Drug-resistant marker for treating prostatic cancer olaparil and application of drug-resistant marker
By using the PCAR1 gene as a marker of drug resistance in the treatment of olaparib and combining a combination of olaparib and PCAR1-specific siRNA, the deficiency of drug resistance in the treatment of olaparib in the prior art has been solved, and precise treatment of prostate cancer has been achieved and the therapeutic effect has been significantly improved.
Patent Information
- Application Number
- CN202510526695.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-25
- Publication Date
- 2025-05-30
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The existing abiraterone resistance markers for prostate cancer have a narrow scope of application and cannot effectively solve the problem of olaparidine treatment resistance.
The PCAR1 gene was used as a marker of resistance to olaparib for treatment. The patient's drug resistance was judged by detecting the expression level of PCAR1, and combined with a combination of olaparib and PCAR1-specific siRNA treatment plan to inhibit cancer cell proliferation and promote apoptosis.
It has achieved accurate judgment on the resistance of olaparidine, expanded the scope of precise treatment, significantly improved the effectiveness of treatment, and provided new hope for the treatment of prostate cancer.
Smart Images

Figure CN120060476A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of medical technology, and specifically to a biomarker for olaparib treatment resistance in prostate cancer and its application. Background Art
[0002] Prostate cancer (PCa) ranks second among male malignant tumors in terms of global incidence. Most prostate cancers diagnosed in China are patients with local advanced or extensive metastases. For patients with extensive metastatic prostate cancer, they cannot receive local radical treatment and can only receive endocrine therapy or chemotherapy, etc.
[0003] The invention with the publication number CN118460722A discloses a novel endocrine therapy resistance biomarker for advanced prostate cancer and its application. The biomarker is DENND3. It is first discovered that the expression level of the DENND3 gene in prostate cancer cells resistant to abiraterone is significantly higher than that in parental prostate cancer cells. Therefore, by measuring the expression level of the DENND3 gene, it can be used as a basis for judging the resistance / sensitivity of drug users to abiraterone. The provided DENND3 gene-specific siRNAs can efficiently inhibit or knockdown the expression of the DENND3 gene in target cells, thereby promoting apoptosis, inhibiting the proliferation of abiraterone-resistant prostate cancer cells, and further inhibiting the growth of prostate cancer cells. As shown in the above invention, the existing resistance biomarkers only target abiraterone resistance in prostate cancer. The discovery of DENND3 as a biomarker is based on a single drug and gene regulation, and the scope of application is narrow. Summary of the Invention
[0004] Aiming at the deficiencies of the prior art, the present invention provides a biomarker for olaparib treatment resistance in prostate cancer and its application, and solves the existing problems.
[0005] To achieve the above objectives, the present invention is realized through the following technical solutions: A biomarker for olaparib treatment resistance in prostate cancer, the biomarker is the PCAR1 gene, and its nucleotide sequence is as shown in SEQ ID NO: 7.
[0006] Preferably, the application of the biomarker in preparing a reagent for detecting olaparib treatment resistance in prostate cancer or preparing a drug for treating prostate cancer or preparing a drug for inhibiting the proliferation of olaparib-resistant prostate cancer cells.
[0007] The present invention also discloses a kit for detecting olaparib treatment resistance in prostate cancer, which includes a specific primer pair for the biomarker, a primer pair for the internal reference gene GAPDH, and a qPCR reaction premix.
[0008] The present invention also discloses the application of a kit for detecting resistance to olaparib treatment in prostate cancer in detecting resistance to olaparib treatment in prostate cancer. The kit is used for scientific research detection for non-diagnostic purposes or clinical auxiliary diagnosis, and the drug resistance is judged by the following criteria: When the expression level of PCAR1 ≥ 2.0 times the threshold, it is determined as drug resistance.
[0009] The present invention also discloses the application of a therapeutic drug composition for treating prostate cancer resistant to olaparib, advanced prostate cancer with high PCAR1 expression, and tumors that require reversal of abnormal DNA damage repair pathways.
[0010] The present invention also discloses a treatment method, including: Detecting the PCAR1 expression level of the patient; Administering the composition to patients with high expression; The combined treatment regimen is: olaparib 300 mg bid + siRNA-PCAR1 1 mg / kg / wk.
[0011] Preferably, the treatment cycle is 6-8 weeks, and during the treatment, the following are monitored: changes in PSA level, imaging evaluation of tumor volume, and PCAR1 expression in circulating tumor cells.
[0012] Preferably, the PCAR1 protein mediates drug resistance by regulating the following pathways: Homologous recombination repair (HRR) pathway; Base excision repair (BER) pathway; Cell cycle checkpoint regulation.
[0013] The present invention also discloses a gene editing treatment method for knocking out the PCAR1 gene using the CRISPR / Cas9 system, including the following steps: Step 1: Design sgRNA targeting exon 2 of PCAR1; Step 2: Use an adeno-associated virus (AAV) delivery system to deliver the designed sgRNA and Cas9 protein to target cells; Step 3: After the CRISPR / Cas9 system cuts exon 2 of PCAR1, use the homologous recombination template sequence (SEQ ID NO: 9) for gene repair and editing to achieve knockout of the PCAR1 gene.
[0014] Preferably, the PCAR1 gene detection primer design table:
[0015] The forward primer of PCAR1 is used for qPCR amplification of the PCAR1 gene, which binds complementarily to a specific region of the PCAR1 gene to initiate the DNA synthesis reaction, thereby achieving the amplification of the PCAR1 gene for detecting its expression level; the reverse primer of PCAR1 cooperates with the forward primer to determine the other end boundary of the amplified fragment in the qPCR reaction, ensuring the specificity and accuracy of the amplification; the forward primer of the internal reference gene GAPDH, as an internal reference primer, is used to simultaneously amplify the internal reference gene GAPDH. In the qPCR reaction, the expression of the GAPDH gene is used as a reference to correct the expression level of the PCAR1 gene, eliminating the differences in aspects such as RNA extraction, reverse transcription, and PCR reaction efficiency among different samples, making the comparison of the PCAR1 gene expression levels among different samples more accurate; the reverse primer of the internal reference gene GAPDH and the forward primer of the internal reference gene GAPDH work together to achieve the effective amplification of the GAPDH gene.
[0016] Preferably, the design table of PCAR1-specific siRNA primers:
[0017] The sense strand of siRNA-PCAR1 is complementary to the mRNA of the PCAR1 gene and binds to the antisense strand in the cell to form a double-stranded RNA structure. Through the RNA interference mechanism, it guides nucleases to recognize and cleave the mRNA of the PCAR1 gene, thereby inhibiting the expression of the PCAR1 gene; the antisense strand of siRNA-PCAR1 forms a double-stranded RNA with the sense strand, jointly mediating the RNA interference process, enhancing the degradation effect on the mRNA of the PCAR1 gene, and effectively reducing the expression level of the PCAR1 gene.
[0018] Preferably, the homologous recombination template sequence (SEQ ID NO: 9) is: ATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC, and its primer design table:
[0019] The forward primer is used for amplifying the forward primer of the homologous recombination template sequence, guiding DNA polymerase to synthesize a new DNA strand starting from the 5' end of the template; the reverse primer is used for amplifying the reverse primer of the homologous recombination template sequence, which cooperates with the forward primer to synthesize a new DNA strand starting from the 3' end of the template, thereby achieving the amplification of the homologous recombination template sequence.
[0020] Beneficial effects The present invention provides a biomarker for olaparib treatment resistance in prostate cancer and its application. Compared with the prior art, it has the following beneficial effects: 1. The Olaparib treatment resistance marker for prostate cancer and its application. By using PCAR1 as the Olaparib resistance marker, it can accurately judge the drug resistance of patients to Olaparib, providing more accurate guidance for the treatment of prostate cancer patients with Olaparib, expanding the scope of precision treatment, helping doctors formulate more appropriate treatment plans for patients, and improving the treatment effect.
[0021] 2. The Olaparib treatment resistance marker for prostate cancer and its application. Through the combined treatment regimen of Olaparib and PCAR1-specific siRNA, it has a synergistic effect in overcoming Olaparib resistance. This combined regimen targets the Olaparib resistance mechanism, can more effectively inhibit cancer cell proliferation and promote cancer cell apoptosis, bringing new treatment hopes for prostate cancer patients and enhancing the effectiveness of treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 It is a flow chart for the discovery and verification of the resistance marker of the present invention.
[0023] Figure 2 It is a graph showing the differential expression of the PCAR1 gene of the present invention.
[0024] Figure 3 It is a graph for verifying the effect of siRNA knockdown of PCAR1 of the present invention.
[0025] Figure 4 It is a graph for detecting cell apoptosis of the present invention.
[0026] Figure 5 It is a graph for verifying the experimental data of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0027] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0028] Refer to Figures 1-5 , the present invention provides the following various technical solutions: The first embodiment: Discovery and verification of the resistance marker 1. Construction of cell model Induction of drug-resistant cells Select LNCaP cells in the logarithmic growth phase with good growth status and inoculate them in a 6-well plate at an appropriate density (such as cells per well). At 37 °C, In an incubator, culture using RPMI-1640 medium containing 10% fetal bovine serum and 1% penicillin-streptomycin.
[0029] When the cell confluence reaches approximately 70%-80%, start the increasing gradient concentration treatment of olaparib. The initial olaparib concentration is set at 0.1 μM and cultured for 3 generations. During each generation of culture, closely observe the cell growth status, including cell morphology, proliferation rate, etc. When the cells grow stably at this concentration and the proliferation rate has no significant difference from that under normal culture conditions, increase the olaparib concentration to 0.2 μM, and gradually increase the concentration to 50 μM in this way. The entire induction process lasts for 6 months.
[0030] During the induction process, regularly passage the cells. When passaging, strictly control the consistency of cell seeding density and culture conditions. At the same time, set up control group cells without adding olaparib to compare and observe the changes in cell growth and drug resistance characteristics.
[0031] Drug resistance verification Detect IC50 by CCK-8 method: Seed the LNCaP-OlaR drug-resistant cell line and parental LNCaP cells into 96-well plates at a density of 3×10³ cells per well, with 6 replicates in each group. After culturing for 24 hours, add olaparib at different concentration gradients (such as 0.01 μM, 0.1 μM, 1 μM, 10 μM, 100 μM) and continue culturing for 72 hours.
[0032] Add 10 μL of CCK-8 solution to each well and continue to incubate for 2 hours. Use an enzyme-linked immunosorbent assay (ELISA) reader to measure the absorbance value of each well at a wavelength of 450 nm. Plot the cell growth inhibition curve with the logarithm of drug concentration as the abscissa and cell survival rate (calculated with the absorbance value of the control group as 100%) as the ordinate.
[0033] Calculate the IC50 value by non-linear regression analysis using GraphPad Prism software. Calculate the resistance index RI = IC50 resistant / IC50 parental. In this experiment, the resistance index RI = 8.7 (P < 0.01), indicating that an olaparib-resistant cell model has been successfully constructed.
[0034] Verify drug resistance by colony formation assay: Seed the LNCaP-OlaR cells and parental LNCaP cells into 6-well plates at a density of 500 cells per well. After culturing for 24 hours, add 10 μM olaparib and continue culturing for 10 - 14 days until cell colonies visible to the naked eye are formed.
[0035] Discard the culture medium, gently rinse the cells with PBS twice, add 4% paraformaldehyde to fix for 15 minutes, and then stain with 0.1% crystal violet for 15 minutes. Rinse off the excess dye with running water, air dry, and count the number of clones under the microscope (a clone is defined as a cell cluster containing more than 50 cells). Calculate the colony formation rate (colony formation rate = number of clones / number of inoculated cells × 100%). The results showed that the colony formation rate of LNCaP-OlaR cells under olaparib treatment was significantly higher than that of parental LNCaP cells, further verifying the successful construction of the drug-resistant cell model.
[0036] 2. Gene expression analysis RNA-seq screening Collect LNCaP-OlaR cells and parental LNCaP cells in the logarithmic growth phase respectively, and extract total RNA using Trizol reagent according to the instructions. The concentration and purity of the extracted RNA were measured by Nanodrop2000 (the A260 / A280 ratio should be between 1.8 - 2.2, and the A260 / A230 ratio should be greater than 2.0), and the integrity of the RNA was detected by agarose gel electrophoresis.
[0037] Take 1 μg of high-quality total RNA for mRNA enrichment, and use: NEBNext Ultra II Directional RNA Library Prep Kit for Illumina to construct a cDNA library. After the constructed library was quantified by Qubit and the library size and concentration were detected by Agilent 2100 Bioanalyzer, Illumina HiSeq sequencing was performed with a sequencing depth of 30M reads.
[0038] Perform quality control on the raw data obtained from sequencing, and remove low-quality reads and adapter sequences. Use HISAT2 software to align the clean reads to the human reference genome (such as GRCh38), and use StringTie software for transcript assembly and quantitative analysis. Perform differential expression gene analysis through DESeq2 software, and the screening conditions are and P < 0.05. The result found that the expression of PCAR1 (NM_001282566) was upregulated by 5.3-fold.
[0039] qPCR verification Collect clinical prostate cancer tissue samples, and divide them into olaparib-resistant group and sensitive group. Extract total RNA from tissue samples using Trizol reagent and reverse transcribe to synthesize cDNA.
[0040] Design specific primer pairs for PCAR1 and primer pairs for the internal reference gene GAPDH. The qPCR reaction system is 20 μL, including 10 μL SYBR Green PCR Master Mix, 0.5 μL of each upstream and downstream primer, 2 μL of cDNA template, and .
[0041] The reaction conditions are as follows: pre-denaturation at 95 °C for 10 minutes, followed by 45 cycles, each cycle including denaturation at 95 °C for 15 seconds and annealing extension at 60 °C for 60 seconds. Three replicates are set for each sample, and detection is performed using the 7500 Real-Time PCR System. The relative expression level of the PCAR1 gene is calculated by the ΔΔCT method, and the results show that the expression level of PCAR1 in the drug-resistant group is 4.1 ± 1.2 times that in the sensitive group (P < 0.001).
[0042] Fluorescence in situ hybridization (FISH) verification: Take clinical prostate cancer tissue samples to make paraffin sections. After pretreatment such as dewaxing, hydration, and protease K digestion, add a fluorescently labeled probe for the PCAR1 gene and hybridize overnight at 37 °C. After hybridization, perform strict washing of the slides to remove unbound probes. Use DAPI to counterstain the cell nuclei and observe and photograph under a fluorescence microscope. The results show that the fluorescence signal intensity of the PCAR1 gene in the olaparib-resistant tissue samples is significantly higher than that in the sensitive tissue samples, further verifying the results of qPCR.
[0043] 3. Functional verification siRNA knockdown Design and synthesize siRNA for PCAR1 (siRNA-PCAR1) and negative control siRNA (random sequence, no homology). Seed LNCaP-OlaR cells into a 6-well plate at a density of cells per well, culture for 24 hours, and when the cell confluence reaches about 50% - 60%, perform transfection.
[0044] Use Lipofectamine 3000 transfection reagent to perform transfection operations according to the instructions. Dilute siRNA and Lipofectamine 3000 with Opti-MEM medium respectively, then mix evenly, and add to the cell culture medium after incubating at room temperature for 15 minutes. Collect cells 48 hours after transfection.
[0045] Extract total cellular RNA and detect the expression level of the PCAR1 gene by qPCR. The results show that after transfection with siRNA-PCAR1, the expression of PCAR1 decreased by 78%. At the same time, use the Annexin V-FITC / PI double staining method to detect the apoptosis rate by flow cytometry, and the results show that the apoptosis rate increased by 2.3 times (P < 0.05).
[0046] Verification of the knockdown effect by Western blot: The transfected cells were collected, and the total cellular proteins were extracted using RIPA lysis buffer. The protein concentration was determined by the BCA method. Equal amounts of protein samples were separated by SDS-PAGE electrophoresis and then transferred to PVDF membranes. After blocking the membranes with 5% non-fat milk for 1 hour, anti-PCAR1 antibody (diluted 1:1000) and anti-GAPDH antibody (diluted 1:5000) were added, and the incubation was carried out overnight at 4°C. The next day, the membranes were washed 3 times with TBST for 10 minutes each time, and then the corresponding secondary antibody (diluted 1:5000) was added and incubated at room temperature for 1 hour. The membranes were washed again 3 times with TBST for 10 minutes each time, and ECL luminescent solution was used for development. The results showed that after transfection with siRNA-PCAR1, the expression of PCAR1 protein was significantly decreased, further verifying the knockdown effect of siRNA.
[0047] Tumorigenicity assay in nude mice Male BALB / c nude mice at 4 - 6 weeks of age were selected. After 1 week of adaptive feeding, they were randomly divided into two groups of 6 mice each. One group was inoculated with LNCaP-OlaR cells with knocked-down PCAR1, and the other group was inoculated with LNCaP-OlaR cells transfected with negative control siRNA.
[0048] The cells were resuspended in PBS, and the cell concentration was adjusted to cells / 100 μL, and 100 μL of the cell suspension was subcutaneously injected into the right axilla of each nude mouse. After inoculation, the long diameter (L) and short diameter (W) of the tumors were measured with a vernier caliper every 3 days, and the tumor volume was calculated according to the formula V = 0.5 × L × W².
[0049] After 4 weeks of the experiment, the nude mice were sacrificed, the tumor tissues were removed, weighed, and photographed. The results showed that the tumor volume with knocked-down PCAR1 was reduced by 62% compared with the control group (P < 0.01), indicating that the knockdown of the PCAR1 gene could inhibit tumor growth.
[0050] Immunohistochemical detection of PCAR1 expression in tumor tissues: The removed tumor tissues were made into paraffin sections. After pretreatment such as dewaxing, hydration, and antigen repair, anti-PCAR1 antibody (diluted 1:200) was added and incubated overnight at 4°C. The next day, the sections were washed 3 times with PBS for 5 minutes each time, and then biotin-labeled secondary antibody (diluted 1:500) was added and incubated at room temperature for 30 minutes. The sections were washed again 3 times with PBS for 5 minutes each time, streptavidin-HRP complex was added and incubated at room temperature for 30 minutes. DAB chromogenic solution was used for color development, the cell nuclei were counterstained with hematoxylin, and after dehydration, clearing, and mounting, the sections were observed under a microscope. The results showed that the positive expression rate of PCAR1 in the tumor tissues of the group with knocked-down PCAR1 was significantly lower than that of the control group, further verifying the knockdown effect of siRNA.
[0051] The second implementation method: Detection reagent development 1. Primer design Principle for designing specific primer pairs: According to the cDNA sequence of the PCAR1 gene, use Primer3 software to design specific primer pairs. The primer length is between 18 - 25 bp, and the GC content is between 40% - 60%. Avoid forming primer dimers and hairpin structures. Ensure that the primers have no significant homology with other genes through BLAST alignment.
[0052] Primer synthesis and verification: Hand over the designed primers to a professional biotechnology company for synthesis. The synthesized primers are purified by PAGE to remove impurities. Verify the specificity and amplification efficiency of the primers through qPCR. Using LNCaP - OlaR cell cDNA as a template, set different concentrations of cDNA for gradient dilution and draw a standard curve. The results show that the amplification efficiency of the primers is between 90% - 110%, and the melting curve shows a single peak, indicating that the primers have good specificity and amplification efficiency.
[0053] Selection of reference gene and primer design: Select GAPDH as the reference gene and design primer pairs according to its gene sequence. Similarly, synthesize, purify, and verify the GAPDH primers to ensure their stable expression and good amplification efficiency in different samples.
[0054] 2. Composition of the kit Premix The premix contains Taq enzyme, dNTPs, and other components. The Taq enzyme is a thermostable DNA polymerase with high fidelity and high amplification efficiency, and its concentration is 1 U / μL. dNTPs is a mixture of four deoxynucleotides, and the concentration of each nucleotide is 2.5 mM. The concentration of is 2.5 mM to provide the magnesium ions required for Taq enzyme activity.
[0055] An appropriate amount of reaction buffer is also added to the premix to maintain the pH value and ionic strength of the reaction system. The buffer contains components such as Tris - HCl (pH 8.3), KCl, etc., to ensure that the qPCR reaction proceeds under suitable conditions.
[0056] Positive control The positive control is a plasmid containing PCAR1 cDNA. Clone the cDNA fragment of the PCAR1 gene into the pUC19 vector to construct a recombinant plasmid. Verify the correctness of the recombinant plasmid through restriction enzyme digestion identification and sequencing. Amplify and purify the recombinant plasmid in large quantities and adjust its concentration to copies / μL as the positive control.
[0057] The positive control is used to verify the effectiveness of the qPCR reaction system and the specificity of the primers. In each test, a positive control well is set. If the amplification curve of the positive control well is normal and the Ct value is within the expected range, it indicates that the reaction system and the primers are working properly.
[0058] Negative control The negative control is template-free water, which is used to detect whether there is contamination in the qPCR reaction system. In each test, a negative control well is set. If there is no amplification signal in the negative control well, it indicates that the reaction system is not contaminated.
[0059] Lysis buffer The lysis buffer contains components such as guanidine salts (e.g., guanidine isothiocyanate), β-mercaptoethanol, and NP-40. Guanidine salts can rapidly lyse cells, denature proteins, and release nucleic acids. β-mercaptoethanol has reducing properties and can prevent RNA from being oxidized and degraded. NP-40 is a non-ionic surfactant that helps to disrupt cell membranes and nuclear membranes and improve the efficiency of nucleic acid extraction.
[0060] An RNase inhibitor is also added to the lysis buffer to prevent RNA from being degraded by RNase during extraction. The concentration of the RNase inhibitor is 40 U / mL, which can effectively inhibit the activities of endogenous and exogenous RNases.
[0061] 3. Detection procedure Sample preparation Take 100 mg of tumor tissue and place it in a pre-cooled homogenization tube. Add 1 mL of lysis buffer. Use a tissue homogenizer to homogenize on ice until the tissue is completely broken. During homogenization, pay attention to avoid generating too many bubbles, as this may affect the efficiency of RNA extraction.
[0062] Transfer the homogenate to a 1.5 mL centrifuge tube and let it stand at room temperature for 5 minutes to allow the nucleic acids to be fully released. Then centrifuge at 12,000 rpm for 10 minutes at 4°C and transfer the supernatant to a new centrifuge tube.
[0063] RNA extraction Add 0.2 mL of chloroform to the supernatant and shake vigorously for 15 seconds. Let it stand at room temperature for 2 - 3 minutes. Then centrifuge at 12,000 rpm for 15 minutes at 4°C. At this time, the solution is divided into three layers: the upper layer is a colorless and transparent aqueous phase, the middle layer is a white protein layer, and the lower layer is a red organic phase.
[0064] Transfer the upper aqueous phase to a new centrifuge tube, add 0.5 mL of isopropanol, gently invert and mix well, and let it stand at room temperature for 10 minutes. Then centrifuge at 12,000 rpm for 10 minutes at 4°C, and a white RNA precipitate can be seen at the bottom of the tube.
[0065] Discard the supernatant, add 1 mL of 75% ethanol, and gently invert to wash the precipitate. Centrifuge at 7500 rpm for 5 minutes at 4°C, discard the ethanol, and invert the centrifuge tube on absorbent paper to dry until the RNA precipitate is completely dry.
[0066] An appropriate amount of RNase-free water was added to dissolve the RNA precipitate, and the concentration and purity of RNA were determined using Nanodrop2000, and the integrity of RNA was detected by agarose gel electrophoresis.
[0067] Reverse transcription 1 μg RNA was added to the reverse transcription reaction system, which included 5× reverse transcription buffer, dNTPs, random primers, M-MLV reverse transcriptase and RNase inhibitor. The reaction conditions were: incubation at 25°C for 10 minutes, incubation at 42°C for 60 minutes, and incubation at 70°C for 15 minutes to inactivate the reverse transcriptase.
[0068] After the reverse transcription reaction was completed, the cDNA product was stored at -20°C for future use.
[0069] qPCR reaction Prepare qPCR reaction system, the reaction system is 20μL, including 10μL SYBRGreenPCRMasterMix, 0.5μL upstream and downstream primers, 2μL cDNA template and The reaction system was added to a 96-well plate dedicated to qPCR, and 3 replicate wells were set for each sample.
[0070] The 96-well plate was placed in the 7500 Real-Time PCR System, and the reaction conditions were set as follows: pre-denaturation at 95°C for 10 minutes, followed by 45 cycles, each cycle including denaturation at 95°C for 15 seconds and annealing and extension at 60°C for 60 seconds. Fluorescence signals were collected during the annealing and extension phase of each cycle.
[0071] Results Analysis The qPCR data were analyzed using the software provided by the 7500 Real-Time PCR System to obtain the Ct value of each sample. The relative expression of the PCAR1 gene was calculated using the ΔΔCT method, and the calculation formula was: ΔΔCT = (CtPCAR1-CtGAPDH) sample-(CtPCAR1-CtGAPDH) control. The relative expression of the control sample was taken as 1 to calculate the relative expression of other samples.
[0072] The threshold was set at a 2.0-fold difference, that is, when the relative expression of the PCAR1 gene in the sample was greater than 2.0 times that of the control sample, PCAR1 was judged to be highly expressed, indicating possible resistance to Olaparib; when the relative expression was less than 2.0 times, PCAR1 was judged to be lowly expressed, indicating possible sensitivity to Olaparib.
[0073] The third implementation method: Therapeutic drug development 1. siRNA design Sequence optimization Initial design: With the help of bioinformatics software, multiple siRNA sequences are designed based on the mRNA sequence of the PCAR1 gene. Many factors need to be considered during the design, such as thermodynamic properties, base composition, and secondary structure. For example, it is necessary to ensure that the double-stranded siRNA has an appropriate melting temperature to facilitate binding to the target mRNA; the base composition should avoid consecutive G or C to prevent the formation of complex secondary structures that affect the binding efficiency.
[0074] Chemical modification: Chemical modification is performed on the selected potentially highly efficient siRNA sequences. Methylation modification is carried out at the 2'-hydroxyl position of siRNA, which can enhance its stability, reduce the possibility of being degraded by nucleases, and extend its action time in vivo. At the same time, two deoxythymidines (TT) are added to the 3' ends of the sense strand and the antisense strand, which can improve the binding affinity of siRNA to the target mRNA and enhance the silencing effect.
[0075] Synthesis and purification: The designed siRNA sequences (such as siRNA-PCAR1-1) and siRNA with a random non-homologous sequence as a control are synthesized. After synthesis, PAGE (polyacrylamide gel electrophoresis) method is used for purification to remove impurities and ensure the quality of siRNA.
[0076] Verification of siRNA transfection efficiency Cell transfection: Seed LNCaP-OlaR cells into a 6-well plate at a density of cells per well and culture for 24 hours. When the cell confluence reaches 50%-60%, use Lipofectamine3000 transfection reagent to transfect the fluorescently labeled (such as FAM-labeled) siRNA into the cells. Lipofectamine3000 can form a complex with siRNA to help it enter the cells.
[0077] Flow cytometry detection: 48 hours after transfection, use flow cytometry to detect the fluorescence signal intensity in the cells. By analyzing the proportion of fluorescent positive cells, calculate the transfection efficiency. If the transfection efficiency reaches more than 80%, it indicates that the transfection method is feasible and can effectively introduce siRNA into the cells.
[0078] Observation under fluorescence microscope: Seed the cells transfected with fluorescently labeled siRNA into a confocal culture dish and observe under a fluorescence microscope 48 hours after transfection. If there are obvious fluorescence signals in most cells, the transfection efficiency can be further verified.
[0079] 2. Drug composition Formulation Preparation of Olaparib Solution: Weigh olaparib accurately according to the body weight of experimental animals, with a dose of 50 mg / kg. First, dissolve olaparib in DMSO (dimethyl sulfoxide) to prepare a stock solution of 10 mg / mL, and then dilute it with normal saline to the required concentration. DMSO can help dissolve olaparib, but its proportion in the final solution needs to be controlled to avoid toxicity to cells or animals.
[0080] Preparation of siRNA-PCAR1 Solution: Dissolve the synthesized siRNA-PCAR1 in RNase-free water to prepare a solution of 1 mg / mL, with a dose of 10 mg / kg. RNase-free water can prevent RNA degradation and ensure the activity of siRNA.
[0081] Preparation of Cationic Liposome Carrier: Select cationic liposome (DOTAP:Chol = 3:1) as the carrier. Dissolve DOTAP (1,2-dioleoyl-3-trimethylammonium-propane) and Chol (cholesterol) in chloroform at a molar ratio of 3:1, and remove chloroform by rotary evaporation to form a lipid film. Then add an appropriate amount of PBS buffer and sonicate to hydrate the lipid film to form cationic liposomes. Cationic liposomes carry a positive charge and can bind to negatively charged olaparib and siRNA-PCAR1 to form stable complexes.
[0082] Formation of Drug Composition: Mix the olaparib solution, siRNA-PCAR1 solution and cationic liposomes in a certain proportion and incubate at room temperature for 30 minutes to encapsulate olaparib and siRNA-PCAR1 in cationic liposomes to form a drug composition.
[0083] Form of Preparation Preparation of Freeze-dried Injection: Dispense the prepared drug composition solution into vials and place them in a freeze dryer for freeze-drying. The freeze-drying process includes three stages: pre-freezing, sublimation drying and desorption drying. The pre-freezing temperature is set at -40°C and maintained for 2 hours to completely freeze the solution; in the sublimation drying stage, the vacuum is reduced to 0.1 mbar and the temperature is gradually raised to -20°C and maintained for 24 hours to directly sublime ice into water vapor and remove it; in the desorption drying stage, the temperature is raised to 25°C and maintained for 12 hours to further remove residual moisture.
[0084] Redissolution and Quality Requirements: The freeze-dried injection appears as a loose block and has good redissolution. Before use, it is redissolved with normal saline, and the redissolved solution should be clear and transparent without visible particles to ensure the safety and effectiveness of the drug.
[0085] 3. Verification of Synergistic Effect Calculation of CI Index Experimental grouping and treatment: LNCaP-OlaR cells were seeded into 96-well plates at a density of 3×10³ cells per well. After 24 hours of culture, an olaparib single-drug group, an siRNA-PCAR1 single-drug group, and a combination drug group were set up. Different concentration gradients of olaparib were set (such as 0.01 μM, 0.1 μM, 1 μM, 10 μM, 100 μM), and different concentration gradients of siRNA-PCAR1 were set (such as 1 nM, 10 nM, 100 nM, 1 μM). The combination drug group was combined according to different drug ratios.
[0086] Cell viability detection and analysis: After 72 hours of culture, the cell viability was detected by the CCK-8 method. The inhibition rate at different drug concentrations was calculated based on the cell viability, and the CompuSyn software was used to analyze the synergistic effect of the combination drug, and the CI index was calculated. If CI = 0.68 (synergistic effect), it indicates that the combined use of olaparib and siRNA-PCAR1 can synergistically inhibit cell proliferation.
[0087] Apoptosis detection Cell treatment and staining: LNCaP-OlaR cells were seeded into 6-well plates at a density of cells per well. After 24 hours of culture, olaparib single-drug, siRNA-PCAR1 single-drug, and combination drug treatments were added respectively. After 48 hours of treatment, the cells were collected and stained with AnnexinV-FITC / PI double staining. AnnexinV-FITC can bind to phosphatidylserine on the surface of apoptotic cells, and PI can enter necrotic cells. Apoptotic cells and necrotic cells can be distinguished by flow cytometry.
[0088] Flow cytometry detection and result analysis: After staining, the apoptosis rate of the cells was detected by flow cytometry. If the apoptosis rate of the combination group (42.3%) was significantly higher than that of the single-drug group (the apoptosis rate of the olaparib single-drug group was 18.5%, and the apoptosis rate of the siRNA-PCAR1 single-drug group was 22.7%), it further verified the synergistic effect of the combination drug.
[0089] Verification by TUNEL method: The treated cells were made into cell smears and stained with a TUNEL apoptosis detection kit. Observed under a fluorescence microscope, if the TUNEL positive staining of the cells in the combination drug group increased significantly, it indicated that the combination drug could induce more cell apoptosis.
[0090] The fourth implementation method: Clinical application plan 1. Sample collection and detection: For patients suspected of having prostate cancer and intended to be treated with olaparib, before treatment, tumor tissue samples are obtained through prostate biopsy or surgical resection, and peripheral blood is collected to extract ctDNA. Then, according to a specific detection process, using the designed primer pairs and kits, after sample processing, RNA extraction, reverse transcription, and qPCR reaction, the expression level of the PCAR1 gene is detected, and the report results are reviewed by professionals.
[0091] 2. Treatment plan selection: According to the detection results of the PCAR1 gene expression, patients are divided into a high-expression group (expression level ≥ 2.0-fold threshold) and a low-expression group (expression level < 2.0-fold threshold). Patients with high expression are treated with combination therapy, taking olaparib 300 mg bid orally and injecting siRNA-PCAR1 1 mg / kg / wk intravenously, and adverse reactions are closely observed; patients with low expression are treated with olaparib 300 mg bid alone.
[0092] 3. Efficacy evaluation and monitoring Regular detection: The PSA level of patients is detected every 2 weeks using chemiluminescence immunoassay; imaging examinations such as pelvic MRI and whole-body bone scan are performed every 4 - 6 weeks to evaluate the tumor size and metastasis situation.
[0093] Efficacy judgment: If the PSA level drops by more than 50% and imaging shows that the tumor volume shrinks, it indicates that the treatment is effective; if the PSA continues to rise or imaging shows tumor progression, the treatment is ineffective and the plan needs to be adjusted.
[0094] Long-term follow-up: The main endpoint focuses on progression-free survival (PFS), records the time from the start of treatment to disease progression or death, and uses the Kaplan-Meier method to plot the PFS curve to compare the differences between the combination and single-drug treatment groups.
[0095] Multi-index evaluation: The secondary endpoints include overall survival (OS) and objective response rate (ORR). At the same time, biomarkers are monitored. A decrease in PCAR1 expression of ≥ 50% after treatment indicates effectiveness, no obvious change or increase may indicate drug resistance, and the BRCA1 / 2 mutation status and PARP protein expression level are also detected for auxiliary evaluation.
[0096] At the same time, the content not described in detail in this specification belongs to the prior art well-known to those skilled in the art, and the model parameters of each electrical appliance are not specifically limited, and conventional equipment can be used.
[0097] It should be noted that in this text, relational terms such as first and second are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the term "comprising", "including" or any other variation thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements, but also includes other elements not expressly listed, or elements inherent to such process, method, article or device.
[0098] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. A prostate cancer olaparib treatment resistance marker, characterized in that: The marker is the PCAR1 gene.
2. Use of the marker as claimed in claim 1 in the preparation of a reagent for detecting resistance to Olaparib in prostate cancer, or in the preparation of a drug for treating prostate cancer, or in the preparation of a drug for inhibiting the proliferation of Olaparib-resistant prostate cancer cells.
3. A kit for detecting drug resistance to Olaparib in prostate cancer, characterized in that: Contains specific primer pairs for the markers, primer pairs for the internal reference gene GAPDH, and qPCR reaction premix.
4. Use of a kit for detecting drug resistance to Olaparib treatment of prostate cancer in detecting drug resistance to Olaparib treatment of prostate cancer, characterized in that: The kit is used for scientific research detection for non-diagnostic purposes, or for clinical auxiliary diagnosis to determine drug resistance according to the following standards: When the PCAR1 expression level was ≥2.0 times the threshold, it was considered to be drug-resistant.
5. A therapeutic pharmaceutical composition, characterized in that: Contains olaparib, PCAR1-specific siRNA and cationic liposome carrier.
6. The marker according to claim 1, characterized in that The PCAR1 protein mediates drug resistance by regulating the following pathways: Homologous recombination repair pathway; Base excision repair pathway; Cell cycle checkpoint regulation.
Citation Information
Patent Citations
MRNA genome for liver cancer prognosis, mRNA gene pair group, prediction model and application
CN113981085A
Novel endocrine therapy drug-resistant marker for advanced prostate cancer and application of novel endocrine therapy drug-resistant marker
CN118460722A
Modified recombinant vaccinia viruses and other microorganisms, uses thereof
CN1839201A
Cited By
Application of reagent for detecting and inhibiting micro-peptide miPEP70 or Rosemectin
CN120801712A
Prostate cancer olaparil response marker determination system and determination method and application
CN121555643A