RPA-PfAgo system for rapidly detecting duck meat

Through the RPA-PfAgo system combined with specific RPA amplification primer pairs, gDNA and molecular beacons, the problem of difficult to quickly and accurately detect duck meat doping or impersonation in the prior art is solved, and efficient and accurate duck meat detection is achieved, suitable for commercial and regulatory environments.

CN120060449APending Publication Date: 2025-05-30HANSHAN NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510322544.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately detect doping or impersonation in duck meat. The traditional methods are inefficient and lack specificity, and cannot meet the market's demand for rapid screening.

Method used

Using the RPA-PfAgo system, the high efficiency and specificity of RPA is used to combine Argonaute protein from extreme thermophilic archaea to achieve accurate recognition of duck meat through specific RPA amplification primer pairs, gDNA and molecular beacons.

Benefits of technology

It greatly improves the accuracy and efficiency of the test, ensures the repeatability, specificity and sensitivity of the test, and can quickly and accurately identify doping or impersonation in duck meat, suitable for meat management in commercial and regulatory environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060449A_ABST
    Figure CN120060449A_ABST
Patent Text Reader

Abstract

The invention provides an RPA-PfAgo system for rapidly detecting duck meat, and belongs to the technical field of molecular biological detection. The detection accuracy is greatly improved by optimizing key parameters in an RPA-PfAgo system, including limiting the sequences of gDNA and the like, the concentrations of gDNA, MnCl2, a molecular beacon, PfAgo enzyme and the like, and the volume of an RPA product added into a reaction mixture. Meanwhile, the repeatability, the specificity and the sensitivity of the RPA-PfAgo system are verified, so that the reliable performance is ensured. According to the technical scheme, the method is simple, rapid and high in accuracy, a practical solution is provided for rapid on-site detection, and meat management in commercial and supervision environments is facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology detection, and in particular relates to an RPA-PfAgo system for rapid detection of duck meat. Background Art

[0002] Due to its unique flavor and high nutritional value, the demand for duck meat continues to grow in Asia and parts of Europe. However, with the complexity of the industrial chain and the intensification of market competition, the quality and safety issues of duck meat have become increasingly prominent, mainly manifested in the following aspects: Frequent adulteration and impersonation of meat: The price of duck meat is generally higher than that of poultry such as chicken and turkey. Some merchants impersonate pure duck meat products (such as duck rolls and cured duck) by adulterating low-priced poultry meat (such as chicken breast and turkey minced meat), or use duck meat scraps mixed with other meats to process into reconstituted meat, which seriously damages the rights and interests of consumers.

[0003] Traditional detection methods have certain limitations. For example, sensory identification relies on experience. The authenticity is determined by observing the texture of the meat, the distribution of fat, or the flavor after cooking. However, duck meat is similar in shape to some poultry (such as goose meat), and it is more difficult to identify adulteration with the naked eye after seasoning or deep processing (such as sauce duck and duck meatballs). The efficiency of using physical and chemical analysis of duck meat ingredients is insufficient. Its pre-treatment is complex and the detection cycle is long (it takes hours to days), which makes it difficult to meet the market's demand for rapid screening. For meat adulteration, conventional indicators such as fat content and amino acid ratio have low specificity and are easily affected by breed and feeding methods. The sensitivity of using immunological methods to detect duck meat is limited. For example, although the ELISA detection technology based on antigen-antibody reaction can be used to identify duck-derived ingredients, cross-reactions (such as with other poultry proteins) may lead to false positives, and the adulteration ratio cannot be quantitatively analyzed. Further research is urgently needed to provide a simple and efficient method for detecting duck meat ingredients. Summary of the invention

[0004] In view of this, the object of the present invention is to provide an RPA-PfAgo system for rapid detection of duck meat. The present invention utilizes the high efficiency and specificity of RPA, combined with Argonaute protein from extreme thermophilic archaea, to achieve accurate identification of duck meat.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides an RPA-PfAgo system for rapid detection of duck meat, wherein the RPA-PfAgo system comprises an RPA amplification primer pair of duck meat, gDNA and a molecular beacon;

[0007] The RPA amplification primer pair is SEQ ID NO.1 and SEQ ID NO.4, SEQ ID NO.1

[0008] and SEQ ID NO.5 or SEQ ID NO.1 and SEQ ID NO.6;

[0009] The SEQ ID NO.1 is a forward primer;

[0010] The SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6 is a reverse primer;

[0011] The gDNA is D-gDNA 41-1 and D-gDNA 41-2;

[0012] The nucleotide sequence of the D-gDNA 41-1 is shown in SEQ ID NO.7;

[0013] The nucleotide sequence of the D-gDNA 41-2 is shown in SEQ ID NO.8;

[0014] The nucleotide sequence of the molecular beacon is shown in SEQ ID NO.11.

[0015] The present invention provides the application of the RPA-PfAgo system in detecting duck meat.

[0016] The present invention provides a kit for detecting duck meat, and the kit comprises the following components:

[0017] The forward primer, reverse primer, D-gDNA 41-1, D-gDNA 41-2, molecular beacon, PfAgo enzyme, MnCl 2 , buffer and water;

[0018] The initial concentrations of the forward primer and the reverse primer are independently 8-12 μM;

[0019] The initial concentrations of the D-gDNA 41-1 and the D-gDNA 41-2 are independently 8-12 μM;

[0020] The initial concentration of the molecular beacon is 15-25 μM;

[0021] The initial concentration of the PfAgo enzyme is 100-300 U / μL;

[0022] The MnCl 2 has an initial concentration of 30-50 mM.

[0023] The present invention provides a method for detecting duck meat by using the kit, comprising the following steps:

[0024] 1) Extract nucleic acids from the sample, and amplify using the forward primer and the reverse primer to obtain an amplification product;

[0025] 2) Mix the amplification product, D-gDNA 41-1, D-gDNA 41-2, PfAgo enzyme, MnCl 2 , buffer and water, react to obtain a reaction product;

[0026] 3) Detect whether there is fluorescence in the reaction product. If there is fluorescence, it is determined that the sample contains duck meat; if there is no fluorescence, it is determined that the sample does not contain duck meat;

[0027] In step 2), the volume ratio of the amplification product: D-gDNA 41-1: D-gDNA 41-2: molecular beacon: PfAgo enzyme: MnCl 2 : buffer: water is 2-8:1-3:1-3:0.5-1.5:2-6:2-6:1-5:1-10;

[0028] The initial concentration of the amplification product is 1-5 ng / μL.

[0029] Preferably, the volume ratio of the components for amplification in step 1) is:

[0030] buffer: forward primer: reverse primer: sample DNA: magnesium acetate: water = 27-32:1-3:1-3:1-3:1-4:10-16;

[0031] The initial concentration of magnesium acetate is 250-300 mM.

[0032] Preferably, the temperature for amplification in step 1) is 35-40 °C, and the amplification time is 10-40 min.

[0033] Preferably, the temperature for the reaction in step 2) is 93-97 °C, and the reaction time is 28-32 min.

[0034] Preferably, the detection in step 3) is to detect whether there is fluorescence using light with a wavelength of 470 nm or 525 nm.

[0035] Preferably, the detection in step 3) is to record the fluorescence every 25-35 seconds.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The present invention provides an RPA-PfAgo system for detecting duck meat. By optimizing the key parameters in the RPA-PfAgo system, including defining the sequences of gDNA, etc., gDNA, MnCl 2The concentrations of molecular beacons, PfAgo enzyme, etc., and the volume of the RPA product added to the reaction mixture have greatly improved the accuracy of detection. At the same time, the repeatability, specificity, and sensitivity of the RPA-PfAgo system have been verified to ensure reliable performance. The technical solution of the present invention is simple, fast, and has high accuracy, providing a practical solution for rapid on-site detection and facilitating meat management in commercial and regulatory environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Flow chart designed for the RPA-PfAgo system for detecting duck meat;

[0039] Figure 2 Graph of amplification primer pairs and gDNA screening results;

[0040] Figure 3 Graph of amplification parameter optimization results, where from top to bottom are MgAc, RPA reaction temperature, and reaction time;

[0041] Figure 4 Graph of multi-parameter optimization results of the RPA-PfAgo system, where from top to bottom are gDNA, MnCl 2 , probe, PfAgo, and RPA product;

[0042] Figure 5 Graph of sensitivity, specificity, and repeatability evaluation results of the RPA-PfAgo system. From top to bottom are repeatability, specificity, and sensitivity. The main vertical axis (scale of 4) is for targeted meat, and the secondary axis (scale of 0.01) is for non-targeted meat and negative controls (NCs). Sensitivity highlights the maximum fluorescence intensity (MFI) at each concentration;

[0043] Figure 6 Detection results of the duck meat RPA-PfAgo system for random meat samples

[0044] Figure 7 Graph of PCR detection results for random meat samples. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0045] The present invention provides an RPA-PfAgo system for detecting duck meat. The RPA-PfAgo system includes an RPA amplification primer pair for duck meat, gDNA, and molecular beacons;

[0046] The RPA amplification primer pair is SEQ ID NO.1 and SEQ ID NO.4, SEQ ID NO.1 and SEQ ID NO.5, or SEQ ID NO.1 and SEQ ID NO.6, preferably SEQ ID NO.1 and SEQ ID NO.4;

[0047] SEQ ID NO.1: TCCTTCCCACAGTATCAATC;

[0048] The said SEQ ID NO.1 is a forward primer;

[0049] SEQ ID NO.4: CGGCTAGCAGGATAGATGAGTT;

[0050] SEQ ID NO.5: GATAGATGAGTTGTAGTGGAATCACATGAC;

[0051] SEQ ID NO.6: TAGCAGGATAGATGAGTTGTAGTGGAATC;

[0052] The said SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6 is a reverse primer;

[0053] The said gDNA is D-gDNA 41-1 and D-gDNA 41-2;

[0054] The nucleotide sequence of the said D-gDNA 41-1 is as shown in SEQ ID NO.7;

[0055] SEQ ID NO.7: TAGGCCTGGATTATGG;

[0056] The nucleotide sequence of the said D-gDNA 41-2 is as shown in SEQ ID NO.8;

[0057] SEQ ID NO.8: GAGGAGGACGAAAACG;

[0058] The nucleotide sequence of the said molecular beacon is as shown in SEQ ID NO.11;

[0059] SEQ ID NO.11: GACGAAAACGTAGGCCTGGATTATGGCCA.

[0060] The present invention provides the application of the said RPA-PfAgo system in detecting duck meat.

[0061] The present invention provides a kit for detecting duck meat, and preferably the said kit comprises the following components:

[0062] The said forward primer, reverse primer, D-gDNA 41-1, D-gDNA 41-2, molecular beacon, PfAgo enzyme, MnCl 2 , buffer solution and water;

[0063] The initial concentrations of the forward primer and the reverse primer are independently preferably 8 - 12 μM, more preferably 9 - 11 μM, and even more preferably 10 μM;

[0064] The initial concentrations of the D-gDNA 41-1 and D-gDNA 41-2 are independently preferably 8 - 12 μM, more preferably 9 - 11 μM, and even more preferably 10 μM;

[0065] The initial concentration of the molecular beacon is preferably 15 - 25 μM, more preferably 18 - 23 μM, and even more preferably 20 μM;

[0066] The initial concentration of the PfAgo enzyme is preferably 100 - 300 U / μL, more preferably 150 - 250 U / μL, and even more preferably 200 U / μL;

[0067] The initial concentration of the MnCl 2 is preferably 30 - 50 mM, more preferably 35 - 45 mM, and even more preferably 40 mM.

[0068] The present invention provides a method for detecting duck meat using the said kit, comprising the following steps:

[0069] 1) Extract nucleic acid from the sample and amplify it using the forward primer and the reverse primer to obtain an amplification product;

[0070] 2) Mix the amplification product, D-gDNA 41-1, D-gDNA 41-2, PfAgo enzyme, MnCl 2 , buffer and water, and react to obtain a reaction product;

[0071] 3) Detect whether the reaction product has fluorescence. If there is fluorescence, it is determined that the sample contains duck meat; if there is no fluorescence, it is determined that the sample does not contain duck meat;

[0072] In the present invention, for step 1), the extraction of nucleic acid from the sample is preferably performed using an Ezup column animal genomic DNA extraction kit.

[0073] In the present invention, the volume ratio of the components in step 1) for amplification is preferably: buffer: forward primer: reverse primer: sample DNA: magnesium acetate: water = 27 - 32: 1 - 3: 1 - 3: 1 - 3: 1 - 4: 12 - 16, more preferably buffer: forward primer: reverse primer: sample DNA: magnesium acetate: water = 28 - 31: 1.5 - 2.5: 1.5 - 2.5: 1.5 - 2.5: 2 - 3: 11 - 15, and even more preferably buffer: forward primer: reverse primer: sample DNA: magnesium acetate: water = 29.5: 2: 2: 2: 2.3: 12.2; the initial concentration of the magnesium acetate is preferably 250 - 300 mM, more preferably 260 - 290 mM, and even more preferably 280 mM; the temperature for amplification is preferably 35 - 40 °C, more preferably 36 - 39 °C, and even more preferably 37 °C; the time for amplification is preferably 10 - 40 min, more preferably 15 - 30 min, and even more preferably 20 min.

[0074] In the present invention, in step 2), amplification product: D-gDNA 41-1: D-gDNA 41-2: molecular beacon: PfAgo enzyme: MnCl 2 : buffer: water has a volume ratio preferably of 2 - 8: 1 - 3: 1 - 3: 0.5 - 1.5: 2 - 6: 2 - 6: 1 - 5: 1 - 10; more preferably 4 - 7: 1.5 - 2.5: 1.5 - 2.5: 0.7 - 1.2: 3 - 5: 3 - 5: 2 - 4: 2 - 5; and even more preferably 6: 2: 2: 1: 4: 4: 3: 3.

[0075] In the present invention, in step 2), the temperature of the reaction is preferably 93 - 97 °C, more preferably 94 - 96 °C, and even more preferably 95 °C, and the time of the reaction is preferably 28 - 32 min, more preferably 29 - 31 min, and even more preferably 30 min.

[0076] In the present invention, the initial concentration of the amplification product is preferably 1 - 5 ng / μL, more preferably 2 - 4 ng / μL, and even more preferably 3 ng / μL.

[0077] In the present invention, the detection in step 3) is to detect whether there is fluorescence using light with a wavelength of 470 nm or 525 nm. The detection in step 3) is preferably to record the fluorescence every 25 - 35 seconds, more preferably 27 - 32 seconds, and even more preferably 30 seconds.

[0078] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0079] The TwistAmp DNA amplification kit was purchased from TwistDx, Cambridge, UK;

[0080] The Basic kit was purchased from TwistDx, Cambridge, UK;

[0081] The Ezup column animal genomic DNA extraction kit was purchased from Sangon Biotech, Shanghai, China.

[0082] Experimental Example 1

[0083] Design of RPA primers, gDNA, and meat molecular beacons

[0084] The conserved sequence of ducks used in the present invention was from the National Center for Biotechnology Information (NCBI, https: / / www.ncbi.nlm.nih.gov): duck (NC_009684.1), and the conserved sequence of ducks was SEQ ID NO.12: TGGCCATAATCCAGGCCTACGTTTTCGTCCTCCTCCTA (5'-3'). The conserved sequence downloaded from NCBI was synthesized into a plasmid by GENEWIZ (Suzhou, Jiangsu Province, China) (the following is the template DNA, which was used to optimize the reaction conditions of the entire RPA-PfAgo system). According to the design principles listed in the TwistAmp DNA amplification kit instructions, three groups of RPA primers were designed for the mitochondrial specific conserved sequence of duck meat. The specificity of the designed primers was verified by the Primer-BLAST tool of NCBI. Guide DNA (gDNA) was designed according to the cleavage characteristics of the PfAgo protein, including sequences complementary to the RPA primers. Two gDNA sequences and their corresponding molecular beacons were designed. The 5'-end of the molecular beacon was labeled with 6-carboxyfluorescein (FAM) or 6-carboxy-X-rhodamine (ROX), and the 5'-end of the gDNA was phosphorylated (see Table 1). The designed primers, gDNA, and molecular beacons were all synthesized by GENEWIZ (Suzhou, Jiangsu Province, China).

[0085] Table 1 Details of the designed RPA primers, gDNA sequences, and molecular beacons

[0086]

[0087]

[0088] The detailed design flow chart of the RPA-PfAgo system for detecting duck meat is shown in Figure 1 .

[0089] These primers were evaluated in the RPA reaction and randomly paired to assess amplification efficiency and specificity. All tested combinations produced a distinct single-band pattern, indicating amplification of the specific target. Quantitative gel analysis performed using ImageJ software enabled the selection of the three most effective primer pairs based on band brightness and clarity under standardized conditions (see details in Figure 2 ). The determined optimal primer pairs were: F1R1, F1R2, and F1R3, with F1R1 being the best. F1R1 was used in subsequent experimental examples and embodiments. Subsequent screening paired these primers with two sets of specifically designed gDNAs for each type of meat and further evaluated them by PfAgo enzyme digestion. The results showed that the most suitable gDNAs for duck meat were gDNA41-1 and gDNA41-2, and gDNA41-1 and gDNA41-2 were also used in subsequent experimental examples and embodiments. These combinations consistently produced clear and distinct RPA products, confirming their applicability in accurate meat identification.

[0090] Experimental Example 2

[0091] Optimization of RPA Amplification Parameters

[0092] RPA was performed using the Basic kit. The reaction mixture included 29.5 μL of buffer A (from the Basic kit), 1 μL of forward primer and 1 μL of reverse primer, 2 μL of template DNA, and 2.5 μL of magnesium acetate (MgAc, 280 mM), and was made up to a final volume of 50 μL with ddH 2 O. After mixing, the mixture was centrifuged and incubated at 39 °C for 30 minutes in a PCR thermal cycler or an isothermal heating device. The RPA products were analyzed by agarose gel electrophoresis. During the optimization process, the volume of MgAc added (2.0, 2.3, 2.5, 2.8, and 3.0 μL), reaction temperature (35 °C, 37 °C, 39 °C, 42 °C, and 45 °C), and time (10, 15, 20, 25, and 30 minutes) were systematically changed. Only the parameters being tested were changed, and other parameters remained unchanged. A negative control containing ddH 2 O as the template was included. The results are shown in Figure 3 .

[0093] Figure 3 The optimal volume of MgAc added for duck meat was shown to be 2.3 μL; the optimal amplification temperature was 37 °C; the optimal amplification time was 20 minutes.

[0094] The optimal amplification system was:

[0095] Buffer A: volume 29.5 μL;

[0096] F1: volume 2 μL, concentration 10 μM;

[0097] R1: Volume is 2 μL and concentration is 10 μM;

[0098] Template DNA: Volume is 2 μL;

[0099] MgAc: Volume is 2.3 μL and concentration is 280 mM;

[0100] ddH 2 O: Volume is 12.2 μL.

[0101] The template DNA is used for optimizing amplification parameters and needs to be replaced with sample DNA in actual operation.

[0102] The extraction of the sample DNA is to take 25 mg of the sample and extract the sample DNA according to the steps in the instruction manual of the Ezup column animal genomic DNA extraction kit.

[0103] Experimental Example 3

[0104] Multi-parameter optimization of the RPA-PfAgo system

[0105] The PfAgo digestion experiment is carried out by System (Hongshi, Shanghai, China) at 95 °C for 30 min, and the FAM fluorescence is recorded every 30 s. After the reaction, the tubes are imaged under blue light (470 nm) and green light (525 nm) respectively by the GelView 6000Plus imaging station (Boluteng, Guangzhou, China). ddH 2 O is used as a negative control for the template. During the optimization process, the concentrations of D-gDNA 41-1 and D-gDNA 41-2 (independently 10 μM, 20 μM, 40 μM, 60 μM, 80 μM, and 100 μM), the added volume of MnCl 2 (1 μL, 2 μL, 3 μL, 4 μL, 5 μL, and 6 μL), the concentration of the molecular marker (10 μM, 20 μM, 40 μM, 60 μM, 80 μM, and 100 μM), the added amount of PfAgo enzyme (1 μL, 2 μL, 3 μL, 4 μL, 5 μL, and 6 μL), and the added volume of the amplification product (1 μL, 2 μL, 3 μL, 4 μL, 5 μL, and 6 μL) are systematically changed. Only the tested parameters are changed, and other parameters remain unchanged.

[0106] When optimizing the RPA-PfAgo detection platform for duck meat identification, the concentrations of key reaction components are precisely adjusted. The detailed results are shown in Figure 4。The results showed that as the gDNA concentration increased, the fluorescence signal initially increased but then decreased, indicating that 10 μM was the optimal concentration for gDNA41-1 and gDNA41-2. The optimization results of the molecular beacon concentration showed that the optimal concentration was 20 μM. The optimal added volume of MnCl 2 was 4 μL. The optimal added volume of PfAgo enzyme was 4 μL. Similarly, the added volume of the amplification product obtained from the optimal amplification system described in Example 2 was also optimized, and the optimal volume of the amplification product was 6 μL. To improve accuracy, two molecular beacons (FAM and ROX) were used in the experiment, and consistent optimal conditions were observed in different systems.

[0107] The optimal reaction system was:

[0108] The volume of the amplification product was 6 μL;

[0109] The volumes of D-gDNA 41-1 and D-gDNA 41-2 were independently 2 μL, and the concentrations were independently 10 μM;

[0110] The volume of the molecular beacon was 1 μL, and the concentration was 20 μM;

[0111] The volume of PfAgo enzyme was 4 μL, and the concentration was 200 U / μL;

[0112] MnCl 2 The volume was 4 μL, and the concentration was 40 mM;

[0113] The volume of the buffer was 3 μL;

[0114] ddH 2 The volume of O was 3 μL.

[0115] Experimental Example 4

[0116] Evaluation of the sensitivity, specificity and repeatability of the RPA-PfAgo system

[0117] Repeatability was evaluated by testing genomic DNA from duck meat under various conditions. The results are shown in detail in Figure 5 (each experiment was repeated 3 times). The results showed that the coefficient of variation in all tests remained below 10%, indicating that the detection method had high repeatability and reliability. The duck meat-specific RPA-PfAgo platform detected fluorescence only in duck meat samples, and no cross-reaction was observed in chicken, beef, pork or lamb samples. The sensitivity experiment was carried out by gradient dilution of meat genomic DNA (ranging from 1×10 0 to 1×10 7 copies / μL). The results showed that the RPA-PfAgo detection system could detect fluorescence in duck meat samples. It should be noted that the detection limit of duck meat was 1×101 copies / μL.

[0118] Example 1 Detection of meat products

[0119] To evaluate the practical application of the RPA-PfAgo system, 20 different samples were analyzed, including commercially available meat products (randomly purchased duck, chicken, beef, pork, and lamb, not unprocessed meat, and the types of samples included commercially available products such as lamb skewer products, roasted duck products, chicken sausage, beef jerky, and pork jerky) and artificially adulterated samples (5 samples with different mixed meat ratios), as detailed in Table 2. The samples were blindly tested using the best primer pair and gDNA screened in Example 1, the RPA conditions optimized in Experimental Example 2, and the RPA-PfAgo system optimized in Experimental Example 3. The order was randomized and renumbered. The test results are detailed in Figure 6。Then, the meat types of different samples were verified by PCR, and the DNA of the samples was extracted as a template. The total volume of the reaction mixture was 25 μL, including 12.5 μL of 2× Taq PCR MasterMix (TIANGEN, Beijing, China), 1 μL of 10 μM forward primer and 1 μL of reverse primer, 2 μL of DNA template, and 8.5 μL of water. The PCR program was as follows: initial denaturation at 95 °C for 5 minutes, followed by 35 cycles: denaturation at 95 °C for 45 seconds, annealing at 54 °C for 45 seconds, extension at 72 °C for 30 seconds, and finally extension at 72 °C for 10 minutes and holding at 4 °C. The PCR products were analyzed by 1.2% agarose gel electrophoresis to confirm the amplification of the target bands. When performing PCR verification, the forward primer sequence for chicken was SEQ ID NO.13: TCGACCCAGCAAATTATAGACCCAC, and the reverse primer sequence was SEQ ID NO.14: GCAAGAGTATGATTGTTGGTAGGATGATCT; the forward primer sequence for duck was SEQ ID NO.15: GCCCATCCTTCCCACAGTATCAATC, and the reverse primer sequence was SEQ ID NO.16: CGGCGGCTAGCAGGATAGATGAGTT; the forward primer sequence for pork was SEQ ID NO.17: AAACACTCGCATTAACAATCACCTT, and the reverse primer sequence was SEQ ID NO.18: TGTAGAATGTGGTGTATTTTGGTAGCACGGA; the forward primer sequence for lamb was SEQ ID NO.19: GCCTCTCCAGTATTAAACTTGC, and the reverse primer sequence was SEQ ID NO.20: GTACTCGTTTGCATGTTTAAGACAGAC; the forward primer sequence for beef was SEQ ID NO.21: ATTATACATCGCCTAGCTCCATACA, and the reverse primer sequence was SEQ ID NO.22: GGTTCTTTAGTGAAGAGGCCATAGGGA. The details of the meat types detected by PCR are shown in Figure 7 。

[0120] Table 2 Randomly purchased meat samples and artificially adulterated samples

[0121]

[0122]

[0123] Figure 6 and Figure 7The results show that the RPA-PfAgo method effectively detected all samples containing duck meat, which is consistent with the detection results of PCR.

[0124] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A RPA-PfAgo system for rapid detection of duck meat, characterized in that: The RPA-PfAgo system includes RPA amplification primer pairs of duck meat, gDNA and molecular beacons; The RPA amplification primer pair is SEQ ID NO.1 and SEQ ID NO.4, SEQ ID NO.1 and SEQ ID NO.5, or SEQ ID NO.1 and SEQ ID NO.6; The SEQ ID NO.1 is a forward primer; The SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.6 is a reverse primer; The gDNAs are D-gDNA 41-1 and D-gDNA 41-2; The nucleotide sequence of the D-gDNA 41-1 is shown in SEQ ID NO.7; The nucleotide sequence of the D-gDNA 41-2 is shown in SEQ ID NO.8; The nucleotide sequence of the molecular beacon is shown in SEQ ID NO.

11.

2. Application of the RPA-PfAgo system according to claim 1 in detecting duck meat.

3. A kit for detecting duck meat, characterized in that: The kit comprises the following components: The forward primer, reverse primer, D-gDNA 41-1, D-gDNA 41-2, molecular beacon, PfAgo enzyme, MnCl2, buffer and water as described in claim 1; The initial concentrations of the forward primer and the reverse primer are independently 8 to 12 μM; The initial concentrations of the D-gDNA 41-1 and D-gDNA 41-2 are independently 8 to 12 μM; The initial concentration of the molecular beacon is 15 to 25 μM; The initial concentration of the PfAgo enzyme is 100-300 U / μL; The initial concentration of MnCl2 is 30-50 mM.

4. A method for detecting duck meat using the kit according to claim 3, characterized in that: The following steps are involved: 1) Extracting nucleic acid from the sample and amplifying it using forward primers and reverse primers to obtain an amplification product; 2) mixing the amplified product, D-gDNA 41-1, D-gDNA 41-2, PfAgo enzyme, MnCl2, buffer and water, reacting to obtain a reactant; 3) Detect whether the reactant has fluorescence. If it has fluorescence, it is judged that the sample contains duck meat; if it does not have fluorescence, it is judged that the sample does not contain duck meat; In step 2), the volume ratio of amplification product: D-gDNA 41-1: D-gDNA 41-2: molecular beacon: PfAgo enzyme: MnCl2: buffer: water is 2-8: 1-3: 1-3: 0.5-1.5: 2-6: 2-6: 1-5: 1-10; The initial concentration of the amplified product is 1-5 ng / μL.

5. The method according to claim 4, characterized in that The volume ratio of the components amplified in step 1) is: Buffer: forward primer: reverse primer: sample DNA: magnesium acetate: water = 27-32: 1-3: 1-3: 1-3: 1-4: 10-16; The initial concentration of magnesium acetate is 250-300 mM.

6. The method according to claim 5, characterized in that The amplification temperature in step 1) is 35-40° C. and the amplification time is 10-40 min.

7. The method according to claim 4, characterized in that The reaction temperature in step 2) is 93-97° C., and the reaction time is 28-32 min.

8. The method according to claim 4, characterized in that The detection in step 3) is to detect whether there is fluorescence using light of 470nm or 525nm wavelength.

9. The method according to claim 8, characterized in that In step 3), the detection is to record fluorescence every 25 to 35 seconds.