Molecular marker related to sheep feed conversion rate and application of molecular marker in breeding

Abstract

The invention provides a molecular marker related to sheep feed conversion rate and application thereof, the molecular marker is obtained by designing a primer for an FABP5 gene sequence, extracting DNA (deoxyribonucleic acid) from sheep blood, performing PCR (polymerase chain reaction) amplification, DNA sequencing and sequence analysis, and finding that a C / G polymorphic site exists at the 2063rd site of an amplified fragment as shown in SEQ ID NO.1, and the C / G polymorphic site exists at the 2063rd site of the amplified fragment as shown in SEQ ID NO.2. An AQP primer is further used for detecting polymorphic sites of 791 sheep and establishing a least square model, correlation analysis is performed on genotypes and growth character chest circumference and tube circumference, and the polymorphic site with S at the 2063bp as shown in SEQ ID NO.1 being C or G is determined and can be used as a molecular marker related to the feed conversion rate of the sheep. The molecular marker provided by the invention can be used for screening new varieties of high-quality mutton sheep with high feed efficiency, can be used for screening assisted breeding and breeding grain-saving sheep, and is beneficial to increase of economic benefits.

Description

Technical Field

[0001] The present invention belongs to the technical field of screening and application of molecular markers, and particularly relates to a molecular marker related to the feed conversion rate of sheep and its application in breeding. Background Art

[0002] Hu sheep is a famous local sheep breed in China, with a long breeding history. It has excellent characteristics such as strong fecundity, fast early growth and development, delicious meat, and is resistant to high temperature and humidity, suitable for large-scale indoor feeding, and has become the breed with the highest market share in the current indoor sheep breeding market. However, compared with specialized meat sheep breeds, its meat production performance still has great room for improvement, and has great research value and breeding potential. In the cost of livestock and poultry breeding, feed accounts for about 70%. Improving feed efficiency (FE) can significantly improve commercial benefits. Feed efficiency refers to the proportion of the feed amount input to livestock and poultry that is used for maintenance needs and production needs. It is an important economic trait in livestock production. Residual feed intake (RFI) and feed conversion ratio (FCR) are two established indicators for evaluating animal feed efficiency. Among them, feed conversion ratio is the main indicator for evaluating FE, which refers to the ratio of the feed amount eaten by animals during the measurement period to the weight gain of animals, also known as feed to gain ratio. The lower the FCR value, the higher the feed efficiency. Because its calculation is simple and the feed cost is directly related to the income, it is widely used.

[0003] Fatty acid-binding protein 5 (FABP5), also known as psoriasis-associated fatty acid-binding protein (PA-FABP) or myelin and lymphocyte protein 1 (Mal1), belongs to the members of the fatty acid-binding protein family. FABP5 can regulate the intracellular fatty acid level, promote the transport of lipids to specific intracellular compartments, and is beneficial to various biological functions such as signal transduction and lipid droplet storage. Existing studies have found that in a mouse model fed a high-fat diet, FABP5 can activate the retinoic acid / peroxisome proliferator-activated receptor β / δ (RA / PPARβ / δ) pathway in mature adipocytes and muscle cells, and work together with the retinoic acid / retinoic acid-binding receptor (RA / RAR) pathway activated by CRABP 2 to promote lipid oxidation and energy utilization. In chicken preadipocytes, the expression of FABP5 is affected by the expression of FABP4. However, at present, the mechanism of action of this gene in the feed conversion rate trait of sheep has not been reported, and its function is also unclear.

[0004] By sequencing and analyzing the FABP5 gene, this invention explores the association between its different genotypes and the feed conversion rate trait of sheep, aiming to provide genetic materials for the genetic improvement of sheep feed efficiency traits, and accelerate the breeding process of high-quality meat sheep breeds with fast growth and high feed efficiency under independent intellectual property rights. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker related to the feed conversion rate of sheep and its application in breeding. The molecular marker of this invention is amplified from the sheep FABP5 gene, and its specific nucleotide sequence is shown in SEQ ID NO.1. By amplifying and sequencing the DNA sequence of the sheep FABP5 gene, polymorphic sites of the FABP5 gene are screened, thereby a detection method for molecular markers related to the feed conversion rate of sheep can be established, and this molecular marker can be applied to the breeding of new sheep breeds with improved feed efficiency traits.

[0006] To achieve the above purpose, the following technical solutions are adopted in this invention:

[0007] A molecular marker related to the feed conversion rate of sheep, the nucleotide sequence of this molecular marker is shown in SEQ ID NO.1, where the S at the 2063bp position is C or G, and this mutation results in the C / G polymorphism of the molecular marker.

[0008] The application of the molecular marker as described above in sheep breeding. When the genotype of the polymorphic site is the CC genotype of sheep individuals, the FCR of these individuals from 80 days old to 180 days old is significantly lower than that of sheep individuals with the CG genotype. Individuals with the CC genotype can be selected for breeding, and the breeding purpose is to screen sheep breeds with high feed efficiency and grain-saving characteristics.

[0009] The application of a nested PCR primer pair for detecting the above-mentioned molecular marker related to the feed conversion rate of sheep in sheep breeding. Preferably, the nucleotide sequences of the outer primers of the nested PCR primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3, and the nucleotide sequences of the inner primers are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0010] The application of an AQP primer for detecting the above-mentioned molecular marker related to the feed conversion rate of sheep in sheep breeding. Preferably, the nucleotide sequences of the AQP primer are shown in SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8.

[0011] Application of a kit for detecting the above-mentioned molecular markers related to sheep feed conversion rate in sheep breeding. Preferably, the kit comprises a common PCR primer pair or an AQP sequence pair. The nucleotide sequences of the common PCR primer pair are the outer primers shown in SEQ ID NO.2 and SEQ ID NO.3 and the inner primers shown in SEQ ID NO.4 and SEQ ID NO.5; the nucleotide sequences of the AQP primers are shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8.

[0012] Application of a method for detecting the above-mentioned molecular markers related to sheep feed conversion rate in breeding, which comprises the following steps:

[0013] 1) Amplify the genomic DNA of sheep blood;

[0014] 2) Genotype the polymorphism site at the 2063bp of the nucleotide sequence shown in SEQ ID NO.1 of the amplification product obtained in step 1). When the genotype of this site is the CC genotype in sheep individuals, the FCR of 80-day-old to 180-day-old sheep individuals is significantly lower than that of sheep individuals with the CG genotype. Individuals with the CC genotype can be selected for breeding.

[0015] In step 1), the amplification is carried out using a nested PCR primer pair, wherein the nucleotide sequences of the nested PCR primer pair are the outer primers shown in SEQ ID NO.2 and SEQ ID NO.3 and the inner primers shown in SEQ ID NO.4 and SEQ ID NO.5.

[0016] Furthermore, when the nested PCR primer pair is used for amplification, the polymorphism site of the amplification product is identified by Sanger sequencing.

[0017] In step 1), the amplification is carried out using an AQP PCR primer pair, and the nucleotide sequences of the AQP primers are shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8. Further, preferably, when the AQP primer pair is used for amplification, the genotyping result is viewed by detecting the fluorescence signal.

[0018] Use of the method as described above in screening for sheep with high feed efficiency, by analyzing the type of locus at the 2063bp position of the nucleotide sequence of the sheep gene as shown in SEQ ID NO.1, so as to determine the high or low FCR of sheep at different growth stages such as 80 - 180 days old, and then screening out sheep with a lower FCR type; namely, obtaining sheep with higher feed efficiency. Specifically, it is to identify that the S at the 2063bp position as shown in the sequence SEQ ID NO.1 of the amplification product is C or G, and this mutation results in the C / G polymorphism of the molecular marker; the FCR of sheep carrying the CC genotype at 80 days old - 180 days old is significantly lower than that of sheep carrying the CG genotype. The lower the FCR, the higher the feed efficiency.

[0019] Use of the above-mentioned molecular marker, PCR primer pair for detecting the molecular marker, AQP primer or kit detection method in screening for sheep with high feed efficiency. By using the above primer pair or kit to amplify and detect the genomic DNA of sheep, determine the genotype of the molecular marker of the sheep to be tested, so as to breed a sheep variety with high feed efficiency and grain-saving type from them. Sheep carrying the CC genotype should be screened, and its FCR is significantly lower than that of sheep with the CG genotype and lower than that of sheep with the GG genotype. That is, the feed efficiency of sheep carrying the CC genotype is significantly higher than that of sheep with the CG genotype and higher than that of sheep with the GG genotype.

[0020] The beneficial effects of the present invention are as follows:

[0021] Through PCR amplification and sequencing of the sheep FABP5 gene, the present invention found that there is a C / G polymorphism site at the 2063rd position of the sequence shown in the amplification fragment SEQ ID NO.1. By detecting the polymorphism of 791 Hu sheep and establishing a least squares model, a molecular marker related to the feed conversion rate of sheep was determined. The nucleotide sequence of this molecular marker is as shown in SEQ ID NO.1, where the S at its 2063bp position is C or G, resulting in the C / G polymorphism of the molecular marker. When the genotype of the polymorphism site is the CC type in sheep individuals, their FCR at 80 days old - 180 days old is significantly lower than that of sheep individuals with the CG genotype. When breeding, sheep with the CC homozygous genotype are selected and reserved as breeding sheep for breeding high feed efficiency meat sheep, so as to improve the feed efficiency during the growth of the flock and contribute to improving the economic benefits of the sheep breeding industry.

[0022] The molecular marker related to the feed conversion rate of sheep and its C / G polymorphism site provided by the present invention can effectively identify whether it is a sheep with high feed efficiency by detecting the genotype of this polymorphism site, providing an effective detection means for the breeding of grain-saving sheep. Brief Description of the Drawings

[0023] Figure 1Gel electrophoresis map of the amplified sheep FABP5 gene fragment in Example 1; among them, lane M: DL5000 Marker, lanes 1-8: amplification results of Hu sheep blood genomic DNA.

[0024] Figure 2 Sequencing result of the g.57575642C>G mutation site of the sheep FABP5 gene in Example 1.

[0025] Figure 3 AQP typing result of the amplified fragment of the sheep FABP5 gene in Example 2. Detailed implementation manners

[0026] The present invention analyzed and verified the relationship between the single nucleotide polymorphism of the Hu sheep FABP5 gene and the feed conversion rate trait. The present invention provides valuable molecular markers for improving the economic benefits of raising meat sheep and sheep breeding. The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Modifications or substitutions made to the present invention without departing from the spirit and essence of the present invention all fall within the scope of the present invention.

[0027] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents used in the examples are all of analytical pure or above specifications.

[0028] Example 1 Amplification of the FABP5 gene

[0029] 1) Primer design

[0030] Using the sheep FABP5 gene DNA (GenBank accession number: NC_056062.1) as a template, two pairs of primers were designed using Oligo7.0 software, namely an outer primer pair and an inner primer pair. Since the amplified fragment is too long and the target fragment may not be obtained by a single amplification, the outer primers were first used for amplification once, and then the PCR reaction solution amplified by the outer primers was used as the amplification template for the inner primers. The reaction systems were the same, but there was a sequence. After the outer primers were amplified, the inner primers were used to amplify again with the same system and conditions. The purpose of designing two pairs of primers in the present invention is to improve the amplification success rate and be able to amplify the target fragment with a relatively high probability, while the success rate of single amplification is relatively low and the target fragment is often not amplified. Among them, the outer primer pair is F-F1, F-R1; the inner primer pair is F-F2, F-R2. The primer sequences are as follows:

[0031] F-F1 (SEQ ID NO.2): 5'-ACAAACCAACCCAAAAACCAGA-3'

[0032] F-R1 (SEQ ID NO.3): 5'-ACTGATCAAGAGGCCAAGGGTC-3'

[0033] F-F2 (SEQ ID NO.4): 5'-ATTTCCCACGCAAGAATACTGGA-3'

[0034] F-R2 (SEQ ID NO.5): 5'-GAGGGTGGAAGGTGGAGGATAAC-3'

[0035] 2) Amplification and sequencing of the FABP5 gene

[0036] Genomic DNA was extracted from the blood of sheep respectively as a template. The PCR reaction system adopted a total volume of 20 μL, specifically including: 0.2 μL of DNA template, 1 μL of upstream and downstream primers at 10 μmol / L, 2 μL of dNTP Mix; 0.2 μL of PrimeSTAR HS DNA Polymerase, 10 μL of 2×PrimeSTAR GC buffer, dd H 2 O 5.6 μL. Among them, the DNA template was genomic DNA extracted from the blood of sheep; in this example, the DNA template was a mixed sample of DNA from 18 different sheep, and a total of 8 replicated samples were made. First, the outer primers were used for amplification, and then the amplification products were secondarily amplified with the inner primers.

[0037] The PCR amplification program was: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 10 s, annealing at 60°C for 5 s, extension at 72°C for 2 min, 35 cycles, and finally extension at 72°C for 10 min.

[0038] The above final PCR amplification products were detected by 1% agarose gel electrophoresis, and the results were as Figure 1 shown. Among them, the M lane: molecular weight 5000 Marker, lanes 1-8: amplification results of the sheep FABP5 gene. The PCR fragment obtained by amplification was sent to Beijing Tsingke Biotechnology Co., Ltd. for Sanger sequencing. The nucleotide sequence of this amplified fragment was as shown in SEQ ID NO.1, with a total of 2453 bp. Among them, there was a polymorphic site in this fragment, specifically, the S at the 2063bp site of the sequence shown in SEQ ID NO.1 was C or G, that is, the amplified FABP5 gene fragment (SEQ ID NO.1) had a C / G polymorphism at the 2063bp site (see Figure 2 ).

[0039]

[0040] DNA sequence homology search and identification:

[0041] Using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov), the DNA sequence obtained after sequencing was compared with the known physiological function genes published in the GenBank database for sequence homology to identify and obtain the functional information of this DNA sequence. The search results showed that the sequenced sequence had 99% homology with a partial sequence of the sheep FABP5 gene DNA (GenBank accession number: NC_056062.1).

[0042] Example 2 Establishment of genotyping detection method

[0043] 1. Primer sequence design

[0044] An AQP primer pair was designed for the C / G polymorphism site shown in the amplified fragment SEQ ID NO.1 in Example 1 (the AQPTM genotyping system, also known as the Allele-Specific Quantitative PCR based genotyping assay (AQP), is a genotyping system formed by combining PCR amplification technology and quantitative PCR technology), so as to be used for the specific detection of this polymorphism site. The nucleotide sequences of the optimized AQP primer pair include:

[0045] The forward primer A1 for detecting Allele C is shown as SEQ ID NO.6: SEQ ID NO.6: GAAGGTGACCAAGTTCATGCTATCCGGGTGGGGGCTCGC;

[0046] The forward primer A2 for detecting Allele G is shown as SEQ ID NO.7, SEQ ID NO.7: GAAGGTCGGAGTCAACGGATTGATCCGGGTGGGGGCTCGG;

[0047] The universal reverse primer C is shown as SEQ ID NO.8, SEQ ID NO.8: CCGAAGGCCAATGAGAAGCG.

[0048] The above primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. Each primer pair in the above AQP primer pairs was diluted to 100 μmol / L, and a primer mixture was prepared by mixing them according to the volume ratio of forward primer A1: forward primer A2: universal reverse primer C: sterile water of 12:12:30:46.

[0049] 2. Extract the genomic DNA and perform quality control

[0050] Genomic DNA was extracted from sheep blood using a DNA extraction kit. Quality testing of the extracted genomic DNA was performed using 1% agarose electrophoresis and Nanodrop 2100 respectively. The requirements for qualified DNA are as follows: (1) Agarose electrophoresis shows a single DNA band without obvious smearing. (2) Nanodrop 2100 detection shows that A260 / 280 is between 1.8 - 2.0; A260 / 230 is between 1.8 - 2.0; and there is no obvious light absorption at 270 nm. According to the AQP™ detection technology of Beijing Jiacheng Biotechnology Co., Ltd. and the genome size, the DNA usage was calculated to be 2 - 50 ng / sample, and the extracted genomic DNA was diluted to a concentration of 2 - 50 ng / μL as a DNA template for standby.

[0051] 3. Perform genotyping

[0052] First, each primer (100 μmol / L) in the above AQP primer pairs (SEQ ID NO. 6 - 8) was mixed with sterile water according to the volume ratio of 12:12:30:46 (forward primer A1: forward primer A2: universal reverse primer C: sterile water) to prepare a primer mixture for standby.

[0053] Then, 0.07 μL of the primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2xProbe Mix, and 2 μL of the diluted DNA template (2 - 50 ng / μL) were added to each well of a 384 - well plate using a pipette. After adding, the plate was sealed, shaken and centrifuged, and then placed on a C1000Touch™ Thermal Cycler instrument for PCR amplification.

[0054] The specific procedure is as follows:

[0055] Pre - denaturation at 95°C for 10 minutes;

[0056] 95°C, 20 seconds (denaturation) - 61°C - 55°C, 40 seconds (annealing & extension), amplified for 10 cycles, with a decrease of 0.6°C per cycle;

[0057] 95°C, 20 seconds (denaturation) - 55°C, 40 seconds, and continue to amplify for 34 cycles.

[0058] After the amplification, use the C1000 Touch TM Thermal Cycler instrument to detect the fluorescence signal at 37°C and view the genotyping situation. The specific results of some samples are as Figure 3 shown. Taking HEX as the abscissa and FAM as the ordinate, where each graph in the figure represents a test material. Among them, the blue square near the left indicates that the locus is a homozygous genotype "CC"; the green triangle near the middle indicates that the locus is a heterozygous genotype "CG"; the orange dot near the right indicates that the locus is a homozygous genotype "GG".

[0059] 4. Application of the molecular marker of the present invention in the association analysis of sheep body weight

[0060] A total of 791 Hu sheep were tested for polymorphism, their genotypes were determined, and the least squares model described below was established to conduct an association analysis between the genotype and body weight.

[0061] Y ijkl = μ + G i + P j + Sk + F l + ε ijkl

[0062] Among them, Y ijkl is the observed value of feed conversion rate, μ is the overall mean, G i is the genotype effect, P j is the batch effect, S k is the season effect, F l is the session effect, ε ijkl is the random error. Assume that ε ijkl are independent of each other and follow the N(0, σ 2 ) distribution.

[0063] The genotype detection results show that among 791 individuals, there are 269 individuals with the CC genotype, 403 individuals with the CG genotype, and 119 individuals with the GG genotype. The results of the association analysis between the genotype and the feed conversion rate trait are shown in Table 1. Among them, 80 - 100 days means that the 80 - 100 - day - old sheep are used as a measurement period. The body weight of all individuals of different ages is measured every 20 days. The feed conversion rate is calculated according to the formula: feed conversion rate = feed consumption / animal weight gain. Record the feed weight and animal weight at the beginning and end of each measurement period for each sheep, and subtract them to obtain the feed consumption and animal weight gain.

[0064] Table 1 Association analysis of the polymorphism of the sheep FABP5 gene and the feed conversion rate trait

[0065]

[0066]

[0067] Note: Different lowercase letters in the superscripts between data in the same row indicate significant differences (P<0.05), while no superscript or the same letter indicates no significant differences (P>0.05).

[0068] The results showed that the FABP5 g.5544C>G mutation site, which is the C / G mutation site at the 2063bp position shown in SEQ ID NO.1, was significantly correlated with the feed conversion rate of sheep (P<0.05). The FCR of sheep with the CC genotype at 100 - 120 days was significantly lower than that of sheep with the GG and CG genotypes; the FCR of sheep with the CC genotype at 80 - 180 days was significantly lower than that of sheep with the CG genotype (P<0.05) and lower than that of sheep with the GG genotype. Generally, it also indicated that individuals with the CC genotype had higher feed efficiency. Thus, the C allele was the dominant allele. It was shown that the FABP5 g.5544C>G mutation site could be used as a potential molecular marker affecting the feed conversion rate of sheep (P<0.05). Selecting individuals with the CC genotype for breeding conservation could reduce the FCR of sheep and obtain a superior flock with higher feed efficiency and grain-saving characteristics. The lower the FCR, the less feed is used to gain 1 kg of body weight, and the higher the feed efficiency. Obtaining sheep with a larger body weight using the least amount of feed would also increase the benefits of the sheep farming industry.

Claims

1. Application of a molecular marker related to sheep feed conversion rate in sheep breeding, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein S at the 2063 bp position is C or G, and the mutation leads to C / G polymorphism of the molecular marker. When the genotype of the polymorphic site is CC-type sheep individuals, their FCR at 80 days to 180 days of age is significantly lower than that of CG-genotype sheep individuals. The breeding purpose is to screen sheep breeds with high feed efficiency and grain saving.

2. Application of a nested PCR primer pair for detecting molecular markers related to sheep feed conversion rate in sheep breeding, characterized in that: The nucleotide sequences of the nested PCR primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3 for the outer primers and SEQ ID NO.4 and SEQ ID NO.5 for the inner primers.

3. Application of AQP primers for detecting molecular markers related to sheep feed conversion rate in sheep breeding, characterized in that: The nucleotide sequences of the AQP primers are shown in SEQ ID NO.6-SEQ ID NO.

8.

4. Use of a kit for detecting molecular markers related to sheep feed conversion rate in sheep breeding, characterized in that: The kit comprises a nested PCR primer pair or an AQP sequence pair, the nucleotide sequence of the nested PCR primer pair being the outer primers shown in SEQ ID NO.2 and SEQ ID NO.3 and the inner primers shown in SEQ ID NO.4 and SEQ ID NO.5; the nucleotide sequence of the AQP primers being the nucleotide sequences shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.

8.

5. Application of a method for detecting molecular markers associated with sheep feed conversion efficiency in sheep breeding, characterized in that: It includes the following steps: 1) Amplify sheep blood genomic DNA; 2) The nucleotide sequence of the amplified product obtained in step 1) is subjected to typing and identification at the polymorphic site at the 2063 bp position as shown in SEQ ID NO.

1. When the sheep individual with the genotype of the site is CC type, its FCR at 80 days to 180 days of age is significantly lower than that of the sheep individual with the genotype of CG, and the individuals with the genotype of CC type can be selected for breeding.

6. The use according to claim 5, characterized in that The amplification was performed using a nested PCR primer pair, wherein the nucleotide sequences of the nested PCR primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3 for the outer primers and SEQ ID NO.4 and SEQ ID NO.5 for the inner primers.

7. The use according to claim 6, characterized in that When nested PCR primer pairs were used for amplification, the polymorphic sites were identified by direct sequencing of the amplified products.

8. The use according to claim 5, characterized in that AQP PCR primers were used for amplification. The nucleotide sequences of the AQP primers are shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.

8.

9. The use according to claim 8, characterized in that When the AQP primer pair is used for amplification, the typing results are checked by detecting the fluorescent signal.

10. Molecular markers related to sheep feed conversion rate, and the use of nested PCR primer pairs or AQP primers or kits for detecting molecular markers related to sheep feed conversion rate in screening sheep with high feed efficiency, characterized in that: The nucleotide sequence of the nested PCR primer pair is shown in SEQ ID NO.2 and the outer primers shown in SEQ ID NO.3 and the inner primers shown in SEQ ID NO.4 and SEQ ID NO.5; the nucleotide sequence of the AQP primer is shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, the kit includes the nested PCR primer pair or the AQP primer, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the S at the 2063rd bp represents C or G, and the mutation leads to the C / G polymorphism of the molecular marker; wherein, the feed efficiency of sheep carrying the CC genotype is significantly higher than that of sheep carrying the CG genotype, and higher than that of sheep carrying the GG genotype.

Images