Magnetic genetics system based on clMagR gene and application of magnetic genetics system in Parkinson's disease

Abstract

The invention discloses a magnetic genetics system based on a clMagR gene and application of the magnetic genetics system in Parkinson's disease. The invention aims to inject the clMagR gene into neurons through an adeno-associated virus (AAV) vector, and regulate and control the biological functions of cells or tissues in combination with exogenous iron and a magnetic field stimulation technology. Compared with optogenetics, the system has the advantages that optical fiber implantation and light source direct irradiation required by optogenetics are avoided through accurate control of an external magnetic field, the risk of invasive surgery is reduced, and the cell function of a deep nerve area, especially a deep brain area, can be more widely regulated in vivo. Compared with a traditional treatment method, the invention discloses a non-invasive and adjustable gene treatment strategy, provides a new technical normal form for the fields of stem cell treatment, nerve regeneration, drug delivery, illumination of a neural circuit mechanism of diseases and the like, and has relatively high application potential and wide preclinical research value.

Description

Technical Field

[0001] The present invention relates to a magnetogenetic system based on the clMagR gene and its application in Parkinson's disease, belonging to the field of magnetogenetic systems. Background Art

[0002] With the continuous advancement of gene therapy technology, gene delivery systems are playing an increasingly important role in the treatment of genetic diseases, tumors, and neurodegenerative diseases. In the field of neuroscience, the application of gene regulation technologies has become a new therapeutic approach. However, traditional gene therapy approaches often rely on chemical or physical methods for gene transduction, which are subject to a series of challenges, including low delivery efficiency, high immunogenicity, and poor targeting. Adeno-associated virus (AAV), a natural, non-pathogenic viral vector, has become an ideal vector for gene therapy due to its ability to efficiently and stably deliver genes to a variety of cell types and exhibit low immunogenicity. In particular, AAV vectors have shown broad application prospects in the treatment of neurodegenerative diseases, with their ability to precisely deliver target genes into neurons, particularly in deep brain regions such as the substantia nigra and striatum. However, AAV vector-based therapeutic approaches still lack the ability to precisely regulate cellular activity in real time, especially in deep neural regions. To overcome this problem, optogenetics, an emerging technology that uses light stimulation to precisely control gene expression or cellular activity, enables highly precise regulation of neurons. The core of this technology is to use light-sensitive proteins (such as channelrhodopsin, ChR2) to activate or inhibit neuronal activity under the irradiation of light of a specific wavelength. It is widely used in the fields of neuroregulation and neural circuit research in animal models. However, optogenetics also has certain limitations. The external light source is irradiated onto the target tissue or area implanted by the optical fiber to the cells, which limits its application in deep neural areas. Secondly, the complex illumination equipment and highly precise light source operation limit its widespread application in preclinical research.

[0003] Against this background, magnetogenetics technology has emerged. It uses an external magnetic field to regulate the activities of specific molecules or cells, and has the advantages of being non-invasive, convenient, and deeply controllable. Magnetogenetics technology can precisely regulate the functions of cells or tissues without the need for a light source by utilizing magnetic molecules to respond to changes in the external magnetic field. In particular, the clMagR protein synthesizes iron oxide nanoparticles by combining with iron ions. Under the action of an external magnetic field, it can change the direction of its magnetic moment, thereby triggering changes in the magnetic response and behavior of the particles. By precisely controlling the magnetic field, the arrangement and movement of these nanoparticles can be adjusted, thereby affecting the biological processes of cells or tissues, providing new ideas for the application of magnetogenetics. However, magnetogenetics technology is still in its early stages of development and faces many challenges, such as how to efficiently introduce the clMagR gene into target neurons, how to ensure a stable supply of exogenous iron ions in the body, and how to precisely control the effects of external magnetic fields on target cells. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a magnetogenetic system based on the clMagR gene and its application in Parkinson's disease, aiming to solve the problems of poor targeting and low regulation precision existing in traditional gene therapy methods. It is particularly suitable for the study of neural circuit mechanisms and the treatment of iron overload diseases, and can be widely used as a technical platform for neural repair and functional recovery.

[0005] Technical solution: In order to solve the above technical problems, the present invention provides the application of a clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1 or a plasmid (recombinant AAV plasmid) containing the clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1 in constructing a magnetogenetic system based on the clMagR gene.

[0006] The plasmid contains the hSyn promoter, the clMagR gene with a nucleotide sequence as shown in SEQ ID NO.1, and a fused immune detection marker and a fluorescent marker.

[0007] Among them, the construction method of the plasmid includes the following steps: fusing the clMagR gene with a nucleotide sequence as shown in SEQ ID NO.1 with an immune detection marker (such as a 3×FLAG tag) and a fluorescent marker GFP, optimizing the promoter (hSyn neuron-specific promoter) and the non-coding region to form the AAV plasmid that can efficiently express the clMagR gene and ensure its specificity and expression efficiency in neurons.

[0008] The present invention also provides a magnetogenetic system based on the clMagR gene, comprising a clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1 or a plasmid comprising the clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1.

[0009] The present invention also provides the use of a clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1, a plasmid containing the clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1, or the magnetogenetic system in preparing a kit or detection system for treating Parkinson's disease.

[0010] In the present invention, the construction of the recombinant AAV plasmid adopts the following strategy: First, the clMagR gene (nucleotide sequence is shown in SEQ ID NO.1) is inserted into the expression frame containing 3×FLAG immune detection tags and GFP fluorescent reporter genes by molecular cloning technology to form a clMagR-FLAG-GFP ternary fusion expression unit. This unit is further driven by the humanized hSyn (human Synapsin) neuron-specific promoter to ensure the targeted expression of the gene in neurons. In order to improve the expression efficiency, the non-coding regions of the plasmid (such as 5'UTR, 3'UTR and polyA signal sequence) were codon optimized and element screened. The experimental group plasmid finally obtained was named pAV200007-20240226002-1 (target gene vector, synthesized by Shandong Weizhen Biotechnology Co., Ltd.).

[0011] As a control, the present invention used a commercial AAV-hsyn-FLAG-GFP empty vector virus (Shandong Weizhen Biotechnology Co., Ltd., catalog number: pAV200007-20240226002-2). Its vector backbone is identical to that of the experimental group, lacking only the clMagR gene insert sequence. This control system design effectively eliminates interference from the vector components and reporter gene itself on experimental results, providing a benchmark for subsequent studies of neuronal transfection efficiency, specificity, and function.

[0012] The present invention further provides the use of the AAV plasmid in constructing a clMagR-based magnetogenetic regulatory system. Specific embodiments include:

[0013] 1. Viral vector design: The clMagR gene was fused with the Flag tag and the eGFP fluorescent protein to construct an expression framework (hSyn-clMagR-Flag-eGFP) driven by the hSyn neuron-specific promoter to ensure targeted and efficient gene expression in neurons;

[0014] 2. AAV virus packaging: The above AAV plasmids were co-transfected with helper plasmids (containing Rep / Cap genes) and adenovirus helper plasmid pHelper into HEK293T cells, and viral capsid assembly was completed using an intracellular system;

[0015] 3. Virus Purification and Validation: Recombinant AAV particles are isolated by CsCl gradient centrifugation or affinity chromatography, and the viral titer is determined. The resulting AAV-hSyn-clMagR-Flag-eGFP virus can be delivered to target neurons via targeted brain injection. Infection efficiency is tracked in real time using eGFP fluorescence, and protein expression is verified using the Flag tag.

[0016] This system provides a standardized tool for magnetogenetic regulation of neural circuits through the targeted expression of the magnetic-responsive protein clMagR.

[0017] Among them, the exogenous iron supply system is used to provide exogenous iron ions to target cells through injection or drug carrier form to ensure that the clMagR protein can bind iron ions to generate iron oxide nanoparticles.

[0018] The magnetic field is a rotating magnetic field generator (application number: 201810714550.8), constructed with a homemade, adjustable, mild 50mT rotating magnetic field. The magnetic stimulation device consists of a pair of cylindrical magnets axially mounted at either end of a rotating aluminum bracket. The magnetic field inside the cylindrical magnets is uniform, with a central magnetic field of 50mT. Changing the rotational speed of the aluminum bracket adjusts the magnetic field gradient. This device is used to apply an external rotating magnetic field or a constant magnetic field to precisely control the generated iron oxide nanoparticles, enabling non-invasive and precise control of deep neural regions, activating neurons and achieving functional recovery.

[0019] The iron oxide nanoparticles, generated by the clMagR protein in response to exogenous iron ions, exhibit magnetic responsiveness. Under external magnetic stimulation, the iron oxide nanoparticles produce a biological response, thereby regulating neuronal activity. This system can promote neural repair, activate neural function, and improve symptoms of neurodegenerative diseases.

[0020] Preferably, the neurological disease is Parkinson's disease.

[0021] Optimized design of the system: Optimizing the gene promoter and sequence design of the AAV vector to improve the clMagR gene expression efficiency in neurons: The present invention significantly enhances the mRNA translation efficiency by adding an efficient Kozak sequence before the ATG of the target gene, and at the same time fuses a 3×FLAG tag at the C-terminus of the target gene to accurately track protein expression and positioning. In addition, the promoter of the AAV vector is optimized, and a neuron-specific promoter (such as hSyn) is used to replace the traditional broad-spectrum promoter (such as CMV), which significantly improves the expression efficiency of the gene in neurons, and further enhances the transduction and expression levels by improving the non-coding sequence of the vector and using an efficient serotype (such as AAV9). Compared with traditional systems that do not add Kozak sequences, do not fuse 3×FLAG tags, use non-neuron-specific promoters and do not optimize vectors, the system of the present invention shows significant advantages in gene expression efficiency, neuron specificity and protein detection convenience, providing a more efficient technical platform for related research; adjusting the dosage and release rate of exogenous iron to ensure the effective generation of iron oxide nanoparticles.

[0022] The present invention also provides a magnetogenetic system based on the clMagR gene, which contains the AAV plasmid.

[0023] The present invention also provides use of the AAV plasmid or magnetogenetic system in preparing a kit or detection system for treating Parkinson's disease.

[0024] The application also includes exogenous iron and magnetic field stimulation systems.

[0025] The magnetic field stimulation system includes a mild rotating magnetic field. The present invention synthesizes iron oxide nanoparticles through the action of exogenous iron ions and precisely regulates cell functions in combination with external magnetic field stimulation.

[0026] The application includes the following steps:

[0027] (1) Using AAV virus to transduce the clMagR gene into target neurons, causing them to express the iron-sulfur cluster protein clMagR in neurons;

[0028] (2) providing the exogenous iron to the patient to ensure that sufficient iron ions are generated in the body to support the magnetic induction effect of the clMagR protein;

[0029] (3) Using a magnetic field stimulation system, magnetic regulation is performed on deep neural areas in the body to improve the effect of neural repair and promote the recovery of neural function.

[0030] The present invention also provides a kit or detection system for treating Parkinson's disease, which contains the AAV plasmid according to claim 1 or the magnetogenetic system according to claim 4.

[0031] It also contains exogenous iron and magnetic field stimulation systems.

[0032] Principle of the present invention: The clMagR gene is injected into neurons through an adeno-associated virus (AAV) vector, and combined with exogenous iron and magnetic field stimulation technology to regulate the biological functions of cells or tissues. The system consists of three key components: an AAV vector system, an exogenous iron supply system, and a magnetic field stimulation system. First, the AAV vector system efficiently delivers the clMagR gene to neurons through adeno-associated virus (AAV), causing them to express the iron-sulfur cluster protein clMagR. Secondly, the exogenous iron supply system ensures that sufficient iron ions are provided in the body. After these iron ions bind to the clMagR protein, they promote its synthesis of iron oxide nanoparticles. In this way, the iron oxide nanoparticles formed can sense and respond to magnetic field changes under the action of an external magnetic field. Finally, the magnetic field stimulation system activates these iron oxide nanoparticles through precise regulation of the external magnetic field, thereby regulating the biological processes of neurons and promoting neural repair and functional recovery. This method can promote neural repair or functional recovery by precisely regulating neuronal activity in the treatment of the neurodegenerative disease Parkinson's disease.

[0033] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: Compared with optogenetics, the system of the present invention has a significant advantage, namely, through the precise control of the external magnetic field, it avoids the optical fiber implantation and direct irradiation of the light source required for optogenetics, reduces the risk of invasive surgery, and can more widely regulate the cell function of deep neural regions in the body, especially in the deep brain region. Compared with traditional treatment methods, the present invention provides a non-invasive, controllable gene therapy strategy, which provides a new technical paradigm for the fields of stem cell therapy, neural regeneration, drug delivery, and elucidation of the neural circuit mechanism of diseases. It has high application potential and extensive preclinical research value, especially in the treatment of neurodegenerative diseases. It has important application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the map of AAV plasmid 5;

[0035] Figure 2 For the verification of AAV plasmid;

[0036] Figure 3 hSyn-clMagR-Flag-eGFP and detect expression efficiency;

[0037] Figure 4 The calculation of QSM based on MRI images of substantia nigra neurons was used to detect the synthesis of iron oxide;

[0038] Figure 5 is the firing rate of substantia nigra neurons at the moment of magnetic stimulation;

[0039] Figure 6 This is the statistics of the number of tyrosine hydroxylase (TH)-positive neurons in the substantia nigra after the end of magnetic stimulation. DETAILED DESCRIPTION

[0040] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0041] Example 1 Construction of hSyn-clMagR-Flag-eGFP and detection of expression efficiency

[0042] In order to evaluate the expression efficiency of the constructed hSyn-clMagR-Flag-eGFP expression framework, high titer AAV virus (10 12 vg / mL) and low titer AAV virus (10 11 vg / mL) were injected into the substantia nigra region of C57BL / 6 mice.

[0043] 1. Gene modification: A Kozak sequence (GCCACCATG) was introduced into the 5' end of the clMagR gene (NCBI: NC_088642.1) to enhance translation efficiency, and a 3×FLAG tag and eGFP fluorescent protein (NCBI: U55763.1) were fused to the C-terminus to form a clMagR-Flag-eGFP fusion unit. The sequence of the clMagR gene is shown in SEQ ID NO. 1:

[0044] gcgatcgccaccatggcctcgtcggcctcgtccgtggtgagggccacggtgcgcgccgtcagcaagcggaagatccaggctacgcgcgccgccctcaccctgaccccatcagctgttcag aagataaaagagcttcttaaagataaacctgagcatgtaggcgtgaaagtaggtgttcgcacaagaggatgcaatggactttcttacacattagaatatacaaaatcaaaaggagactct gatgaagaagtagttcaagatggggttagagtgtttattgagaagaaggcacagctgacgcttttaggcactgaaatggactatgtagaagacaaactgtccagtgaatttgtcttcaat aatccaaacatcaaaggaacatgtggctgtggagaaagctttaacatcgattacaaagatcgacggggattataaggaccatgacatcgactataaggatgatgacgacaagacgcgt

[0045] 2. Expression framework assembly: The above units were inserted into the AAV vector backbone, driven by the hSyn neuron-specific promoter, to construct the hSyn-clMagR-Flag-eGFP expression plasmid (i.e., pAV200007-20240226002-1, see the structure for details). Figure 1 );

[0046] 3. Plasmid verification: Confirm the integrity of the plasmid by PCR, enzyme digestion and sequencing. The vector hSyn-clMagR-Flag-eGFP containing the above genes was digested with enzymes. The enzyme digestion system is shown in Table 1:

[0047] Table 1

[0048] Reaction solution components volume DNA fragments (0.1 μg / μL) 15 μL 10×Buffer 5μL AsiSI 1.5 μL MluI 1.5 μL <![CDATA[ddH2O]]> 17μL Total 40 μL

[0049] After adding the sample and mixing well, the mixture was placed at 37°C for 1 hour for enzyme digestion. After the reaction was completed, the size of the target enzyme-digested band was detected by 1% agarose gel electrophoresis, and the target fragment was recovered using a gel recovery kit.

[0050] The empty vector pAV-hSyn-P2A-mcherry was digested with the same enzyme system as shown in Table 2:

[0051] Table 2

[0052]

[0053]

[0054] After the vector pAV-hSyn-P2A-mcherry was digested with enzymes for 1 hour, 1 μL FASTAP (thermosensitive alkaline phosphatase) was added, and the reaction was continued for 15 minutes before the vector was recovered using a purification recovery kit.

[0055] 2. Connection

[0056] The recovered target gene fragment was ligated with the vector pAV-hSyn-P2A-mcherry that had been digested with the same enzymes. The ligation system is shown in Table 3:

[0057] Table 3

[0058] Element volume Destination fragment 2-6 μL Vector fragment 2-4 μL 10×T4 Buffer 1 μL T4 DNA ligase (10 U / μL) 1 μL Total 10 μL

[0059] After mixing, microcentrifuge and connect at 22℃ for 2h.

[0060] 3. Conversion

[0061] The ligation product was transformed into Escherichia coli DH5α competent cells and spread on LB plates with corresponding resistance for screening.

[0062] IV. Enzyme Digestion Verification

[0063] Pick a single colony, culture it, extract the plasmid, and perform enzyme digestion to identify the positive clone. The system is shown in Table 4:

[0064] Table 4

[0065] Reaction solution components volume DNA fragments (0.1 μg / μL) 5μL 10×Buffer 3μL AsiSI 0.25 μL MluI 0.25 μL <![CDATA[ddH2O]]> 1.5 μL Total 10 μL

[0066] The target gene band size is about 470 bp, such as Figure 2 Shown: 1 is the plasmid verified to be correct by enzyme digestion and sent for sequencing.

[0067] 5. Sequencing

[0068] The plasmid that was correctly digested in step 4 was sent for sequencing verification. A three-plasmid transfection system was used for viral packaging plasmids.

[0069] 6. Virus Packaging

[0070] After the vector is extracted to a high purity and endotoxin-free state, the plasmid is transfected into 293T cells using the transfection reagent PEI. Following virus extraction, the virus is purified using an iodixanol gradient and concentrated to the appropriate volume based on specific requirements. Finally, quality tests are performed, including viral infection verification, specificity testing, and purity testing. The experimental process includes: transfection → virus collection → purification → concentration → quality inspection.

[0071] VII. Verify the successful construction of AAV-hSyn-clMagR-Flag-eGFP:

[0072] C57BL / 6 mice were randomly divided into control group (injected with normal saline), low titer group (10 11 vg / mL), high titer group (10 12 vg / mL), n=5 per group. The packaged virus was injected into the substantia nigra region (AP: -3.2mm, ML: ±1.2mm, DV: -4.5mm) using a stereotaxic apparatus, with an injection volume of 2μL and an injection rate of 0.2μL / min. The needle was left to rest for 5 minutes after injection to avoid liquid backflow. 14 days after injection, the brain tissue was removed by perfusion fixation, and the substantia nigra and striatum regions were prepared into frozen sections. The expression of eGFP was observed using a fluorescence microscope, and the fluorescence intensity (au) was quantitatively analyzed using ImageJ software. At the same time, the expression of the Flag tag was detected by immunofluorescence staining, and the proportion of positive neurons was counted (number of positive cells / total number of cells × 100%) in combination with DAPI nuclear staining. The distribution of eGFP signals in different brain regions (such as the substantia nigra and striatum) was further analyzed to evaluate the transduction efficiency of the virus in different regions. Data are presented as mean ± standard deviation (mean ± SD). Fluorescence intensity and positive cell ratio were compared between groups using one-way analysis of variance (ANOVA), with the significance level set at ***P < 0.05. The results are shown in the bar graph showing the transduction efficiency of different titers of AAV virus ( Figure 3 ), with the ordinate representing the percentage of positive cells (%) and the abscissa representing the experimental groups (control, low-titer, and high-titer groups). The distribution diagram shows the intensity of eGFP signal expression in different brain regions, visually reflecting the differences in viral transduction distribution in the substantia nigra and striatum. This experimental method validated the successful construction of AAV-hSyn-clMagR-Flag-eGFP and its efficient expression in the target brain regions.

[0073] Example 2 Detection of Iron Oxide Formation in Substantia Nigra in Parkinson's Disease Based on Magnetic Resonance QSM

[0074] The experimental animals were divided into the following three groups: 1. Control group: mice did not receive any special treatment and were only injected with normal saline to provide a baseline iron content reference; 2. 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) + AAV-hSyn-clMagR-Flag-eGFP group (hereinafter referred to as MPTP+AAV-clMagR group): MPTP (30 mg / kg, for 5 consecutive days) was injected intraperitoneally, hSyn-clMagR-Flag-eGFP virus (1012 vg / mL, 2 μL) was stereotactically injected into the substantia nigra, and FAC (iron-saturated transferrin, 2 μg) was injected into the lateral ventricle; 3. AAV+FAC combined treatment group (MPTP+FAC+AAV-clMagR group): Based on the MPTP model mice, AAV-hSyn-clMagR-Flag-eGFP virus (1012 vg / mL, 2 μL) was stereotactically injected into the substantia nigra. 12 vg / mL, 2μL) was injected into the substantia nigra, and FAC (iron-saturated transferrin, 2μg) was injected into the lateral ventricle, combined with a rotating magnetic field (frequency 10 Hz, intensity 50mT) for 10 minutes every day for 2 consecutive weeks to promote the formation of iron oxide nanoparticles.

[0075] Fourteen days after intervention, mice in each group underwent magnetic resonance imaging (QSM). Quantitative Susceptibility Mapping (QSM) was used on a 9.4T high-field MRI scanner to examine iron oxide formation in the substantia nigra of Parkinson's disease mice. Mice were divided into a control group, an MPTP+AAV-clMagR model group, and an AAV+FAC combined treatment group. MRI scans were performed at fixed time points after treatment. Phase images were acquired using a gradient echo (GRE) sequence with an echo time (TE) of 20 ms, a repetition time (TR) of 1500 ms, a slice thickness of 0.5 mm, and a resolution of 200 μm. Background magnetic field removal and QSM reconstruction were performed on the phase images using specialized software (e.g., SPM or STI Suite). The magnetic susceptibility (χ value, in ppb) of the substantia nigra was calculated. The substantia nigra region was segmented based on the mouse brain atlas, and the mean magnetic susceptibility was extracted. The susceptibility values ​​of the different groups were statistically analyzed to assess the level of iron oxide formation and the effect of the magnetogenetic system on iron metabolism. Data are presented as mean ± standard deviation. One-way analysis of variance (ANOVA) was used for comparison between groups, with the significance level set at ***P < 0.05. This method can quantify the iron oxide content in the substantia nigra and be used to evaluate the formation of iron oxide and the regulatory effect of combined treatment. Figure 4As shown, the experimental results showed that among the different treatment groups, the magnetic susceptibility of the MPTP+FAC+AAV-clMagR group was the highest, significantly higher than that of the control group and the MPTP+AAV-clMagR group. Among them, the magnetic susceptibility of the MPTP+AAV-clMagR group was higher, but still lower than that of the MPTP+FAC+AAV-clMagR group, while the magnetic susceptibility of the control group was significantly lower. Statistical analysis showed that the difference between the MPTP+FAC+AAV-clMagR group and the other groups was highly significant (P<0.001). This result indicates that clMagR generates iron oxide nanoparticles in an iron source environment.

[0076] Example 3 Detecting the real-time regulation of substantia nigra neurons by an external magnetic field

[0077] To evaluate the effect of real-time magnetic modulation on the electrical signaling of substantia nigra neurons, C57BL / 6 mice were injected with AAV-hSyn-clMagR-Flag-eGFP virus (10 12 vg / mL, 2μL) was injected into the substantia nigra region (AP: -3.2mm, ML: ±1.2mm, DV: -4.5mm), and iron-saturated transferrin (FAC, 2μg) was injected intraperitoneally daily for 7 consecutive days to promote the binding of clMagR protein to iron ions to generate iron oxide nanoparticles. 14 days after virus injection, the substantia nigra region was precisely stimulated using a real-time rotating magnetic field (frequency 10Hz, intensity 50mT), and in situ electrophysiological recording technology was used to record the electrical signal discharge (discharge peak amplitude) of the substantia nigra dopaminergic neurons. The results are as follows Figure 5 As shown in the figure, under the magnetic field off state (MS OFF), there was no significant difference in the peak potential between the MPTP+FAC+AAV-clMagR group and the MPTP+AAV-clMagR group (p>0.05), indicating that the effect of FAC combined with AAV-clMagR on neuronal function was limited when no magnetic field was applied. However, under the magnetic field on state (MS ON), the peak potential of the MPTP+FAC+AAV-clMagR group increased significantly to about 60μV, which was significantly different from the MPTP+AAV-clMagR group (p<0.01). This shows that FAC combined with AAV-clMagR can significantly enhance the electrical activity of neurons under magnetic field stimulation, suggesting that magnetic field stimulation is an important condition for promoting the recovery of neuronal function.

[0078] Example 4 Evaluation of the protective effect of magnetic stimulation on dopaminergic neurons

[0079] In order to reveal the potential mechanism of the magnetogenetic system in restoring the function of Parkinson's disease neurons, a rotating magnetic field (frequency 10 Hz, intensity 50 mT) was applied to the substantia nigra region of mice through an external magnetic stimulation system, and the stimulation was performed for 10 minutes every day for 14 consecutive days of long-term treatment. The magnetic stimulation process used a directional magnetic field coil to ensure that the magnetic field accurately covered the substantia nigra region. After the magnetic stimulation, brain tissue from the substantia nigra region was taken for analysis. The number of tyrosine hydroxylase (TH)-positive neurons was detected by immunofluorescence staining to evaluate the protective effect of magnetic stimulation on dopaminergic neurons. The results are as follows Figure 6 As shown in the results, in Parkinson's disease model mice, the number of TH-positive neurons in the substantia nigra region maintained a high level in the control group, but was significantly reduced in the PD model group, showing obvious dopaminergic neuronal damage. After AAV-clMagR treatment, the number of neurons recovered, showing a certain protective effect. After further combined magnetic field stimulation, the number of TH-positive neurons increased significantly, and the recovery effect was better than that of AAV-clMagR treatment alone, indicating that magnetic field stimulation can enhance the protective effect on dopaminergic neurons. This strategy is expected to provide a new intervention method for the treatment of Parkinson's disease-related neurodegenerative damage and promote the development of precision treatment for the disease.

Claims

1. Use of the clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1 or a plasmid containing the clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1 in constructing a magnetogenetic system based on the clMagR gene.

2. The application according to claim 1, characterized in that: The plasmid comprises the hSyn promoter, the clMagR gene with a nucleotide sequence as shown in SEQ ID NO.1, and a fused immune detection marker and a fluorescent marker.

3. The application according to claim 1, characterized in that: The construction method of the plasmid comprises the following steps: fusing the nucleotide sequence of the clMagR gene as shown in SEQ ID NO.1 with an immune detection marker and a fluorescent marker GFP, optimizing the promoter and non-coding regions, and forming an AAV plasmid capable of efficiently expressing the clMagR gene.

4. A magnetogenetic system based on the clMagR gene, characterized in that: A clMagR gene containing the nucleotide sequence as shown in SEQ ID NO.1 or a plasmid containing the clMagR gene containing the nucleotide sequence as shown in SEQ ID NO.

1.

5. Use of the clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1, a plasmid containing the clMagR gene having a nucleotide sequence as shown in SEQ ID NO.1, or the magnetogenetic system according to claim 4 in the preparation of a kit or detection system for treating and / or improving Parkinson's disease.

6. The use according to claim 5, characterized in that: The application also contains exogenous iron and magnetic field stimulation systems.

7. The use according to claim 6, characterized in that: The magnetic field stimulation system has a mild rotating magnetic field.

8. The use according to claim 6, characterized in that: The following steps are involved: (1) Using AAV plasmid to transduce the clMagR gene into target neurons, so that the iron-sulfur cluster protein clMagR is expressed in neurons; (2) The exogenous iron is provided to the patient's body, and a magnetic field stimulation system is used to perform magnetic regulation in deep neural areas in the body to improve the neural repair effect and promote neural function recovery.

9. A kit or detection system for treating Parkinson's disease, characterized in that: It contains the AAV plasmid according to claim 1 or the magnetogenetic system according to claim 4.

10. The kit or detection system according to claim 9, characterized in that: It also contains exogenous iron and magnetic field to stimulate the system.

Images