Attenuated African swine fever virus strain with ASFV-G-ACD-01020 gene deletion, method and application

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a gene-deleted attenuated African swine fever virus strain, a method and application, in particular to application of the attenuated African swine fever virus strain prepared by inhibiting ASFV-G-ACD-01020 gene expression in gene type II African swine fever viruses and deleting or conditionally knocking out ASFV-G-ACD-01020 genes. The sequence of the ASFV-G-ACD-01020 gene is as shown in SEQ ID NO. 4; the prepared African swine fever virus strain ASFV 01020i is completely attenuated to pigs, immunized pigs do not have typical ASF clinical symptoms, 100% immune protection can be provided for attack of ASFV CN / GS / 2018 virulent strains, and the African swine fever virus strain ASFV 01020i can be used as a candidate vaccine for safely and effectively preventing and controlling ASF epidemic situations and has great social value.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to an attenuated African swine fever virus strain with deletion of the ASFV-G-ACD-01020 gene, a method and an application thereof. Background Art

[0003] At present, the preparation of African swine fever vaccines mainly adopts three methods: one is to directly inactivate the original African swine fever virus to obtain an inactivated vaccine; the second is to screen out virus proteins that can effectively induce immune responses, and then prepare subunit vaccines and live vector vaccines; the third is to use gene deletion means to obtain recombinant virus vaccines after knocking out genes related to virulence or replication. The first method is the most commonly used and direct method for preparing virus vaccines. However, since African swine fever virus encodes proteins such as immunosuppression, immune tolerance, and antibody-dependent enhancement (ADE), the inactivated vaccine cannot cause effective immune protection in immunized pigs; at the same time, due to the complex structure of African swine fever virus, the proteins that currently induce immune responses are not yet clear, and the antigens obtained by the second method are not sufficient to induce strong immune protection. The most promising vaccine currently is the gene knockout vaccine. By knocking out virulence-related genes such as immunosuppression, tolerance, and ADE, a vaccine candidate strain that has both immunogenicity and can reduce pathogenicity and enable immunized pigs to obtain immune protection can be obtained. For example, Chinese Patent CN110551695A provides an African swine fever virus four-gene deletion attenuated strain, which is a four-gene deletion attenuated strain of African swine fever virus SY18 isolate, and its functional proteins of the following genes are deleted: the encoded product of the CD2v gene and the encoded products of three multigene family genes (MGF-360-12L, MGF-360-13L, MGF-360-14L). After immunizing piglets for 28 days and conducting a challenge test with the original ASFV virus, the results showed that all immunized pig groups obtained complete protection; another example is that Chinese Patent CN110093324B discloses a gene type II African swine fever virus with deletion of MGF-360-505R and a gene deletion virus with combined deletion of CD2V and MGF-360-505R. Both of these strains can provide 100% immune protection against the highly prevalent Chinese strain of African swine fever, and sufficient protection against strong virus challenge can be provided 21 days after immunization with these two gene deletion viruses. However, the genes knocked out in the above patents are all based on the reading frames with known functions of African swine fever virus.

[0004] There are 189 open reading frames in the ASFV Georgia 2007 / 1 strain. In addition to the open reading frames with known functions, there are 23 open reading frames with unknown functions, which are called "final genes" and have the following two characteristics: (1) They are relatively short, generally encoding no more than 64 amino acids; (2) There is no sequence similarity with any known genes. In addition, 11 of these 23 genes overlap with upstream or downstream genes. Currently, there is still no experimental evidence for the existence and function of such genes. Moreover, due to the small size of these genes and their close proximity to upstream and downstream genes, this transcriptional sequence may be part of the mRNA encoded by upstream and downstream genes. ASFV-G-ACD-01020 is a member of the "final genes", and there is currently no report on its research.

[0005] The present invention first discovers that inhibiting the expression of the ASFV-G-ACD-01020 gene or knocking out the ASFV-G-ACD-01020 gene in the parental African swine fever virus strain can obtain an attenuated strain. The attenuated strain, as a candidate vaccine strain, is completely attenuated for pigs, immunized pigs have no typical ASF clinical symptoms, and can provide 100% immune protection against the challenge of the virulent ASFV CN / GS / 2018 strain. It can be used as a candidate vaccine for the safe and effective prevention and control of ASF epidemics, and has great social value. Secondly, the present invention discovers that by constructing a conditional knockout fragment, conditional inhibition or knockout of the ASFV-G-ACD-01020 gene is achieved. The obtained attenuated strain can replicate normally under IPTG induction, enabling the production of the attenuated strain, while directly inhibiting the expression of the ASFV-G-ACD-01020 gene under the condition of no IPTG induction, and can be used as a safe and effective vaccine for production. Summary of the Invention

[0006] In view of the above technical problems, the first aspect of the present invention provides the application of preparing an attenuated African swine fever virus strain by inhibiting the expression of the ASFV-G-ACD-01020 gene, deleting or conditionally knocking out the ASFV-G-ACD-01020 gene in the genotype II African swine fever virus, and the sequence of the ASFV-G-ACD-01020 gene is as shown in SEQ ID NO.4.

[0007] The second aspect of the present invention provides the application of preparing an attenuated African swine fever vaccine by inhibiting the expression of the ASFV-G-ACD-01020 gene, deleting or conditionally knocking out the ASFV-G-ACD-01020 gene in the genotype II African swine fever virus, characterized in that the sequence of the ASFV-G-ACD-01020 gene is as shown in SEQ ID NO.4.

[0008] Preferably, the genotype II African swine fever virus is the ASFV CN / GS / 2018 isolate, which was deposited at the China Center for Type Culture Collection on December 21, 2020. The address of the depositary institution is Wuhan University, No. 16 Luojiashan Road, Wuchang District, Wuhan City, Hubei Province, China; the deposit number is CCTCC NO.V202096.

[0009] In a third aspect, the present invention provides an attenuated African swine fever virus strain, which includes, but is not limited to, a genotype II African swine fever virus strain with inhibited, deleted or conditionally knocked out ASFV-G-ACD-01020 gene expression. The genotype II African swine fever virus is the ASFV CN / GS / 2018 isolate, which was deposited at the China Center for Type Culture Collection on December 21, 2020, and the deposit number is CCTCC NO.V202096.

[0010] Preferably, the attenuated African swine fever virus strain is a genotype II African swine fever virus strain with inhibited, deleted or conditionally knocked out ASFV-G-ACD-01020 gene expression. The genotype II African swine fever virus is the ASFV CN / GS / 2018 isolate, which was deposited at the China Center for Type Culture Collection on December 21, 2020, and the deposit number is CCTCC NO.V202096.

[0011] Preferably, the attenuated African swine fever virus strain is a genotype II African swine fever virus strain with conditionally knocked out ASFV-G-ACD-01020 gene. The genotype II African swine fever virus is the ASFV CN / GS / 2018 isolate, which was deposited at the China Center for Type Culture Collection on December 21, 2020, and the deposit number is CCTCC NO.V202096.

[0012] In a fourth aspect, the present invention provides an attenuated African swine fever vaccine, which includes the above-mentioned attenuated African swine fever virus strain.

[0013] In a fifth aspect, the present invention provides a method for preparing the above-mentioned attenuated African swine fever virus strain. The method is to conditionally knock out the ASFV-G-ACD-01020 gene of the original genotype II African swine fever virus strain by genetic engineering means. The sequence of the ASFV-G-ACD-01020 gene is shown in SEQ ID NO.4. The genotype II African swine fever virus is the ASFV CN / GS / 2018 isolate, which was deposited at the China Center for Type Culture Collection on December 21, 2020, and the deposit number is CCTCC NO.V202096.

[0014] Preferably, it specifically includes the following steps:

[0015] (1) Insert the conditional knockout gene fragment into the expression vector to construct the pUC118-ASFV IPTG vector;

[0016] (2) Design the upstream and downstream sequences of the start codon of the ASFV-G-ACD-01020 gene as the left and right homologous recombination arms. By the method of Gibson ligation, clone the two homologous arms into the above pUC118-ASFV IPTG vector respectively. The left and right homologous recombination arms are located at the 5' end of the conditional knockout gene fragment and the 3' end including the ASFV-G-ACD-01020 gene respectively, and the homologous recombination transfer vector pUC118-LR-i01020-eGFP-lacI is obtained;

[0017] (3) Transfect the homologous recombination transfer vector pUC118-LR-i01020-eGFP-lacI into BMDM cells infected with the original genotype II African swine fever virus strain, and screen to obtain an attenuated African swine fever virus strain with conditional knockout of the ASFV-G-ACD-01020 gene.

[0018] Preferably, the expression vector in step (1) is selected from any one or its variants of pUC18, pUC19, pUC57, pUC118, pUC119, pCA, pCK, pCC, pCC1, but is not limited to any one or its variants of pUC18, pUC19, pUC57, pUC118, pUC119, pCA, pCK, pCC, pCC1.

[0019] Preferably, step (1) is as follows: The pUC118 vector is digested with EcoRI and HindIII restriction endonucleases, and the backbone fragment is recovered; then the lac repressor gene expression element, the lac operator gene expression element, and the selectable marker gene expression element are simultaneously ligated into the backbone fragment of pUC118 to obtain the pUC118-ASFV IPTG vector; in the vector, from left to right are the p72 promoter, the eGFP gene, the U104L promoter, the lac repressor expression gene, the p72 promoter, and the lac operator expression gene.

[0020] In the eighth aspect, the present invention provides an attenuated African swine fever virus strain obtained by the method described above.

[0021] In the ninth aspect, the present invention provides the application of the attenuated African swine fever virus strain in the preparation of African swine fever vaccines.

[0022] The beneficial effects of the present invention are as follows: First, the present invention first discovered that inhibiting the expression of the ASFV-G-ACD-01020 gene or knocking out the ASFV-G-ACD-01020 gene in the parental African swine fever virus strain can obtain a attenuated strain. The attenuated strain, as a candidate vaccine strain, is completely attenuated for pigs, immunized pigs have no typical ASF clinical symptoms, and can provide 100% immune protection against the challenge of the virulent strain ASFV CN / GS / 2018. It can be used as a candidate vaccine for safe and effective prevention and control of ASF epidemic, and has great social value. Second, the present invention found that by constructing a conditional knockout fragment, conditional inhibition or knockout of the ASFV-G-ACD-01020 gene can be achieved. The obtained attenuated strain can replicate normally under IPTG induction, which does not affect the production of the attenuated strain, while under the condition of no IPTG induction, it can directly inhibit the expression of the ASFV-G-ACD-01020 gene and can be used as a safe and effective production vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the conditional knockout strategy of the African swine fever virus ASFV-G-ACD-01020 gene

[0024] Figure 2 Identification diagram of ASFV-G-ACD-01020 protein expression

[0025] Figure 3 Fluorescence results after transfection of the vector pUC118-LR-i01020-eGFP-lacI into BMDM infected with ASFV

[0026] Figure 4 Schematic diagram of the purity detection of the conditional knockout strain of the ASFV-G-ACD-01020 gene

[0027] Figure 5 Infection situation of the conditional knockout strain of the ASFV-G-ACD-01020 gene (ASFV 01020i) in the presence / absence of IPTG

[0028] Figure 6 Detection of the transcriptional expression results of the ASFV-G-ACD-01020 gene, p30 and p72 in the conditional knockout strain of the ASFV-G-ACD-01020 gene (ASFV 01020i) in the presence and absence of IPTG

[0029] Figure 7 Survival rate result diagram of experimental pigs after immunization with the conditional knockout strain of the ASFV-G-ACD-01020 gene (ASFV 01020i) and challenge with the parental virus

[0030] Where the abscissa is the immunization time and the challenge time respectively, and the ordinate is the survival rate;

[0031] Figure 8 Graph of body temperature changes in experimental pigs after immunization with the conditional knockout strain of ASFV-G-ACD-01020 gene (ASFV 01020i)

[0032] Each curve represents an animal. The abscissa represents the immunization time and the challenge time respectively, and the ordinate represents the body temperature;

[0033] Figure 9 Graph of virus-carrying results in the blood of experimental pigs after immunization with the conditional knockout strain of ASFV-G-ACD-01020 gene (ASFV 01020i) and challenge with the parental virus

[0034] Figure 10 Graph of survival rate results of experimental pigs after challenge with the parental virus 20 days after immunization with the conditional knockout strain of ASFV-G-ACD-01020 gene (ASFV 01020i)

[0035] The abscissa represents the immunization time and the challenge time respectively, and the ordinate represents the survival rate;

[0036] Figure 11 Graph of body temperature changes in experimental pigs after challenge with the parental virus 20 days after immunization with the conditional knockout strain of ASFV-G-ACD-01020 gene (ASFV 01020i)

[0037] Each curve represents an animal. The abscissa represents the immunization time and the challenge time respectively, and the ordinate represents the body temperature; Specific implementation manners

[0038] To make the technical means, creative features, achieved purposes and functions of the present invention easy to understand, the present invention will be further described below in conjunction with specific implementation manners. However, the protection scope of the present invention is not limited to the following examples.

[0039] The experiments described in the following examples obtained biosafety permits and African swine fever laboratory activity permits:

[0040] According to the relevant requirements of biosafety level 3 laboratory (BSL-3) and African swine fever-related biosafety, the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences reported step by step to the Biosafety Committee of the Lanzhou Veterinary Research Institute, the Experimental Animal Ethics Committee, the Biosafety Committee of the Chinese Academy of Agricultural Sciences, the Experimental Animal Ethics Committee of the Lanzhou Veterinary Research Institute, and the Biosafety Committee of the Lanzhou Veterinary Research Institute, and obtained the permission from the Ministry of Agriculture and Rural Affairs to conduct research on highly pathogenic ASFV pathogens and animals, and has been filed with the Ministry of Agriculture and Rural Affairs, meeting the requirements of national biosafety levels.

[0041] The sources of experimental cells, viruses and plasmids described in the following examples:

[0042] Primary porcine alveolar macrophages (PAM) and primary bone marrow-derived macrophages (BMDM) were obtained from healthy SPF Bama miniature pigs aged 2 - 4 months. After aseptically collecting the cells, red blood cell lysis buffer (purchased from Biosharp) was used to remove red blood cells. After low-speed centrifugation, the supernatant was discarded, and the cell pellet was resuspended in RPMI 1640 complete medium (purchased from Gibco) containing 10% FBS (purchased from PAN), and placed in an incubator at 37°C and 5% CO 2 for culture. The culture of BMDM cells requires the additional addition of recombinant porcine GM-CSF (purchased from R&D Systems) at a final concentration of 10 ng / mL in RPMI 1640 complete medium, and was induced in an incubator at 37°C and 5% CO 2 for culture. The cells were washed every 2 - 3 days. The non-adherent cells were centrifuged and then re-added to a new cell dish, and the medium was changed for continued induction. After 5 - 7 days, the cells were cryopreserved or used. PAM cells were used to amplify ASFV and perform virus titer determination, and BMDM cells were used for plasmid transfection and virus recombination experiments.

[0043] The African swine fever virus strain ASFV CN / GS / 2018 of genotype II was from the National African Swine Fever Regional Laboratory (Lanzhou), belonging to genotype II, with a virus titer of 5×10 7 TCID 50 / mL. It was the 4th generation seed virus after amplification in PAM cells, and was deposited at the China Center for Type Culture Collection on December 21, 2020, with the deposit number CCTCC NO: V202096; deposit address: Wuhan University, Wuhan, China; contact phone number: 027 - 68752319; hereinafter referred to as the ASFV CN / GS / 2018 isolate in the following examples.

[0044] In the following examples, the ASFV CN / GS / 2018 isolate of genotype II African swine fever virus was used as an example to construct a recombinant virus strain with the ASFV-G-AC D-01020 gene knocked out, and a candidate attenuated African swine fever vaccine strain with high safety and complete immunity was obtained. However, it is not limited to the ASFV CN / GS / 2018 isolate. Using other genotype II African swine fever virus strains as parental viruses, conditional induction of knocking out the ASFV-G-ACD-01020 gene can also obtain a candidate attenuated African swine fever vaccine strain with high safety and complete immunity. Taking the ASFV CN / GS / 2018 isolate of genotype II African swine fever virus as an example, the ASFV-G-ACD-01020 gene is located at positions 91510-91668 of the full-length sequence of the ASFV CN / GS / 2018 isolate, and the sequence of the ASFV-G-ACD-01020 gene is shown in SEQ ID NO.4; the protein sequence encoded by the ASFV-G-ACD-01020 gene is shown in SEQ ID NO.5.

[0045] The pUC118 vector was purchased from Lanzhou Ribolai Biotechnology Co., Ltd.

[0046] The operations in the experiment are all operation methods known in the art if not otherwise specified.

[0047] In the following examples, in order to facilitate the subsequent purification of the virus, while synthesizing the regulatory sequence, an eGFP gene screening marker element expressed by the p72 promoter was also synthesized. However, it is not limited to the eGFP gene screening marker, and other screening marker genes used in the field of genetic engineering are applicable. The screening marker is preferably a fluorescent protein.

[0048] Although in this example, specific homologous recombination arm sequences (LA, the sequence is shown in SEQ ID NO.6; and RA, the sequence is shown in SEQ ID NO.7) were selected from the upstream and downstream sequences of the start codon of the ASFV-G-ACD-01020 gene, on the basis of not knocking out the upstream and downstream genes of the target gene and not destroying the integrity of the target gene sequence (including the start codon of the target gene), the homologous recombination arm sequences can be selected. The selection of the homologous recombination arm sequences can be achieved as long as the following aspects are met: the LA is selected from the complementary sequence of a 900bp fragment downstream of the start codon of the ASFV-G-ACD-01020 gene, including the start codon of the ASFV-G-ACD-01020 gene; the RA is selected from a 900bp fragment downstream of the stop codon of the ASFV-G-ACD-01020 gene, excluding the stop codon of the ASFV-G-ACD-01020 gene.

[0049] An operon refers to the general term for a promoter gene, an operator gene, and a series of closely linked structural genes, and is a functional unit of transcription. The lac operon described in the present invention, namely the lactose operon, is an operon responsible for the transport and metabolism of lactose in Escherichia coli and other Enterobacteriaceae bacteria.

[0050] A repressor belongs to a regulatory gene. In an inducible expression system, when its expression product binds to the operon gene, RNA polymerase cannot pass through the operator gene, thus hindering the synthesis of messenger ribonucleic acid and preventing the synthesis and expression of the enzyme; when the expression product of the lac repressor described in the present invention binds to the Escherichia coli lactose operon, RNA polymerase cannot pass through the operator gene, thus hindering the synthesis of messenger ribonucleic acid and preventing the synthesis and expression of the gene; among them, an inducer (such as IPTG) can bind to the lac repressor to inactivate the lac repressor, inhibit its binding to the lac operon gene, relieve the inhibition of the lac operon, and enable the normal synthesis and expression of the target gene.

[0051] A homologous recombination arm generally refers to the flanking sequences on both sides of the exogenous sequence to be inserted on the targeting vector that are identical to the genomic sequences, and is the region for recognition and recombination.

[0052] A plasmid is a very small circular DNA molecule that can replicate autonomously outside the cell chromosome. The plasmid constructed in the present invention containing the conditional knockout fragment can recombine with the viral genome after transfection into the cell, and regulate the expression of the ASFV-G-ACD-01020 gene through conditional induction, thereby achieving the knockout of the ASFV-G-ACD-01020 gene.

[0053] The method of gene deletion generally refers to gene knockout, which is an exogenous DNA introduction technique in which a DNA fragment containing a certain known sequence undergoes homologous recombination with a gene in the receptor cell genome that is the same or similar in sequence, integrates into the receptor cell genome, and is expressed. The methods of gene knockout generally include: homologous recombination technology, random insertion mutation technology, and RNA interference technology; among them, homologous recombination technology is also called gene targeting, which refers to the method of recombining between an exogenous DNA and a homologous sequence on the receptor cell chromosomal DNA and integrating it into a predetermined position, thereby changing certain genetic characteristics. The purpose of recombination is to knockout a certain gene; random insertion mutation technology refers to using certain viruses, bacteria, or other gene vectors that can randomly insert into gene sequences to create a cell library with random insertion mutations in the target cell genome, and then screening through corresponding markers to obtain the corresponding gene knockout cells; RNA interference technology is a reverse genetics technology in which the degradation of target mRNA is specifically triggered by double-stranded RNA homologous to the endogenous target gene mRNA in the organism, resulting in the silencing of the expression of the target gene.

[0054] The term "vaccine" refers to a biological agent that can provide a protective response in an animal, where the vaccine has been delivered and does not cause severe disease. The African swine fever vaccine of the present invention further optionally comprises one or more adjuvants, excipients, carriers, and diluents. The adjuvant can be any suitable adjuvant, such as chemical immune adjuvants like aluminum hydroxide, Freund's adjuvant, mineral oil, Span, etc.; microbial immune adjuvants like mycobacteria, lipopolysaccharide, muramyl dipeptide, muropeptides, liposoluble wax D, Corynebacterium parvum; plant immune adjuvants are mostly polysaccharides extracted from plants or macrofungi, such as pachymaran, carthamus tinctorius polysaccharide, Chinese herbal medicines, etc. And biochemical immune adjuvants like thymosin, transfer factor, interleukin, etc. Preferred adjuvants can be nano adjuvant biological adjuvants, interleukin, interferon, etc.

[0055] The African swine fever vaccine disclosed in the present invention can also be used to prepare combined vaccines, such as in combination with other vaccines for pigs, but with a focus on live attenuated vaccines, especially the integration of viral genes, such as bivalent vaccines, trivalent vaccines, etc. The combined vaccine can contain multiple live attenuated non-African swine fever viruses of different genotypes, so as to induce cross-protective immune responses against multiple non-African swine fever virus genotypes.

[0056] The administration of the African swine fever vaccine of the present invention can be carried out by convenient routes, such as intramuscular injection, intranasal, oral, subcutaneous, transdermal, and vaginal routes, etc. The live attenuated vaccine of the present invention is preferably administered by intramuscular injection. The vaccine can be administered after a prime-boost regimen. For example, after the first vaccination, the subject can receive a second booster administration after a period of time (such as about 7, 14, 21, or 28 days). Usually, the dose of the booster administration is the same or lower than the dose of the prime administration. In addition, a third booster immunization can also be carried out, such as 2 - 3 months, 6 months, or one year after immunization.

[0057] In the present invention, although the African swine fever attenuated strain with conditional knockout of the ASFV-G-ACD-01020 gene was constructed using the gene type II African swine fever virus strain ASFV CN / GS / 2018 isolate as an example, the present invention is not limited to the ASFV CN / GS / 2018 isolate. It is well known to those skilled in the art that after conditional deletion of related genes in different ASFV genomes, the observed phenotypic differences are related to the gene composition; and the currently prevalent gene type II African swine fever viruses (including China / 2018 / AnhuiXCGQ, Pig / CN / HLJ / 2018, Georgia 2007, ASFV-SY18, ASFV / POL / 2015 / Podlaskie, ASFV / Pol17_05838_C220, ASFV / Pol16_29413-o23, ASFV / Pol16_20538_o9, ASFV / Pol17_04461_C210, ASFV / Pol16_20186_o7, ASFV / Pol17_03029_C201, ASFV / Pol16_20540_o10, ASFV CzechRepublic 2017 / 1, ASFV Moldova 2017 / 1, ASFV Belgium 2018 / 1, ASFV Germany 2020 / 1, ASFVArm / 07 / CBM / c2, ASFV Ken.rie1, ASFV Wuhan 2019-2, ASFV_HU_2018, ASFV / pig / China / CAS19-01 / 2019) have exactly the same gene composition as the gene type II African swine fever virus ASFV CN / GS / 2018 isolate described in the present application. Therefore, on the basis of the same gene composition of the gene type II African swine fever virus, those skilled in the art can reasonably infer that in addition to the ASFV CN / GS / 2018 isolate described in the present invention, the above-mentioned other type II African swine fever viruses can also be used as the starting virus strains to successfully construct the relevant attenuated African swine fever virus strains and vaccines.

[0058] Example 1 Construction of the conditional knockout strain (ASFV 01020i) of the ASFV-G-ACD-01020 gene

[0059] 1. Construction of the conditional knockout homologous recombination transfer vector of the ASFV-G-ACD-01020 gene

[0060] (1) Gene synthesis

[0061] Synthesize the coding lac repressor gene sequence (shown in SEQ ID NO.2) and the gene sequence encoding the lac operon (shown in SEQ ID NO.3); simultaneously synthesize the lac repressor gene element (shown in SEQ ID NO.2) initiated by the U104L promoter (shown in SEQ ID NO.8) and the lac operon gene element (shown in SEQ ID NO.3) initiated by the p72 promoter (shown in SEQ ID NO.9).

[0062] (2) Screening expression cassette construction

[0063] To facilitate subsequent purification of the virus, while synthesizing the regulatory sequence, we synthesized the eGFP gene screening marker element expressed by the p72 promoter (shown in SEQ ID NO.9), and the sequence of the eGFP gene screening marker element expressed by the p72 promoter is as shown in SEQ ID NO.1.

[0064] (3) Construction of homologous recombination transfer vector

[0065] The pUC118 vector was digested with EcoRI and HindIII restriction endonucleases, and the backbone fragment was recovered; then the lac repressor gene expression element lacI, the lac operon gene expression element lacO, and the eGFP screening marker element synthesized in step (1) were simultaneously ligated into the backbone fragment of pUC118 to obtain the pUC118-ASFV IPTG vector; in this vector, from left to right are the p72 promoter (p72 promoter, the sequence is as shown in SEQ ID NO.9), the eGFP gene, the U104L promoter (U104L promoter, the sequence is as shown in SEQ ID NO.8), the lac repressor expression gene (lacI), the p72 promoter (p72 promoter, the sequence is as shown in SEQ ID NO.9), and the lac operon expression gene (lac operator);

[0066] Design the upstream and downstream sequences of the start codon of the ASFV-G-ACD-01020 gene as homologous recombination arms (LA, the sequence is as shown in SEQ ID NO.6; and RA, the sequence is as shown in SEQ ID NO.7). By the method of Gibson ligation, the two homologous arms were respectively cloned into the left side of the eGFP screening marker element and the right side of the lac operon gene expression element lacO in the above pUC118-ASFV IPTG vector, and the homologous recombination transfer vector pUC118-LR-i01020-eGFP-lacI for conditional knockout of the ASFV-G-ACD-01020 gene was obtained.

[0067] The specific construction strategy is asFigure 1 as shown, where lacI shown in the figure is the lac repressor expression gene.

[0068] The protein expression identification diagram of ASFV-G-ACD-01020 is obtained as Figure 2 shown.

[0069] In this example, although specific homologous recombination arm sequences (LA, the sequence is as shown in SEQ ID NO.7; and RA, the sequence is as shown in SEQ ID NO.8) are selected from the upstream and downstream sequences of the start codon of the ASFV-G-ACD-01020 gene, on the basis of not knocking out the upstream and downstream genes of the ASFV-G-ACD-01020 gene and not destroying the integrity of the ASFV-G-ACD-01020 gene sequence, the homologous recombination arm sequences can be selected, and the selection of the homologous recombination arm sequences can be achieved as long as the following aspects are met: the LA includes all the sequences of the promoter of the ASFV-G-ACD-01020 gene, and / or part or all of the sequences of the upstream gene of the ASFV-G-ACD-01020 gene, and the end point at the 5' end of the LA sequence is selected from the start codon of the ASFV-G-ACD-01020 gene; the RA is the right homologous recombination arm sequence downstream of the ASFV-G-ACD-01020 gene, and the 5' end of the RA starts from the stop codon of the ASFV-G-ACD-01020 gene (excluding the stop codon).

[0070] 2. Cell transfection and recombinant virus screening

[0071] Resuscitate BMDM cells and seed them in 6-well plates (about 10 6 cells / well), and use DNA transfection reagent to transfect the homologous recombination transfer vector pUC118-LR-iASFV-G-ACD-01020-eGFP-lacI prepared in 1 above. Add 500 μl buffer, 2 μg recombinant plasmid, and 6 μl transfection reagent into an EP tube, mix well and let it stand for 10 min, then add it into the six-well plate.

[0072] 6 hours after transfection, discard the complete culture medium used for transfection and replace it with a complete medium containing IPTG. Directly infect BMDM cells with the ASFV CN / GS / 2018 virus strain (MOI = 1). Do not change the medium after infection. After 48 hours, observe the number of fluorescent cells under a fluorescence microscope and take pictures. After culturing with a complete medium containing IPTG, a large amount of fluorescence expression can be observed, indicating that the suspected recombinant virus has successfully infected the cells ( Figure 3) Pick a single fluorescent cell and inoculate it into the BMDM cells in a 96-well plate that has been pre-coated and cultured with complete medium containing IPTG (the final concentration of IPTG in the medium is 1.25 mM). Observe once every 24 hours. Observe the wells with fluorescent cells, and continue to pick newly emerged fluorescent cells and inoculate them again into the BMDM cells in a 96-well plate that has been pre-coated and cultured with complete medium containing IPTG (the final concentration of IPTG in the medium is 1.25 mM). Screen several times in this way.

[0073] 3. Identification of gene knockout results

[0074] When the fluorescent cells are selected to the 7th or 8th generation, extract the genomic DNA of wild ASFV and recombinant ASFV using a viral genome extraction kit (purchased from Beijing TianGen Biotech Co., Ltd.). Use the primers on wild ASFV (WT-ASFV-F: ACCATCTGTTGAAACCTGATGGTT; WT-ASFV-R: AGAAACTGTGTACAACCTATCCGA) and the primers on the recombinant element (ASFV 01020i-F: ACCATCTGTTGAAACCTGATGGTT; ASFV 01020i-R: GGTGGTGCAGATGAACTTCA) to perform PCR identification on their purity.

[0075] The results of purity detection are as Figure 4 shown. The recombinant element of ASFV 01020i can be detected in the F8 deletion virus of the eighth generation. There is no wild virus in the eighth generation F8, indicating that the IPTG conditional induction ASFV-G-ACD-01020 gene knockout strain has been constructed and purified successfully. And it is named ASFV 01020i.

[0076] The infection situation of the ASFV-G-ACD-01020 gene knockout strain (ASFV 01020i) in the presence / absence of IPTG is shown in Figure 5 , in the presence of IPTG, ASFV 01020i can infect BMDM normally and replicate. In the absence of IPTG, ASFV 01020i can infect BMDM normally but does not replicate.

[0077] In addition, the results of ASFV-G-ACD-01020 gene expression detection are as Figure 6As shown, in the presence or absence of IPTG, there was no effect on P72 and P30 (infection 18h), while there were differences in the expression of the ASFV-G-ACD-01020 gene, further indicating that the constructed ASFV-G-ACD-01020 gene conditional knockout strain (ASFV 01020i) achieved conditional knockout of the ASFV-G-ACD-01020 gene in the absence of IPTG, and obtained the recombinant virus with conditional gene knockout of ASFV-G-ACD-01020.

[0078] Example 2 Determination of virus titer

[0079] The titer of African swine fever virus was measured by 50% haemadsorption (HAD 50 ) indicates that HAD 50 The specific experimental procedures were described in the literature (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, Gladue DP. Development of a highly effective African swine fever virus vaccine by deletion of the I177L gene results in sterile immunity against the current epidemic Eurasia strain. J Virol. 2020. pii: JVI.02017-19), and appropriate adjustments were made to the experiments: approximately 1 × 10 5 / well cells were inoculated with primary PAM cells, and the ASFV-G-ACD-01020 gene conditional knockout strain (ASFV01020i) to be tested was diluted 10 times in a series of 7 dilutions, 8 wells at each dilution, and the diluted virus was added to the 96-well plate PAM at 100μL / well, followed by the addition of red blood cells, and repeated three times in total. Virus infection can be determined based on the rosettes formed by the aggregation of red blood cells around infected cells. The observation was continued for 6 days, and the number of positive wells was counted to calculate the half hemocyte adsorption capacity (HAD 50 ). If the titer is qualified, pathogenicity evaluation is performed.

[0080] Example 3 Virulence Evaluation of ASFV-G-ACD-01020 Gene Conditional Knockout Strain (ASFV 01020i)

[0081] To detect the virulence of the ASFV-G-ACD-01020 gene conditional knockout strain (ASFV 01020i), in this experiment, 10 4 HAD 50 doses were intramuscularly injected into piglets to evaluate its virulence.

[0082] In this experiment, 12 healthy Landrace piglets negative for African swine fever antigen and antibody were divided into 2 groups. Among them, 9 piglets were in the immunization group with the ASFV-G-ACD-01020 gene conditional knockout strain (ASFV 01020i), and 6 piglets were in the challenge group with the ASFV CN / GS / 2018 isolate. After immunization, the body temperature changes were measured daily, peripheral blood and saliva were collected. Referring to the literature (King DP, Reid SM, Hutchings GH, Grierson SS, Wilkinson PJ, Dixon LK, Bastos AD, Drew TW. 2003. Development of a TaqMan PCR assay with internal amplification control for the detection of African swine fever virus. J Virol Methods 107:53-61), and the ASFV virus content in the blood was determined by real-time fluorescence quantitative PCR method, and the detection was terminated at 20 days. The lethality rates of the animals in the immunization group and the challenge group were statistically analyzed (see Figure 7 ), and the body temperature change results (see Figure 8 ). The results showed that after intramuscular injection of the ASFV-G-ACD-01020 gene conditional knockout strain (ASFV 01020i), the body temperatures of the pigs in the immunization group were normal, no persistent high fever occurred, and no deaths occurred, and the survival rates were all 100%.

[0083] The detection results of the ASFV virus content in the blood are as shown in Figure 9 (immunization part). After injection of the ASFV-G-ACD-01020 gene-deleted recombinant virus, a small amount of virus was detected in the blood of the pigs in the immunization group 5 days after immunization; while the blood virus content of the pigs in the challenge control group was very high, and all died on the 7th day. These experimental results indicate that after conditional knockout of the ASFV-G-ACD-01020 gene in the parental ASFV CN / GS / 2018 isolate, resulting in the loss of the function of the protein encoded by the ASFV-G-ACD-01020 gene, the virulence of the obtained ASFV-G-ACD-01020 gene conditional knockout strain (ASFV 01020i) was completely attenuated and had good safety.

[0084] Evaluation of the Immunoprotective Effect of the Conditional Knockout Strain of ASFV-G-ACD-01020 Gene (ASFV 01020i)

[0085] To detect the immunoprotective effect of the conditional knockout strain of ASFV-G-ACD-01020 gene (ASFV 01020i), in this experiment, 10 2 HAD 50 doses of the parental ASFV CN / GS / 2018 isolate were used to conduct a challenge experiment on the immunized pigs (9 pigs) immunized with the conditional knockout strain of ASFV-G-ACD-01020 gene (ASFV 01020i) in Example 3 and the non-immunized control pigs (5 pigs).

[0086] After challenge, the body temperature changes were measured daily, peripheral blood was collected, and the observation was terminated at 17 days. The survival rate results are as Figure 10 shown, where the abscissa is the challenge time and the ordinate is the survival rate. After challenge with the parental ASFV CN / GS / 2018 isolate, the survival rate of the immunized pigs was 100%, while all the control pigs died on the 6th day after challenge. The body temperature change results are as Figure 11 shown. Two pigs in the immunized group showed typical symptoms of fever, while the body temperature of the control pigs increased sharply after challenge and all died on the 6th day after challenge. The above results indicate that after challenge with the parental ASFV CN / GS / 2018 isolate, the body temperature of the pigs in the immunized group with the ASFV-G-ACD-01020 gene-deleted recombinant virus was normal and the survival rate was 100%, that is, the conditional knockout strain of ASFV-G-ACD-01020 gene (ASFV 01020i) has complete immunoprotective effect against the parental ASFV CN / GS / 2018 isolate.

[0087] In summary, the present invention first discovers that inhibiting the expression of ASFV-G-ACD-01020 gene or knocking out ASFV-G-ACD-01020 gene in the parental African swine fever virus strain can obtain a attenuated strain. The attenuated strain, as a candidate vaccine strain, is completely attenuated to pigs, the immunized pigs have no typical ASF clinical symptoms, and can provide 100% immunoprotection against challenge with the virulent ASFV CN / GS / 2018 strain, and can be used as a candidate vaccine for safe and effective prevention and control of ASF epidemic, with great social value; secondly, the present invention discovers that by constructing a conditional knockout fragment, conditional inhibition or knockout of ASFV-G-ACD-01020 gene is achieved, and the obtained attenuated strain can replicate normally under IPTG induction without affecting the production of the attenuated strain, while directly inhibiting the expression of ASFV-G-ACD-01020 gene under the condition of no IPTG induction, and can be used as a safe and effective vaccine for production.

Claims

1. The use of preparing an attenuated African swine fever virus strain by inhibiting the expression of ASFV-G-ACD-01020 gene in genotype II African swine fever virus, deleting or conditionally knocking out the ASFV-G-ACD-01020 gene, characterized in that: The ASFV-G-ACD-01020 gene sequence is shown in SEQ ID NO.

4.

2. The use of preparing an attenuated African swine fever vaccine by inhibiting the expression of the ASFV-G-ACD-01020 gene in genotype II African swine fever virus, deleting or conditionally knocking out the ASFV-G-ACD-01020 gene, characterized in that: The ASFV-G-ACD-01020 gene sequence is shown in SEQ ID NO.

4.

3. The use according to claim 1 or 2, characterized in that: The genotype II African swine fever virus is the ASFV CN / GS / 2018 isolate, which was deposited in the China Center for Type Culture Collection on December 21, 2020, with the collection number CCTCCNO.V202096.

4. An attenuated African swine fever virus strain, characterized in that: The attenuated African swine fever virus strain includes but is not limited to a genotype II African swine virus strain with expression inhibition, deletion or conditional knockout of the ASFV-G-ACD-01020 gene. The genotype II African swine fever virus is an ASFV CN / GS / 2018 isolate, which was deposited in the China Center for Type Culture Collection on December 21, 2020, with the deposit number CCTCC NO.V202096.

5. The attenuated African swine fever virus strain according to claim 4, characterized in that The attenuated African swine fever virus strain is a genotype II African swine virus strain with suppressed, deleted or conditionally knocked out ASF VG-ACD-01020 gene expression. The genotype II African swine fever virus is the ASFV CN / GS / 2018 isolate, which was deposited in the China Center for Type Culture Collection on December 21, 2020, with the deposit number CCTCC NO.V202096.

6. The attenuated African swine fever virus strain according to claim 5, characterized in that The attenuated African swine fever virus strain is a genotype II African swine virus strain with conditional knockout of the ASF VG-ACD-01020 gene. The genotype II African swine fever virus is the ASFV CN / GS / 2018 isolate, which was deposited in the China Center for Type Culture Collection on December 21, 2020, with the preservation number CCTCC NO.V202096.

7. An attenuated African swine fever vaccine, characterized in that: The attenuated African swine fever vaccine comprises the attenuated African swine fever virus strain described in claim 4.

8. A method for preparing the attenuated African swine fever virus strain according to claim 5, characterized in that: The method described is to conditionally knock out the ASFV-G-ACD-01020 gene of the original genotype II African swine virus strain through genetic engineering means. The ASFV-G-ACD-01020 gene sequence is shown in SEQ ID NO.

4. The genotype II African swine fever virus is the ASFVCN / GS / 2018 isolate, which was deposited in the China Center for Type Culture Collection on December 21, 2020, with the preservation number CCTCC NO.V202096.

9. The method for attenuating African swine fever virus strains according to claim 7, characterized in that: The specific steps include: (1) Inserting the conditional knockout gene fragment into the expression vector to construct the pUC118-ASFV IPTG vector; (2) Designing the upstream and downstream sequences of the start codon of the ASFV-G-ACD-01020 gene as left and right homologous recombination arms, and cloning the two homologous arms into the above-mentioned pUC118-ASFV IPTG vector by Gibbs on ligation, wherein the left and right homologous recombination arms are located at the 5' end of the conditional knockout gene fragment and the 3' end including the ASFV-G-ACD-01020 gene, respectively, to obtain the homologous recombination transfer vector pUC118-LR-i01020-eGFP-lacI; (3) The homologous recombination transfer vector pUC118-LR-i01020-eGFP-lacI was transfected into BMDM cells infected with the original gene type II African swine virus strain, and the attenuated African swine fever virus strain with conditional knockout of the ASFV-G-ACD-01020 gene was screened.

10. Use of the attenuated African swine fever virus strain according to any one of claims 4 to 6 in the preparation of an African swine fever vaccine.

Images