Nucleic acid detection reagent preservation method and application

Abstract

The invention relates to the technical field of molecular biology, in particular to a preservation method and application of a nucleic acid detection reagent. The invention provides a fully premixed nucleic acid detection reagent which at least comprises the following components: (a) a buffer solution, (b) DNA polymerase or a combination of DNA polymerase and reverse transcriptase, and (c) a primer for detecting target nucleic acid, the primer comprises an upstream primer and a downstream primer; wherein the primer has a primer double-chain structure. The nucleic acid detection reagent provided by the invention not only can be not influenced by reverse transcriptase and / or Taq enzyme during low-temperature storage so as to avoid non-specific amplification reaction, but also can ensure normal and even efficient proceeding of subsequent nucleic acid amplification, thereby simplifying the operation of a user side.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly relates to a method for preserving a nucleic acid detection reagent and its application. Background Art

[0002] In the field of molecular detection, the main means currently used for nucleic acid amplification is still the PCR technology. In nucleic acid detection, for DNA samples, in order to improve the specificity and sensitivity of the system, the polymerase activity of Taq DNA polymerase is usually selected for activity blocking, that is, hot start (Taq DNA polymerase does not show polymerase activity before thermal activation), so that it does not work before thermal activation, and thus non-specific amplification such as primer dimers cannot be generated. When amplifying RNA samples, there is an additional step of reverse transcription, and reverse transcriptase is also required for RNA amplification. Since the heat resistance of reverse transcriptase is not as high as that of Taq DNA polymerase, the same activity blocking method cannot be used. Therefore, when storing nucleic acid detection reagents at low temperature, primers in the system will slowly undergo non-specific amplification under the action of Taq DNA polymerase and / or reverse transcriptase, resulting in the generation of non-specific fragments (i.e., primer dimers). Primer dimers will also undergo PCR amplification, and their presence will consume the raw materials in the PCR system (such as primers), leading to a decrease in amplification efficiency. When the original concentration of the target nucleic acid is low, the competitive effect of primer dimers will result in poor amplification results, specifically manifested in aspects such as poor amplification curve morphology and low fluorescence increment, which will greatly reduce the sensitivity and specificity of the PCR amplification system.

[0003] Therefore, the prior art usually uses chemical modification or antibody modification (i.e., adding Taq enzyme antibody) to block the activity of Taq enzyme at low temperature, so as to try to avoid the generation of primer dimers stimulated by Taq enzyme at low temperature. On the one hand, the blocking efficiency of Taq enzyme in the prior art cannot reach 100%, which means that non-specific amplification reactions of primers still occur inevitably and slowly under the action of Taq enzyme. On the other hand, since the optimal temperature for reverse transcriptase to work is usually not high (the commonly used reverse transcription temperature is 50°C), it is difficult for reverse transcriptase antibody to be inactivated at this temperature, which makes it difficult for the prior art to block the activity of reverse transcriptase at low temperature. The prior art usually starts from the perspective of controlling reverse transcriptase and / or Taq enzyme, and tries to store reverse transcriptase, Taq enzyme and primers in the same reaction system. For example, Chinese Patent Application CN118813628A discloses a nucleic acid aptamer that specifically binds to reverse transcriptase, and the low-temperature activity of reverse transcriptase modified by the nucleic acid aptamer can be blocked to a certain extent. Chinese Patent Application CN118028439A discloses a nucleic acid detection reagent, which separates primers and Taq enzyme by pre-laminated encapsulation to avoid non-specific amplification reactions of primers caused by reverse transcriptase and / or Taq enzyme during low-temperature storage.

[0004] In summary, it is difficult to store reverse transcriptase and / or Taq polymerase and primers in the same reaction system for a long time stably in the prior art. SUMMARY OF THE INVENTION

[0005] In a first aspect, the present invention provides a fully premixed nucleic acid detection reagent, characterized in that the fully premixed nucleic acid detection reagent at least comprises the following components: (a) a buffer, (b) a DNA polymerase, or a combination of a DNA polymerase and a reverse transcriptase, and (c) primers for detecting a target nucleic acid; the primers include an upstream primer and a downstream primer.

[0006] As used herein, "fully premixed" means that a DNA polymerase, or a combination of a DNA polymerase and a reverse transcriptase, and primers for detecting a target nucleic acid are simultaneously present in a buffer and are in a mixed state where they can contact each other.

[0007] In some embodiments, the primers have a primer duplex structure.

[0008] In some embodiments, the concentration of the primers includes 2 - 20 μM.

[0009] In some embodiments, the concentration of the primers is 2 - 10 μM.

[0010] In some embodiments, the primer duplex structure includes a first strand and a second strand, the first strand is used to specifically bind to the target nucleic acid, and the second strand is substantially complementary to the first strand.

[0011] As used herein, "complementary" means that in a double-stranded nucleic acid molecule, the bases of one strand pair with the bases of the other strand in a complementary manner. In DNA, the purine base adenine (A) pairs with the pyrimidine base thymine (T) (or with uracil (U) in RNA); the purine base guanine (C) pairs with the pyrimidine base cytosine (G). Each base pair includes a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered to be complementary to each other. Accordingly, "mismatch" as used herein means that in a double-stranded nucleic acid molecule, the bases at corresponding positions do not pair in a complementary form.

[0012] As used herein, "substantially complementary" means that there are no more than 2 base mismatches between the two nucleotide sequences involved.

[0013] In some embodiments, the second strand has a base mismatch with the first strand.

[0014] In some embodiments, the first strand is longer than the second strand.

[0015] In some embodiments, the first strand and the second strand differ by at least 5 bases.

[0016] In some embodiments, the first strand and the second strand differ by 5 - 15 bases.

[0017] In some embodiments, the Tm value of the second strand is 30 - 50 °C.

[0018] In some embodiments, the 3'-end of the second strand is a non-extendable nucleotide.

[0019] In some embodiments, the non-extendable nucleotide can be a dideoxynucleotide or a nucleotide that has been artificially modified to be non-extendable.

[0020] In some embodiments, the artificial modification includes phosphate, amino, or C3 spacer modification.

[0021] Existing technical solutions usually focus on blocking the activities of reverse transcriptase and / or Taq polymerase in nucleic acid detection reagents. Different from the existing technical concept, based on the conventional primer design, the present invention designs a substantially complementary sequence (also referred to as an "interfering strand") at the 3'-end of the primer, thereby forming a primer duplex structure (i.e., correspondingly forming an upstream primer-upstream interfering strand duplex structure and a downstream primer-downstream interfering strand duplex structure), and a non-extendable nucleotide is also provided at the 3'-end of the interfering strand. The present invention finds that even if Taq polymerase, reverse transcriptase, and the primer duplex structure provided by the present invention coexist in the nucleic acid detection reagent and come into contact with each other, the primer duplex structure provided by the present invention cannot be extended, and thus will not cause the non-specific amplification reaction of the primer that usually occurs during low-temperature storage of Taq polymerase, reverse transcriptase, and the primer.

[0022] Furthermore, the present invention finds that although the setting of the primer duplex structure can control the extension of the primer to a certain extent during low-temperature storage, however, limited by the structure, it is relatively difficult for the primer itself to achieve "hot start". For this, the present invention improves the dissociation efficiency of the second strand (i.e., the interfering strand) by controlling the position and number of base mismatches of the second strand (for example, introducing 1 - 2 mismatched bases at the middle position of the primer) and the Tm value (for example, 30 - 50 °C), and synergistically ensures that the second strand can be fully dissociated from the first strand at 35 °C - 40 °C, thereby completing the opening of the primer extension function (i.e., the hot start of the primer) and ensuring the normal progress of nucleic acid amplification.

[0023] Therefore, the primer double-stranded structure provided by the present invention can be not affected by reverse transcriptase and / or Taq enzyme during low-temperature storage, avoiding non-specific amplification reactions, and can also ensure that the second strand can dissociate (or fall off) from the first strand through temperature regulation (i.e., hot start), without affecting the binding of the first strand to the template, so as to ensure the normal progress of subsequent nucleic acid amplification. Therefore, the primer double-stranded structure provided by the present invention can be premixed with reverse transcriptase and / or Taq enzyme, thus simplifying the operation at the user end.

[0024] In some embodiments, when the target nucleic acid is DNA, the Tm value of the second strand of the primer is 30-50 °C; when the target nucleic acid is RNA, the Tm value of the second strand of the primer is 30-40 °C; when the target nucleic acid includes DNA and RNA, the Tm value of the second strand of the primer is 30-40 °C.

[0025] In some embodiments, the second strand pairs with the first strand from the 3' end of the primer.

[0026] In some embodiments, the primer double-stranded structure is formed by annealing the first strand and the second strand. In some embodiments, the annealing method specifically includes: mixing the first strand and the second strand in a ratio of 1-2:1, heating at 94 °C for 1-2 minutes, and then placing in an environment of 20 °C - 30 °C for 5-30 minutes.

[0027] In some embodiments, the position of the base mismatch is the middle position of the second strand.

[0028] As used herein, "middle position" refers to the non-terminal (i.e., 5' end and 3' end) position of a nucleic acid molecule. In some embodiments, the mismatched base is at least 2 bases away from the end of the nucleic acid strand where it is located.

[0029] In some embodiments, the number of base mismatches is 1-2.

[0030] In some embodiments, the method for introducing base mismatches includes: at the corresponding site, selecting the same base as the first strand to introduce the mismatched base, i.e., A-A, T-T, C-C, G-G, U-T.

[0031] In some embodiments, when the target nucleic acid is RNA, or DNA and RNA, the primer does not contain U (uracil).

[0032] In some embodiments, the fully premixed nucleic acid detection reagent further includes a probe for detecting the target nucleic acid.

[0033] In some embodiments, the concentration of the probe for detecting the target nucleic acid is 1-5 μM.

[0034] In some embodiments, the DNA polymerase is Taq DNA polymerase.

[0035] In some embodiments, the concentration of the DNA polymerase includes 2 - 20 U.

[0036] In some embodiments, the concentration of the DNA polymerase is 5 - 20 U.

[0037] In some embodiments, the concentration of the reverse transcriptase includes 100 - 300 U.

[0038] In some embodiments, the all - premixed nucleic acid detection reagent further includes dNTPs.

[0039] In some embodiments, the concentration of the dNTPs includes 10 - 50 mM.

[0040] In some embodiments, when the target nucleic acid is the adenovirus hexon gene, the nucleic acid detection reagent includes (a) a buffer, (b) a DNA polymerase, (c) primers for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Wherein, the primers for detecting the target nucleic acid specifically include: a first primer and a second primer; the first primer has a first upstream primer - first upstream interferer double - strand structure, and the second primer has a first downstream primer - first downstream interferer double - strand structure; the nucleotide sequence of the first upstream primer is as shown in SEQ ID NO:1, the nucleotide sequence of the first downstream primer is as shown in SEQ ID NO:2, the nucleotide sequence of the first upstream interferer is as shown in SEQ ID NO:4, and the nucleotide sequence of the first downstream interferer is as shown in SEQ ID NO:5; the probe for detecting the target nucleic acid is a first probe, and the nucleotide sequence of the first probe is as shown in SEQ ID NO:3.

[0041] In some embodiments, when the target nucleic acid is the influenza A virus M2 gene, the nucleic acid detection reagent includes (a) a buffer, (b) a combination of a DNA polymerase and a reverse transcriptase, (c) primers for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a third primer and a fourth primer; the third primer has a second upstream primer - second upstream interferer double-stranded structure, and the fourth primer has a second downstream primer - second downstream interferer double-stranded structure; the nucleotide sequence of the second upstream primer is as shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is as shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferer is as shown in SEQ ID NO:9, the nucleotide sequence of the second downstream interferer is as shown in SEQ ID NO:10, the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is as shown in SEQ ID NO:8.

[0042] In some embodiments, when the target nucleic acid is the human β-action gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a DNA polymerase, (c) primers for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a fifth primer and a sixth primer; the fifth primer has a third upstream primer - third upstream interferer double-stranded structure, and the sixth primer has a third downstream primer - third downstream interferer double-stranded structure; wherein the nucleotide sequence of the third upstream primer is as shown in SEQ ID NO:11, the nucleotide sequence of the third downstream primer is as shown in SEQ ID NO:12, the nucleotide sequence of the third upstream interferer is as shown in SEQ IDNO:14, the nucleotide sequence of the third downstream interferer is as shown in SEQ ID NO:15, the probe for detecting the target nucleic acid is a third probe, and the nucleotide sequence of the third probe is as shown in SEQ ID NO:13.

[0043] In some embodiments, when the target nucleic acids are the influenza A virus M2 gene and the human β-action gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a combination of a DNA polymerase and a reverse transcriptase, (c) primers for detecting the target nucleic acids, and (d) a probe for detecting the target nucleic acids; Among them, the primers for detecting the target nucleic acid specifically include: a third primer, a fourth primer, a fifth primer, and a sixth primer; the third primer has a second upstream primer - second upstream interferer double-stranded structure, and the fourth primer has a second downstream primer - second downstream interferer double-stranded structure; the nucleotide sequence of the second upstream primer is as shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is as shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferer is as shown in SEQ ID NO:9, the nucleotide sequence of the second downstream interferer is as shown in SEQ ID NO:10, the fifth primer has a third upstream primer - third upstream interferer double-stranded structure, and the sixth primer has a third downstream primer - third downstream interferer double-stranded structure; wherein the nucleotide sequence of the third upstream primer is as shown in SEQ ID NO:11, the nucleotide sequence of the third downstream primer is as shown in SEQ ID NO:12, the nucleotide sequence of the third upstream interferer is as shown in SEQ ID NO:14, and the nucleotide sequence of the third downstream interferer is as shown in SEQ ID NO:15; The probes for detecting the target nucleic acid include a second probe and a third probe, the nucleotide sequence of the second probe is as shown in SEQ ID NO:8, and the nucleotide sequence of the third probe is as shown in SEQ ID NO:13.

[0044] In a second aspect, the present invention provides a method for nucleic acid amplification based on the above nucleic acid detection reagent, characterized in that the method includes: Directly mixing the sample with the nucleic acid detection reagent and performing hot start and nucleic acid amplification, wherein the conditions for the hot start include 1 - 10 min at 94 - 98 °C; the conditions for the nucleic acid amplification include denaturation for 2 - 10 s at 94 - 98 °C, annealing and extension for 20 - 40 s at 50 - 65 °C, and denaturation, annealing and extension cycles for 30 - 50 times.

[0045] In some embodiments, the method further includes performing reverse transcription before the hot start, and the conditions for the reverse transcription include 5 - 30 min at 45 °C - 60 °C.

[0046] In a third aspect, the present invention provides a use of a primer double-stranded structure in enhancing the storage stability of a nucleic acid detection reagent, characterized in that the nucleic acid detection reagent at least includes the following components: a buffer, a DNA polymerase or a combination of a DNA polymerase and a reverse transcriptase, and primers for detecting a target nucleic acid; the primers include an upstream primer and a downstream primer; the primers have a primer double-stranded structure.

[0047] In some embodiments, the concentration of the primers includes 2 - 20 μM.

[0048] In some embodiments, the concentration of the primer is 2 - 10 μM.

[0049] In some embodiments, the primer double-stranded structure includes a first strand and a second strand. The first strand is used to specifically bind to the target nucleic acid, and the second strand is substantially complementary to the first strand.

[0050] In some embodiments, there are base mismatches between the second strand and the first strand.

[0051] In some embodiments, the first strand is longer than the second strand.

[0052] In some embodiments, the first strand and the second strand differ by at least 5 bases.

[0053] In some embodiments, the first strand and the second strand differ by 5 - 15 bases.

[0054] In some embodiments, the Tm value of the second strand is 30 - 50 °C.

[0055] In some embodiments, the 3'-end of the second strand is a non-extendable nucleotide.

[0056] In some embodiments, the non-extendable nucleotide can be a dideoxynucleotide or a nucleotide that has been artificially modified to be non-extendable.

[0057] In some embodiments, the artificial modification includes phosphorylation, amino group or C3 spacer modification.

[0058] In some embodiments, when the target nucleic acid is DNA, the Tm value of the second strand of the primer is 30 - 50 °C; when the target nucleic acid is RNA, the Tm value of the second strand of the primer is 30 - 40 °C; when the target nucleic acid includes both DNA and RNA, the Tm value of the second strand of the primer is 30 - 40 °C.

[0059] In some embodiments, the second strand pairs with the first strand from the 3'-end of the primer.

[0060] In some embodiments, the primer double-stranded structure is formed by annealing the first strand and the second strand. In some embodiments, the specific annealing method includes: mixing the first strand and the second strand in a ratio of 1 - 2:1, heating at 94 °C for 1 - 2 minutes, and then placing in an environment of 20 °C - 30 °C for 5 - 30 minutes.

[0061] In some embodiments, the position of the base mismatch is the middle position of the second strand.

[0062] In some embodiments, the number of base mismatches is 1 - 2.

[0063] In some embodiments, the method for introducing base mismatches includes: at the corresponding sites, selecting the same base as the first strand to introduce mismatched bases, namely A-A, T-T, C-C, G-G, U-T.

[0064] In some embodiments, when the target nucleic acid is RNA or DNA and RNA, the second strand of the primer does not contain U (uracil).

[0065] In some embodiments, the nucleic acid detection reagent further includes a probe for detecting the target nucleic acid.

[0066] In some embodiments, the concentration of the probe for detecting the target nucleic acid is 1-5 μM.

[0067] In some embodiments, the DNA polymerase is Taq DNA polymerase.

[0068] In some embodiments, the concentration of the DNA polymerase is 2-20U.

[0069] In some embodiments, the concentration of the DNA polymerase is 5-20U.

[0070] In some embodiments, the concentration of the reverse transcriptase is 100-300 U.

[0071] In some embodiments, the nucleic acid detection reagent further includes dNTPs.

[0072] In some embodiments, the concentration of the dNTPs is 10-50 mM.

[0073] In some embodiments, the storage includes storing the nucleic acid detection reagent at -20°C for at least 12 months.

[0074] In some embodiments, when the target nucleic acid is the adenovirus hexon gene, the nucleic acid detection reagent includes (a) a buffer, (b) a DNA polymerase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a first primer and a second primer; the first primer has a first upstream primer - first upstream interferer double-stranded structure, and the second primer has a first downstream primer - first downstream interferer double-stranded structure; the nucleotide sequence of the first upstream primer is as shown in SEQ ID NO:1, the nucleotide sequence of the first downstream primer is as shown in SEQ ID NO:2, the nucleotide sequence of the first upstream interferer is as shown in SEQ ID NO:4, and the nucleotide sequence of the first downstream interferer is as shown in SEQ ID NO:5; the probe for detecting the target nucleic acid is a first probe, and the nucleotide sequence of the first probe is as shown in SEQ ID NO:3.

[0075] In some embodiments, when the target nucleic acid is the influenza A virus M2 gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a combination of a DNA polymerase and a reverse transcriptase, (c) primers for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a third primer and a fourth primer; the third primer has a second upstream primer - second upstream interferer double-stranded structure, and the fourth primer has a second downstream primer - second downstream interferer double-stranded structure; the nucleotide sequence of the second upstream primer is as shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is as shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferer is as shown in SEQ ID NO:9, and the nucleotide sequence of the second downstream interferer is as shown in SEQ ID NO:10; the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is as shown in SEQ ID NO:8.

[0076] In some embodiments, when the target nucleic acid is the human β-actin gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a DNA polymerase, (c) primers for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a fifth primer and a sixth primer; the fifth primer has a third upstream primer-third upstream interferer double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferer double-stranded structure; wherein the nucleotide sequence of the third upstream primer is as shown in SEQ ID NO:11, the nucleotide sequence of the third downstream primer is as shown in SEQ ID NO:12, the nucleotide sequence of the third upstream interferer is as shown in SEQ ID NO:14, the nucleotide sequence of the third downstream interferer is as shown in SEQ ID NO:15, the probe for detecting the target nucleic acid is a third probe, and the nucleotide sequence of the third probe is as shown in SEQ ID NO:13.

[0077] In some embodiments, when the target nucleic acids are influenza A virus M2 gene and human β-actin gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a combination of a DNA polymerase and a reverse transcriptase, (c) primers for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a third primer, a fourth primer, a fifth primer and a sixth primer; the third primer has a second upstream primer-second upstream interferer double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferer double-stranded structure; the nucleotide sequence of the second upstream primer is as shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is as shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferer is as shown in SEQ ID NO:9, the nucleotide sequence of the second downstream interferer is as shown in SEQ ID NO:10, the fifth primer has a third upstream primer-third upstream interferer double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferer double-stranded structure; wherein the nucleotide sequence of the third upstream primer is as shown in SEQ ID NO:11, the nucleotide sequence of the third downstream primer is as shown in SEQ ID NO:12, the nucleotide sequence of the third upstream interferer is as shown in SEQ ID NO:14, and the nucleotide sequence of the third downstream interferer is as shown in SEQ ID NO:15; The probes for detecting the target nucleic acid include a second probe and a third probe, the nucleotide sequence of the second probe is as shown in SEQ ID NO:8, and the nucleotide sequence of the third probe is as shown in SEQ ID NO:13.

[0078] Fourth aspect, the present invention provides an adenovirus nucleic acid detection kit, characterized in that the kit includes a nucleic acid detection reagent, and the nucleic acid detection reagent at least includes primers for detecting a target nucleic acid and a probe for detecting the target nucleic acid; the target nucleic acid is the adenovirus hexon gene; Among them, the primers for detecting the target nucleic acid specifically include: a first primer and a second primer; the first primer has a first upstream primer - first upstream interferer double-stranded structure, and the second primer has a first downstream primer - first downstream interferer double-stranded structure; the nucleotide sequence of the first upstream primer is as shown in SEQ ID NO:1, the nucleotide sequence of the first downstream primer is as shown in SEQ ID NO:2, the nucleotide sequence of the first upstream interferer is as shown in SEQ ID NO:4, and the nucleotide sequence of the first downstream interferer is as shown in SEQ ID NO:5; the probe for detecting the target nucleic acid is a first probe, and the nucleotide sequence of the first probe is as shown in SEQ ID NO:3.

[0079] In some embodiments, the nucleic acid detection reagent further includes a buffer and / or a DNA polymerase.

[0080] In some embodiments, the nucleic acid detection reagent is a fully premixed nucleic acid detection reagent.

[0081] Fifth aspect, the present invention provides an influenza A virus nucleic acid detection kit, characterized in that the kit includes a nucleic acid detection reagent, and the nucleic acid detection reagent at least includes primers for detecting a target nucleic acid and a probe for detecting the target nucleic acid; the target nucleic acid is the influenza A virus M2 gene; Among them, the primers for detecting the target nucleic acid specifically include: a third primer and a fourth primer; the third primer has a second upstream primer - second upstream interferer double-stranded structure, and the fourth primer has a second downstream primer - second downstream interferer double-stranded structure; the nucleotide sequence of the second upstream primer is as shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is as shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferer is as shown in SEQ ID NO:9, and the nucleotide sequence of the second downstream interferer is as shown in SEQ ID NO:10; the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is as shown in SEQ ID NO:8.

[0082] In some embodiments, the nucleic acid detection reagent further includes a buffer and / or a combination of a DNA polymerase and a reverse transcriptase.

[0083] In some embodiments, the nucleic acid detection reagent is a fully premixed nucleic acid detection reagent.

[0084] In a sixth aspect, the present invention provides a human β-actin nucleic acid detection kit, characterized in that the kit includes a nucleic acid detection reagent, and the nucleic acid detection reagent at least includes primers for detecting a target nucleic acid and a probe for detecting the target nucleic acid; the target nucleic acid is the human β-actin gene; Among them, the primers for detecting the target nucleic acid specifically include: a fifth primer and a sixth primer; the fifth primer has a third upstream primer-third upstream interferer double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferer double-stranded structure; wherein the nucleotide sequence of the third upstream primer is as shown in SEQ ID NO:11, the nucleotide sequence of the third downstream primer is as shown in SEQ ID NO:12, the nucleotide sequence of the third upstream interferer is as shown in SEQ ID NO:14, the nucleotide sequence of the third downstream interferer is as shown in SEQ ID NO:15, the probe for detecting the target nucleic acid is a third probe, and the nucleotide sequence of the third probe is as shown in SEQ ID NO:13.

[0085] In some embodiments, the nucleic acid detection reagent further includes a buffer and / or a DNA polymerase.

[0086] In some embodiments, the nucleic acid detection reagent is a fully premixed nucleic acid detection reagent.

[0087] In a seventh aspect, the present invention provides an influenza A virus nucleic acid detection kit, characterized in that the kit includes a nucleic acid detection reagent, and the nucleic acid detection reagent at least includes primers for detecting a target nucleic acid and a probe for detecting the target nucleic acid; the target nucleic acids are the influenza A virus M2 gene and the human β-actin gene; Among them, the primers for detecting the target nucleic acid specifically include: a third primer, a fourth primer, a fifth primer, and a sixth primer; the third primer has a second upstream primer-second upstream interferer double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferer double-stranded structure; the nucleotide sequence of the second upstream primer is as shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is as shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferer is as shown in SEQ ID NO:9, the nucleotide sequence of the second downstream interferer is as shown in SEQ ID NO:10, the fifth primer has a third upstream primer-third upstream interferer double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferer double-stranded structure; wherein the nucleotide sequence of the third upstream primer is as shown in SEQ ID NO:11, the nucleotide sequence of the third downstream primer is as shown in SEQ ID NO:12, the nucleotide sequence of the third upstream interferer is as shown in SEQ ID NO:14, and the nucleotide sequence of the third downstream interferer is as shown in SEQ ID NO:15; The probes for detecting the target nucleic acid include a second probe and a third probe, the nucleotide sequence of the second probe is as shown in SEQ ID NO:8, and the nucleotide sequence of the third probe is as shown in SEQ ID NO:13.

[0088] In some embodiments, the nucleic acid detection reagent further includes a buffer and / or a combination of DNA polymerase and reverse transcriptase.

[0089] In some embodiments, the nucleic acid detection reagent is a fully premixed nucleic acid detection reagent.

[0090] Compared with the prior art, the beneficial effects of the present invention at least include the following aspects: Existing technical solutions focus on blocking the activities of reverse transcriptase and / or Taq polymerase in nucleic acid detection reagents. Different from the ideas of the existing technologies, on the basis of conventional primer design, the present invention designs a substantially complementary sequence at the 3'-end of the primer (also referred to as "interferer"), thereby forming a primer duplex structure (i.e., correspondingly forming an upstream primer-upstream interferer duplex structure and a downstream primer-downstream interferer duplex structure), and non-extendable nucleotides are further provided at the 3'-end of the interferer. The present invention finds that even if Taq polymerase, reverse transcriptase and the primer duplex structure provided by the present invention coexist in the nucleic acid detection reagent and contact each other, the primer duplex structure provided by the present invention cannot be extended, and thus will not cause non-specific amplification reactions of the primer usually caused by Taq polymerase, reverse transcriptase and the primer during low-temperature storage. It is confirmed by the experiments of the present invention that the nucleic acid detection reagent provided by the present invention (i.e., the primer duplex structure, Taq polymerase, reverse transcriptase provided by the present invention) can still remain stable after being stored at -20°C for 13 months, and the amplification efficiency is equivalent to that of the nucleic acid detection reagent stored for 0 months, which is significantly better than the control group (i.e., conventional primer design).

[0091] In other words, the primer duplex structure provided by the present invention can be not affected by reverse transcriptase and / or Taq polymerase during low-temperature storage, avoiding non-specific amplification reactions, and can also ensure that the second strand can dissociate (or fall off) from the first strand through temperature regulation (i.e., hot start), without affecting the binding of the first strand to the template, so as to ensure the normal or even efficient progress of subsequent nucleic acid amplification. Therefore, the primer duplex structure provided by the present invention can be premixed with reverse transcriptase and / or Taq polymerase to form a fully premixed nucleic acid detection reagent, thereby simplifying the operation at the user end. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to actual scale. Obviously, the following-described drawings are some embodiments of the present invention, and for those of ordinary skill in the art, other drawings can be obtained according to these drawings without creative efforts.

[0093] Figure 1 It is the amplification diagram of DNA target detection in a singleplex system; Figure 2 It is the amplification diagram of RNA target detection in a singleplex system; Figure 3 It is the amplification diagram of DNA target detection in a duplex system; Figure 4 It is the amplification diagram of RNA target detection in a duplex system. Detailed implementation manners

[0094] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part rather than all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0095] In this document, the orientation or positional relationship indicated by the terms "upper", "lower", "inner", "outer", "front", "rear", "one end", "the other end", etc. is based on the orientation or positional relationship shown in the accompanying drawings. It is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore should not be construed as a limitation of the present invention. In addition, the terms "first" and "second" are only used for descriptive purposes and cannot be construed as indicating or implying relative importance.

[0096] As used herein, "and / or" includes any and all combinations of one or more of the listed related items.

[0097] As used herein, "a plurality of" means two or more, that is, it includes two, three, four, five, etc.

[0098] It should be noted that, in this document, the term "comprising", "including" or any other variant thereof is intended to cover a non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or further includes elements inherent to such process, method, article or device. Without further limitation, an element defined by the statement "comprising one..." does not exclude the existence of another identical element in the process, method, article or device comprising that element.

[0099] As used in this specification, the term "about" typically means + / -5% of the stated value, more typically + / -4% of the stated value, more typically + / -3% of the stated value, more typically + / -2% of the stated value, even more typically + / -1% of the stated value, and even more typically + / -0.5% of the stated value.

[0100] In this specification, certain embodiments may be disclosed in a format within a certain range. It should be understood that this description of "within a certain range" is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of the range should be considered to have specifically disclosed all possible sub-ranges and individual numerical values within that range. For example, the description of the range 1 - 6 should be regarded as having specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as the individual numbers within that range, such as 1, 2, 3, 4, 5, and 6. The above rules apply regardless of the breadth of the range.

[0101] Example 1: Detection of DNA Target DNA Target: Adenovirus hexon gene Upstream Primer Sequence: CCCTTAAACCAGCTACCAACATG (SEQ ID NO:1) Downstream Primer Sequence: CTGGTTCCTCAGTTTCAACCCC (SEQ ID NO:2) Probe Sequence: CCATGCTACGGGTCTTTTGCAAGACC (SEQ ID NO:3) Upstream Decoy Sequence: CATGT A G C TAGCTGG-C3 (SEQ ID NO:4, Tm value: 49.7 °C) Downstream Decoy Sequence: GGG C TTGAAAC-C3 (SEQ ID NO:5, Tm value: 32.1 °C) Among them, the italicized ones represent mismatched bases (i.e., the 6th and 8th bases in the 5'-to-3' direction of the nucleotide sequence indicated by SEQ ID NO:4, and the 4th base in the 5'-to-3' direction of the nucleotide sequence indicated by SEQ ID NO:4), and C3 represents C3 spacer modification.

[0102] The above upstream primer, upstream decoy, downstream primer, and downstream decoy were respectively prepared into a concentration of 200 μM with primer diluent (10 mM Tris-HCl (pH 8.8), 150 mM KCl). Then, the upstream primer and upstream decoy, and the downstream primer and downstream decoy were respectively mixed in a ratio of 1:1. Subsequently, after 1 minute at 94 °C, they were placed in an environment at 30 °C for 20 minutes to obtain the upstream primer-upstream decoy double-stranded structure and the downstream primer-downstream decoy double-stranded structure, and finally stored in a -20 °C refrigerator.

[0103] DNA Nucleic Acid Amplification System (total reaction volume 25 μL): Upstream primer-upstream interferer double-stranded structure, final concentration: 2 μM; Downstream primer-downstream interferer double-stranded structure, final concentration: 2 μM; Probe (diluted with DEPC water), final concentration: 2 μM; PCR Buffer: Prepared at a 5× concentration, final concentration is 10 mM Tris-HCl (pH 8.8), 50 mM KCl, 2.5 mM MgCl 2 , 1% Triton-X-100; dNTPs: 10 mM; DNA polymerase: 5 U; DNA template: 5 μL.

[0104] DNA detection amplification conditions: Hot start temperature: 94 °C, hot start time: 2 min; Denaturation temperature: 94 °C, denaturation time: 2 s; Annealing and extension temperature: 53 °C, annealing and extension time: 20 s.

[0105] In this example, an interferer was introduced in the experimental group (i.e., an upstream primer-upstream interferer double-stranded structure and a downstream primer-downstream interferer double-stranded structure were correspondingly formed), and no interferer was introduced in the control group (i.e., only upstream and downstream primers were used). After preparing the DNA nucleic acid amplification system as described above, the nucleic acid detection reagents of the experimental group and the control group were placed at 2 - 8 °C for 15 days, and the stability test results of the nucleic acid detection reagents of the two groups at 0 day and 15 days were compared (in this example, the stability of the nucleic acid detection reagent was evaluated by examining the Ct value of the positive amplification curve detected using the corresponding nucleic acid detection reagent).

[0106] The experimental results are as Figure 1 shown. The CT value of the nucleic acid detection reagent in the control group at 0 day for detecting the adenovirus hexon gene DNA target was 27.82, the CT value of the nucleic acid detection reagent in the experimental group at 0 day for detecting the adenovirus hexon gene DNA target was 27.57, the CT value of the nucleic acid detection reagent in the control group at 15 days for detecting the adenovirus hexon gene DNA target was 31.81, and the CT value of the nucleic acid detection reagent in the experimental group at 15 days for detecting the adenovirus hexon gene DNA target was 28.23. It can be seen that the nucleic acid detection reagent prepared by introducing an interferer is significantly more stable in detecting the DNA target after being stored at 2 - 8 °C for 15 days than the control group without introducing an interferer.

[0107] Example 2: Detection of RNA target RNA Target: Influenza A virus M2 gene Forward primer sequence: TCTTTCTATCATCCCATCAGGCC (SEQ ID NO:6) Reverse primer sequence: GAGGTGACAGGATCGGTCTT (SEQ ID NO:7) Probe sequence: CCTCAAAGCCGAGATCGCGCAGAGAC (SEQ ID NO:8) Forward interfering sequence: GGC GA GATGGG-C3 (SEQ ID NO:9, Tm value: 39.6℃) Reverse interfering sequence: AAG U CCGATC-C3 (SEQ ID NO:10, Tm value: 31.1℃) Among them, italic indicates the mismatched bases (i.e., the 4th and 5th bases in the 5'-to-3' direction of the nucleotide sequence indicated by SEQ ID NO:9, and the 4th base in the 5'-to-3' direction of the nucleotide sequence indicated by SEQ ID NO:10), and C3 represents C3 spacer modification.

[0108] The above forward primer, forward interfering sequence, reverse primer, and reverse interfering sequence were respectively prepared into a concentration of 200 μM with primer diluent (10 mM Tris-HCl (pH 8.8), 150 mM KCl). Then, the forward primer and the forward interfering sequence, as well as the reverse primer and the reverse interfering sequence, were mixed at a dosage ratio of 2:1. Subsequently, after heating at 94℃ for 1 minute, they were placed in an environment of 20℃ for 30 minutes to obtain the forward primer-forward interfering sequence double-stranded structure and the reverse primer-reverse interfering sequence double-stranded structure, and finally stored in a -20℃ refrigerator.

[0109] RNA nucleic acid amplification system (total reaction volume 25 μL): Forward primer-forward interfering sequence double-stranded structure, final concentration: 5 μM; Reverse primer-reverse interfering sequence double-stranded structure, final concentration: 5 μM; Probe (diluted with DEPC water), final concentration: 3 μM; PCR Buffer: Prepared as 5× concentration, final concentration is 75 mM Tris-HCl (pH 8.8), 30 mM(NH4) 2 SO 4 、3.0 mM MgCl 2 、0.1% Tween 20; dNTPs: 30 mM; DNA polymerase: 20 U; Reverse transcriptase: 100 U; RNA template: 5 μL.

[0110] RNA detection amplification conditions: Reverse transcription temperature: 48 °C, reverse transcription time: 5 min; Hot start temperature: 98 °C, hot start time: 5 min; Denaturation temperature: 98 °C, denaturation time: 5 s; Annealing and extension temperature: 60 °C, annealing and extension time: 30 s.

[0111] In this example, an interferer was introduced into the experimental group (i.e., an upstream primer-upstream interferer double-stranded structure and a downstream primer-downstream interferer double-stranded structure were correspondingly formed), and no interferer was introduced into the control group (i.e., only the upstream primer and the downstream primer were used). After preparing the RNA nucleic acid amplification system as described above, the nucleic acid detection reagents of the experimental group and the control group were placed at 2 - 8 °C for 15 days, and the stability test results of the two groups of nucleic acid detection reagents at 0 day and 15 days were compared (in this example, the stability of the nucleic acid detection reagent was evaluated by examining the Ct value of the positive amplification curve detected by the corresponding nucleic acid detection reagent).

[0112] The experimental results are as Figure 2 shown. The CT value of the nucleic acid detection reagent of the control group at 0 day for detecting the RNA target of the influenza A virus M2 gene was 27.84, the CT value of the nucleic acid detection reagent of the experimental group at 0 day for detecting the RNA target of the influenza A virus M2 gene was 27.45, the CT value of the nucleic acid detection reagent of the control group at 15 days for detecting the RNA target of the influenza A virus M2 gene was 34.19, and the CT value of the nucleic acid detection reagent of the experimental group at 15 days for detecting the RNA target of the influenza A virus M2 gene was 28.39. It can be seen that the nucleic acid detection reagent prepared by introducing an interferer is significantly more stable in detecting the RNA target after being stored at 2 - 8 °C for 15 days than the control group without introducing an interferer.

[0113] Example 3: Simultaneously detecting DNA target and RNA target Dual detection of DNA target and RNA target: Influenza A virus M2 gene and human β-actin gene RNA target: Influenza A virus M2 gene Upstream primer sequence: TCTTTCTATCATCCCATCAGGCC (SEQ ID NO:6) Downstream primer sequence: GAGGTGACAGGATCGGTCTT (SEQ ID NO:7) Probe sequence: CCTCAAAGCCGAGATCGCGCAGAGAC (SEQ ID NO:8) Upstream blocker sequence: GGC GA GATGGG-C3 (SEQ ID NO:9, Tm value: 39.6 °C) Downstream blocker sequence: AAG U CCGATC-C3 (SEQ ID NO:10, Tm value: 31.1 °C) Among them, the italicized bases indicate mismatched bases (i.e., the 4th and 5th bases in the 5'-to-3' direction of the nucleotide sequence indicated by SEQ ID NO:9, and the 4th base in the 5'-to-3' direction of the nucleotide sequence indicated by SEQ ID NO:10), and C3 represents C3 spacer modification.

[0114] DNA target: human β-action gene Upstream primer sequence: AACGAGCGGTTCCGCTGT (SEQ ID NO:11) Downstream primer sequence: TGGATGCCACAGGACTCC (SEQ ID NO:12) Probe: TCTTCCAGCCTTCCTTCCTGGGCAA (SEQ ID NO:13) Upstream blocker: ACA CG GGAAC-C3 (SEQ ID NO:14, Tm value: 30.3 °C) Downstream blocker: GGAG A CCTGTGG-C3 (SEQ ID NO:15, Tm value: 39.8 °C) Among them, the italicized bases indicate mismatched bases (i.e., the 4th and 5th bases in the 5'-to-3' direction of the nucleotide sequence indicated by SEQ ID NO:14, and the 5th base in the 5'-to-3' direction of the nucleotide sequence indicated by SEQ ID NO:15), and C3 represents C3 spacer modification.

[0115] The upstream primers, upstream interferons, downstream primers, and downstream interferons corresponding to the above-mentioned influenza A virus M2 gene and human β-actin gene were respectively prepared into a concentration of 200 μM with a primer diluent (10 mM Tris-HCl (pH 8.8), 150 mM KCl). Then, the upstream primers and upstream interferons, as well as the downstream primers and downstream interferons, were mixed at a dosage ratio of 1:2. After that, they were placed at 94 °C for 2 minutes and then in an environment of 20 °C for 30 minutes to obtain the upstream primer-upstream interferon double-stranded structure and the downstream primer-downstream interferon double-stranded structure, and finally stored in a -20 °C refrigerator.

[0116] Nucleic acid amplification system (total reaction volume 25 μL): Upstream primer-upstream interferon double-stranded structure, final concentration: 10 μM; Downstream primer-downstream interferon double-stranded structure, final concentration: 10 μM; Probe (diluted with DEPC water), final concentration: 5 μM; PCR Buffer: Prepared at a 5× concentration, final concentration: 10 mM Tris-HCl (pH 8.8), 50 mM KCl, 5 mM (NH 4 ) 2 SO 4 、2.0 mM MgCl 2 ; dNTPs: 50 mM; DNA polymerase: 20 U; Reverse transcriptase: 300 U; Total template: 5 μL.

[0117] DNA target and RNA target detection amplification conditions: Reverse transcription temperature: 55 °C, reverse transcription time: 30 min; Hot start temperature: 94 °C, hot start time: 10 min; Denaturation temperature: 94 °C, denaturation time: 10 s; Annealing and extension temperature: 60 °C, annealing and extension time: 40 s.

[0118] In this embodiment, an interferer is introduced into the experimental group (i.e., a double-stranded structure of upstream primer-upstream interferer and a double-stranded structure of downstream primer-downstream interferer are formed accordingly), and no interferer is introduced into the control group (i.e., only the upstream primer and the downstream primer are used). After preparing the nucleic acid amplification system as described above, the nucleic acid detection reagents of the experimental group and the control group are placed at -20 °C for 13 months, and the stability investigation results of the nucleic acid detection reagents of the two groups placed for 0 months and 13 months are compared (in this embodiment, the stability of the nucleic acid detection reagent is evaluated by examining the Ct value of the positive amplification curve detected by the corresponding nucleic acid detection reagent).

[0119] The experimental results are as Figure 3 and Figure 4 shown. The Ct value of the nucleic acid detection reagent of the control group placed at the 0th month for detecting the human β-action gene DNA target is 28.01, the Ct value of the nucleic acid detection reagent of the experimental group placed at the 0th month for detecting the human β-action gene DNA target is 27.72, the Ct value of the nucleic acid detection reagent of the control group placed at the 13th month for detecting the human β-action gene DNA target is 35.58, and the Ct value of the nucleic acid detection reagent of the experimental group placed at the 13th month for detecting the human β-action gene DNA target is 28.58. The Ct value of the nucleic acid detection reagent of the control group placed at the 0th month for detecting the influenza A virus M2 gene RNA target is 28.61, the Ct value of the nucleic acid detection reagent of the experimental group placed at the 0th month for detecting the influenza A virus M2 gene RNA target is 28.29, the Ct value of the nucleic acid detection reagent of the control group placed at the 13th month for detecting the influenza A virus M2 gene RNA target is 37.93, and the Ct value of the nucleic acid detection reagent of the experimental group placed at the 13th month for detecting the influenza A virus M2 gene RNA target is 28.84. It can be seen that the nucleic acid detection reagent prepared by introducing the interferer is significantly more stable in detecting DNA targets and RNA targets after being stored at -20 °C for 13 months than the control group without introducing the interferer.

[0120] The embodiments of the present invention have been described above in conjunction with the accompanying drawings. However, the present invention is not limited to the above specific embodiments. The above specific embodiments are merely illustrative and not restrictive. Under the inspiration of the present invention, those of ordinary skill in the art can also make many forms without departing from the spirit and scope protected by the claims of the present invention, and these all belong to the protection scope of the present invention.

Claims

1. A fully premixed nucleic acid detection reagent, characterized in that: The fully premixed nucleic acid detection reagent comprises at least the following components: (a) a buffer, (b) a DNA polymerase, or a combination of a DNA polymerase and a reverse transcriptase, and (c) a primer for detecting a target nucleic acid; The primers include an upstream primer and a downstream primer; wherein the primers have a double-stranded primer structure; the double-stranded primer structure includes a first strand and a second strand, the first strand is used to specifically bind to the target nucleic acid, the second strand is substantially complementary to the first strand, and there is a base mismatch between the second strand and the first strand; The first strand is longer than the second strand, the first strand and the second strand differ by at least 5 bases, the Tm value of the second strand is 30-50° C.; and the 3′ end of the second strand is a non-extendable nucleotide.

2. The nucleic acid detection reagent according to claim 1, characterized in that When the target nucleic acid is DNA, the Tm value of the second chain of the primer is 30-50°C; when the target nucleic acid is RNA, the Tm value of the second chain of the primer is 30-40°C; when the target nucleic acid includes DNA and RNA, the Tm value of the second chain of the primer is 30-40°C.

3. The nucleic acid detection reagent according to claim 1, characterized in that The fully premixed nucleic acid detection reagent also includes a probe for detecting target nucleic acid.

4. The nucleic acid detection reagent according to claim 1, characterized in that When the target nucleic acid is an adenovirus hexongene, the nucleic acid detection reagent includes (a) a buffer, (b) a DNA polymerase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a first primer and a second primer; the first primer has a double-stranded structure of a first upstream primer-a first upstream interferon, and the second primer has a double-stranded structure of a first downstream primer-a first downstream interferon; wherein the nucleotide sequence of the first upstream primer is as shown in SEQ ID NO:1, the nucleotide sequence of the first downstream primer is as shown in SEQ ID NO:2, the nucleotide sequence of the first upstream interferon is as shown in SEQ ID NO:4, and the nucleotide sequence of the first downstream interferon is as shown in SEQ ID NO:5; the probe for detecting the target nucleic acid is a first probe, and the nucleotide sequence of the first probe is as shown in SEQ ID NO:

3.

5. The nucleic acid detection reagent according to claim 1, characterized in that When the target nucleic acid is influenza A virus M2 gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a combination of DNA polymerase and reverse transcriptase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a third primer and a fourth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferon is shown in SEQ ID NO:9, and the nucleotide sequence of the second downstream interferon is shown in SEQ ID NO:10; the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is shown in SEQ ID NO:

8.

6. The nucleic acid detection reagent according to claim 1, characterized in that When the target nucleic acid is influenza A virus M2 gene and human β-action gene, the nucleic acid detection reagent includes (a) a buffer, (b) a combination of DNA polymerase and reverse transcriptase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Wherein, the primers for detecting the target nucleic acid specifically include: a third primer, a fourth primer, a fifth primer and a sixth primer; the third primer has a second upstream primer-second upstream interferor double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferor double-stranded structure; the nucleotide sequence of the second upstream primer is shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferon is shown in SEQ ID NO:9, the nucleotide sequence of the second downstream interferon is shown in SEQ ID NO:10, the fifth primer has a third upstream primer-third upstream interferor double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferor double-stranded structure; wherein the nucleotide sequence of the third upstream primer is shown in SEQ ID NO:11, the nucleotide sequence of the third downstream primer is shown in SEQ ID NO:12, the nucleotide sequence of the third upstream interferon is shown in SEQ ID NO:14, and the nucleotide sequence of the third downstream interferon is shown in SEQ ID NO:15; The probe for detecting the target nucleic acid includes a second probe and a third probe, the nucleotide sequence of the second probe is shown in SEQ ID NO:8, and the nucleotide sequence of the third probe is shown in SEQ ID NO:

13.

7. A use of a double-stranded primer structure in improving the storage stability of a nucleic acid detection reagent, characterized in that: The nucleic acid detection reagent comprises at least the following components: (a) a buffer, (b) a DNA polymerase, or a combination of a DNA polymerase and a reverse transcriptase, and (c) a primer for detecting a target nucleic acid; The primers include an upstream primer and a downstream primer; wherein the primers have a double-stranded primer structure; the double-stranded primer structure includes a first strand and a second strand, the first strand is used to specifically bind to the target nucleic acid, the second strand is substantially complementary to the first strand, and there is a base mismatch between the second strand and the first strand; The first strand is longer than the second strand, the first strand and the second strand differ by at least 5 bases, the Tm value of the second strand is 30-50° C.; and the 3′ end of the second strand is a non-extendable nucleotide.

8. The use according to claim 7, characterized in that When the target nucleic acid is an adenovirus hexon gene, the nucleic acid detection reagent includes (a) a buffer, (b) a DNA polymerase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a first primer and a second primer; the first primer has a double-stranded structure of a first upstream primer-a first upstream interferon, and the second primer has a double-stranded structure of a first downstream primer-a first downstream interferon; wherein the nucleotide sequence of the first upstream primer is as shown in SEQ ID NO:1, the nucleotide sequence of the first downstream primer is as shown in SEQ ID NO:2, the nucleotide sequence of the first upstream interferon is as shown in SEQ ID NO:4, and the nucleotide sequence of the first downstream interferon is as shown in SEQ ID NO:5; the probe for detecting the target nucleic acid is a first probe, and the nucleotide sequence of the first probe is as shown in SEQ ID NO:

3.

9. The use according to claim 7, characterized in that When the target nucleic acid is influenza A virus M2 gene, the nucleic acid detection reagent comprises (a) a buffer, (b) a combination of DNA polymerase and reverse transcriptase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Among them, the primers for detecting the target nucleic acid specifically include: a third primer and a fourth primer; the third primer has a second upstream primer-second upstream interferon double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferon double-stranded structure; the nucleotide sequence of the second upstream primer is shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferon is shown in SEQ ID NO:9, and the nucleotide sequence of the second downstream interferon is shown in SEQ ID NO:10; the probe for detecting the target nucleic acid is a second probe, and the nucleotide sequence of the second probe is shown in SEQ ID NO:

8.

10. The use according to claim 7, characterized in that When the target nucleic acid is influenza A virus M2 gene and human β-action gene, the nucleic acid detection reagent includes (a) a buffer, (b) a combination of DNA polymerase and reverse transcriptase, (c) a primer for detecting the target nucleic acid, and (d) a probe for detecting the target nucleic acid; Wherein, the primers for detecting the target nucleic acid specifically include: a third primer, a fourth primer, a fifth primer and a sixth primer; the third primer has a second upstream primer-second upstream interferor double-stranded structure, and the fourth primer has a second downstream primer-second downstream interferor double-stranded structure; the nucleotide sequence of the second upstream primer is shown in SEQ ID NO:6, the nucleotide sequence of the second downstream primer is shown in SEQ ID NO:7, the nucleotide sequence of the second upstream interferon is shown in SEQ ID NO:9, the nucleotide sequence of the second downstream interferon is shown in SEQ ID NO:10, the fifth primer has a third upstream primer-third upstream interferor double-stranded structure, and the sixth primer has a third downstream primer-third downstream interferor double-stranded structure; wherein the nucleotide sequence of the third upstream primer is shown in SEQ ID NO:11, the nucleotide sequence of the third downstream primer is shown in SEQ ID NO:12, the nucleotide sequence of the third upstream interferon is shown in SEQ ID NO:14, and the nucleotide sequence of the third downstream interferon is shown in SEQ ID NO:15; The probe for detecting the target nucleic acid includes a second probe and a third probe, the nucleotide sequence of the second probe is shown in SEQ ID NO:8, and the nucleotide sequence of the third probe is shown in SEQ ID NO:13.

Images