant. This system is simple, rapid, and effective, avoiding the labor-intensive and inefficient shortcomings of traditional genetic transformation. This system can effectively reduce the expression level of the FmGSK3 gene in Manchurian ash and induce the emergence of gene silencing, thereby providing an effective means for verifying gene function in Manchurian ash. This technology lays the foundation for identifying key genes with stress resistance traits and promoting the cultivation of new, high-quality Manchurian ash varieties.

[0005] To achieve the above objectives, in a first aspect, the present invention provides a VIGS silencing vector for the FmGSK3 gene of Manchurian ash, wherein the silencing vector comprises a specific fragment of the FmGSK3 gene of Manchurian ash, and the nucleotide sequence of the specific fragment is shown in SEQ ID NO.1, specifically as follows: 5'-ATGGTGCCACCG GGACCTCAGCTGTATCAGCACAATCCACCACCCGATAATCAATACCATAATGTCCTTGACCAAGCTATGCCACCACCAGCCGACGCGAAGCTTTCCACTGCAGCACCCAGGGAAACAGACAAGGAGATGTCGGCTTCTGTAGTCGATGGGAATGATCCAGCTGCTGGTCACATTATCTCCACCACCGTTGGAGGCAAAAATGGCGAGCCCAAAAGGACAGTTAGTTACATGGCAGAGCGTGTTGTTGGTACAGGATCATTTGGAATAGTTTTTCAGGCAAAA-3'

[0006] In a second aspect, the present invention provides a VIGS silencing system for the FmGSK3 gene of Fraxinus mandshurica, comprising the following steps:

[0007] a. The ash target gene FmGSK3 specific fragment was connected to the multiple cloning site of the pTRV2 vector to obtain a recombinant plasmid pTRV2-FmGSK3 specific fragment, the nucleotide sequence of the specific fragment is shown in SEQ ID NO.1;

[0008] b. The recombinant plasmid was transformed into Agrobacterium to obtain pTRV2-FmGSK3-specific fragment of Agrobacterium, and the cells were cultured and collected for later use;

[0009] c. The pTRV1 Agrobacterium, pTRV2-FmGSK3 specific fragment of Agrobacterium were resuspended and dispersed with a resuspension solution to prepare an Agrobacterium bacterial solution, and then the pTRV1 Agrobacterium bacterial solution and the pTRV2-FmGSK3 specific fragment of Agrobacterium bacterial solution were mixed as an infection solution;

[0010] d. Use a syringe to draw up the infection solution and inject it into the back of the leaves and stems of the ash seedlings until the surface of the plant is full of water stains;

[0011] e. The injected ash seedlings were cultured in the dark for 2 days under a high humidity environment, and then cultured normally at a temperature of 25°C, a photoperiod of 16h / 8h (day / night), and a light intensity of 20,000 Lux.

[0012] Preferably, Agrobacterium containing the pTRV1 vector and Agrobacterium containing the recombinant vector pTRV2-FmGSK3 are resuspended in resuspension solution to an OD600 of 0.8 respectively; and the Agrobacterium infection solution containing the pTRV1 vector and the Agrobacterium infection solution containing the recombinant vector pTRV2-FmGSK3 are mixed in an equal volume ratio.

[0013] Preferably, the resuspension contains 10 mM MES, 200 μM acetosyringone and 10 mM MgCl 2 (pH=5.6).

[0014] Preferably, the above-mentioned elm is an annual elm seedling.

[0015] Preferably, the above-mentioned method for constructing the VIGS silencing system for Manchurian ash also includes a control, wherein the control is to replace the pTRV2-FmGSK3-specific fragment Agrobacterium with pTRV2 Agrobacterium, and the remaining steps are the same. Using Manchurian ash plants injected with a blank infection solution as a control, the phenotypic changes of the target gene-infected plants under normal growth and drought conditions are monitored to detect the expression of the target gene.

[0016] The present invention also provides the use of the gene fragment or recombinant expression vector or VIGS silencing system described in the above technical solution in identifying the gene function of Fraxinus mandshurica.

[0017] The present invention has the following positive effects:

[0018] Fraxinus mandshurica faces challenges such as difficult genetic transformation cycles and long breeding cycles, which seriously hinder further research on its gene functions. This paper, for the first time, provides a method for constructing a transient gene silencing system for fraxinus mandshurica based on VIGS technology. The constructed silencing system has been validated and demonstrated to significantly reduce GSK3 expression in fraxinus mandshurica leaves and stems, with the silencing effect lasting three weeks. The present gene silencing system is simple, rapid, and highly efficient, providing strong support for research related to genetic improvement and molecular breeding of fraxinus mandshurica. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the electrophoresis diagram of FmGSK3-specific fragment clone.

[0020] Figure 2 This is a diagram of the infected site of the ash seedlings used for injection.

[0021] Figure 3 To quantitatively detect the expression level of target genes in VIGS lines.

[0022] Figure 4 The phenotypes of pTRV2-FmGSK3 and the control under drought treatment.

[0023] Figure 5 These are the results of electrical conductivity measurements of silent plants and controls after 7 days of drought treatment. DETAILED DESCRIPTION

[0024] The present invention is further explained through the accompanying drawings and examples.

[0025] Example 1: Cloning of FmGSK3-specific fragments and construction of VIGS silencing vector

[0026] a. The CDS sequence of the Fraxinus mandshurica FmGSK3 gene was aligned with that of homologous genes. Specific fragments were selected from the alignment results to design primers. The primers were designed by Heilongjiang Jiansu Gene Co., Ltd. The primer sequences are as follows: VIGS-GSK-F: 5'-TGAGTAAGGTTACCGAATTCTCTAGAATGGTGCCACCG GGACC-3'; VIGS-GSK-R: 5'-GCCTCGAGACGCGTGAGCTCGGTACCTTTTG CCTGAAAAACTA-3'.

[0027] b. Using Fraxinus mandshurica cDNA as a template and VIGS-GSK-F and VIGS-GSK-R as primers, amplification was performed using KOD enzyme. The amplification procedure was as follows: initial denaturation at 98°C for 2 minutes, followed by 35 cycles of denaturation at 98°C for 12 seconds, annealing at 60°C for 30 seconds, and extension at 68°C for 30 seconds, and a final extension at 68°C for 10 minutes. Bands were detected by 1.5% agarose gel electrophoresis. The results are shown in the figure below. Figure 1 As shown, a target fragment of 350 bp in size was amplified, and the band was single and bright. The fragment was recovered using the OMEGA gel recovery kit to obtain the amplified product of the Fraxinus mandshurica FmGSK3 gene fragment for VIGS construction.

[0028] c. The pTRV2 plasmid was digested with XbaⅠ and KnpⅠ restriction endonucleases at 37°C for 45 min, and the reaction was terminated at 80°C for 5 s. The digestion product was recovered using a purification kit from OMEGA.

[0029] d. The 350 bp FmGSK3-specific fragment amplified product obtained by the above cloning was ligated with the double-digested pTRV2 vector in a 1:1 ratio. The reaction system was 3 ul of ligase, 1.5 ul of fragment, and 1.5 ul of digested vector. The ligation was carried out at 50°C for 30 min.

[0030] e. Transform the ligation product into DH5a E. coli, pick a single clone, sequence it, and shake the correct clone to extract the plasmid.

[0031] Example 2: Preparation of infection solution

[0032] a. Add 500 ng of each pTRV1, pTRV2, and pTRV2-FmGSK3 plasmid to 50 μL of Agrobacterium GV3101 competent cells, mix gently, and incubate on ice for 30 minutes, in liquid nitrogen for 5 minutes, at 37°C for 5 minutes, and in an ice bath for 2 minutes. Add 500 μL of antibiotic-free LB liquid medium, incubate at 180 rpm at 28°C for 2 hours, centrifuge at 5000 rpm for 5 minutes, discard 200 μL of bacterial liquid, and spread the remaining cells on resistant LB solid medium containing 50 μg / ml kanamycin and 50 μg / ml rifampicin. Place the cells upside down in a 28°C constant temperature incubator and incubate for 2-3 days. Select single colonies and shake the cells. After PCR identification of positive clones, store the glycerol bacteria.

[0033] b. 200 μL of pTRV1, pTRV2, and pTRV2-FmGSK3 Agrobacterium bacteria were added to 5 ml of LB liquid medium containing 50 μg / ml kanamycin and 50 μg / ml rifampicin resistance, and cultured on a shaker at 28°C for 16 h. 3 ml of the bacteria were then drawn from the liquid and added to 100 ml of liquid LB containing 50 μg / ml kanamycin and 50 μg / ml rifampicin resistance. The bacteria were cultured on a shaker at 28°C until the OD600 value was 1.0. The bacteria were collected by centrifugation at 5000 rpm for 10 min and resuspended in buffer (containing 10 mM MES, 200 μM acetosyringone and 10 mM MgCl2, the balance being water, pH 5.6). The bacterial pellet was adjusted to an OD600 value of 0.8.

[0034] c. Mix the pTRV1 bacterial suspension and pTRV2-FmGSK3 resuspension at a ratio of 1:1. At the same time, mix the pTRV1 and pTRV2 resuspensions at a ratio of 1:1 as a control.

[0035] Example 3: Infection of Fraxinus mandshurica seedlings

[0036] a. One-year-old ash seedlings were used as materials. Water them well in advance and randomly select ash plants with good growth, relatively uniform development, and no obvious diseases and insect pests. They were divided into a control group and a test group. Then, a 1 mL disposable syringe was used to draw up the mixed pTRV2-FmGSK3 infection solution and the control infection solution, and the solution was injected into the back of the ash leaves and the stem segments. Figure 2 shown

[0037] b. After the injection, the seedlings were kept in a high humidity environment and shaded for 2 days. Then, they were cultured under normal light conditions, with a temperature of 25°C, a photoperiod of 16h / 8h (day / night), and a light intensity of 20,000 Lux.

[0038] Example 4: qRT-PCR detection of FmGSK3 gene expression

[0039] To investigate the effect of pTRV2-FmGSK3 silencing in plants, leaves and stems of infected plants were collected three weeks later, RNA was extracted, and reverse transcribed into cDNA. The relative expression levels of FmGSK3 in the silenced samples of Fraxinus mandshurica were detected by qRT-PCR. The primer sequences for qRT-PCR detection of FmGSK3 were as follows: Q-GSK3-F: 5'-CTCCTGAAGCCATTGATCTTGC-3'; Q-GSK3-R: 5'-CATGCTCAGGAATCA GCCGG-3'

[0040] Analyze the results, such as Figure 3 As shown in the figure, the expression levels of FmGSK3 gene in leaves and stems of Fraxinus mandshurica were decreased compared with those in the control, indicating that the VIGS gene silencing system of Fraxinus mandshurica was successfully constructed.

[0041] Example 5: Phenotypic Monitoring of Fraxinus mandshurica pTRV2-FmGSK3 Plants under Drought Conditions

[0042] To investigate the drought resistance of pTRV2-FmGSK3-silenced plants, the pTRV2-FmGSK3 plants and controls were subjected to natural drought conditions three weeks later. All Manchurian ash plants were watered abundantly one day beforehand, then watering was stopped. Soil moisture was measured four times daily. After the soil moisture content dropped to 35% to 40% (three days), the plants' drought resistance was observed. On the seventh day, leaves in the control group showed significant wilting and yellowing, while leaves in the pTRV2-FmGSK3 group remained emerald green, demonstrating stronger drought resistance. Electrical conductivity measurements revealed that after seven days, the control group had significantly higher electrical conductivity than the silenced plants, indicating that FmGSK3 gene silencing enhances Manchurian ash drought resistance.

[0043] It can be seen from the above embodiments that the present invention can achieve the silencing effect on the FmGSK3 gene of Fraxinus mandshurica. The leaves and stem segments of Fraxinus mandshurica after infection and injection can greatly reduce the gene expression level in a short period of time. The gene silencing effect is good, the gene conversion rate is high, and the gene function can be quickly verified, overcoming the difficulties of the long genetic transformation cycle and difficulty of Fraxinus mandshurica.

[0044] Finally, it should be noted that although the present invention has been described in detail above using general descriptions and specific embodiments, it is readily apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, without departing from the spirit of the present invention, are intended to fall within the scope of the present invention.

Claims

1. A VIGS silencing vector for the FmGSK3 gene of Fraxinus mandshurica, characterized in that: The silencing vector comprises a specific fragment of the Manchurian ash FmGSK3 gene, and the nucleotide sequence of the specific fragment is shown in SEQ ID NO.

1.

2. A VIGS silencing system for the FmGSK3 gene of Fraxinus mandshurica, characterized in that: The following steps are involved: ① Cloning of FmGSK3-specific fragments and construction of VIGS silencing vector; ② Preparation of infection solution; ③ Infection of elm seedlings; ④ qRT-PCR detection of FmGSK3 gene expression; ⑤ Phenotypic monitoring of elm pTRV2FmGSK3 plants under drought conditions.

3. The silencing system according to claim 2, characterized in that: Step ①: The primers for cloning the FmGSK3 specific fragment are VIGS-GSK-F: 5'-TGAGTAAGGTTACCGAATTCTCTAGAATGGT GCCACCGGGACC-3'; VIGS-GSK-R: 5'-GCCTCGAGACGCGTGA GCTCGG TACCTTT TGCCT GAAAAACTA-3'.

4. The silencing system according to claim 2, characterized in that: The preparation of the infection solution in step ② includes: resuspending the Agrobacterium containing the pTRV1 vector and the Agrobacterium containing the recombinant vector pTRV2-FmGSK3 respectively with a resuspension solution to an OD600 of 0.8; mixing the Agrobacterium infection solution containing the pTRV1 vector and the Agrobacterium infection solution containing the recombinant vector pTRV2-FmGSK3 in an equal volume ratio.

5. The resuspension according to claim 4, characterized in that: Contains 10 mM MES, 200 μM acetosyringone and 10 mM MgCl 2 (pH=5.6).

6. The silencing system according to claim 2, characterized in that: In step ③, the method of infecting the Manchurian ash seedlings is to use a syringe to inject leaves and stem segments; the Manchurian ash seedlings are one-year-old Manchurian ash seedlings in good growth condition.

7. The silencing system according to claim 2, characterized in that: After infection, the seedling materials were cultured in the dark for 2 days and then cultured in the light at a temperature of 25°C, a photoperiod of 16h / 8h (day / night), and a light intensity of 20,000Lux.

8. Application of the silencing vector according to claim 1 or the silencing system according to claims 2-7 in FmGSK3 gene function.

9. Use of the silencing vector according to claim 1 or the silencing system according to claims 2-7 in improving the drought resistance of elm wood.

Images