HNRNPA2B1 gene-based SNP molecular marker related to bovine sperm malformation rate and application of HNRNPA2B1 gene-based SNP molecular marker

Abstract

The invention discloses an HNRNPA2B1 gene-based bovine sperm malformation rate related SNP molecular marker and application thereof, and belongs to the technical field of genetic molecular biology, the number of the SNP molecular markers is two, SNP1 is at the position of a bovine genome chr4: 69733358, the polymorphism is C or A, SNP2 is at the position of a bovine genome chr4: 69733387, and the polymorphism is T or G. According to the two SNP loci provided by the invention, the dominant genotypes of g.-1713A > C and g.-1684G > T are AA and GG respectively, and the sperm collection quantity and the sperm malformation rate of the two SNP loci have better performance. By detecting the polymorphism of the two SNP loci, the motility evaluation of the bull sperms can be realized, the breeding is assisted, a reliable support is provided for breeding a high-quality next generation, and the method has the advantages of high reliability, high efficiency, low cost and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic molecular biology, and specifically relates to SNP molecular markers related to bovine sperm malformation rate based on the HNRNPA2B1 gene and their applications. Background Art

[0002] The breeding of dairy breeding bulls is the core link of the modern dairy genetic improvement system, and is of great significance for achieving genetic gain in the herd and sustainable development of the industry. As a biological carrier for the transmission of genetic material, the phenotypic variation of bull semen traits is affected by a multi-factor regulation system, among which the genetic architecture constitutes its essential determining factor. The formation of phenotypic traits involves a cascade reaction from genomic polymorphisms to transcriptional regulatory networks, which provides a theoretical basis for improving the reproductive performance of breeding bulls through marker-assisted selection (MAS).

[0003] Based on the genomic segment analysis strategy of linkage disequilibrium, it can effectively analyze the functional association between haplotype blocks (Haplotype block) composed of polymorphic loci and reproductive traits. By integrating the interaction effects of multiple SNPs, it can significantly improve the explanatory power of the genetic evaluation model and provide a scientific basis for establishing a precise molecular breeding index system.

[0004] Heterogeneous nuclear ribonucleoprotein A2B1 (hnRNPA2B1) is a protein molecule that binds to RNA in the cell nucleus and participates in mRNA splicing, transport, and other mRNA and miRNA-related processes. Currently, the research on HNRNPA2B1 mainly focuses on human diseases, and there is very little research on bovine hnRNPA2B1.

[0005] In view of this, the present invention is specifically proposed. Summary of the Invention

[0006] The object of the present invention is to provide SNP molecular markers related to bovine sperm malformation rate based on the HNRNPA2B1 gene and their applications.

[0007] The technical solution of the present invention is described in detail as follows: In the first aspect, the present invention provides SNP molecular markers related to bovine sperm malformation rate based on the HNRNPA2B1 gene, including SNP1 and SNP2. The SNP1 is located at position chr4: 69733358 in the bovine genome, and the polymorphism is C or A. The SNP2 is located at position chr4: 69733387 in the bovine genome, and the polymorphism is T or G.

[0008] Optionally or preferably, SNP1 is the 182nd nucleotide of SEQ ID NO:1 in the sequence listing, which is C or A; SNP2 is the 211th nucleotide of SEQ ID NO:1 in the sequence listing, which is T or G.

[0009] In a second aspect, the present invention provides a product for detecting the above SNP molecular marker, and the product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequences are as shown in SEQ ID NO:2-3.

[0010] In a third aspect, the present invention provides a product for detecting the above SNP molecular marker, and the product is a detection kit, and the detection kit includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequences are as shown in SEQ ID NO:2-3.

[0011] In a fourth aspect, the present invention provides the application of any of the above products, which is used to evaluate the level of sperm malformation rate in bulls.

[0012] In a fifth aspect, the present invention provides a method for evaluating the level of sperm malformation rate in bulls, detecting the genotypes of the above SNP molecular markers in the semen of the bulls to be tested, the SNP molecular markers include SNP1 and SNP2, and evaluating the sperm malformation rate of the bulls to be tested according to the genotypes of SNP1 and SNP2 of the bulls to be tested; the haplotype combination with the lowest sperm malformation rate in bulls is AG / AG.

[0013] Optionally or preferably, the above method includes the following steps: (1) Using the genomic DNA of the blood or semen of the bulls to be tested as a template; (2) Designing specific primers for the above SNP molecular markers, the SNP molecular markers include SNP1 and SNP2, and performing a PCR reaction to obtain an amplified product sequence; (3) Sequencing to determine the genotypes of SNP1 and SNP2 in the amplified product sequence, and the haplotype combinations of SNP1 and SNP2 with the lowest to highest sperm malformation rate in bulls are AG / AG, AG / CT, CT / CT in turn.

[0014] Compared with the prior art, the present invention has the following beneficial effects: In the research on the HNRNPA2B1 gene of the present invention, two new SNP loci related to sperm malformation rate, g. -1713A>C and g. -1684G>T, were discovered and identified. The dominant genotypes of them are AA and GG respectively, and they have better performance in semen collection volume and sperm malformation rate. By detecting the polymorphisms of these two SNP loci, the sperm motility of bulls can be evaluated, and then assisted breeding can be carried out, providing reliable support for breeding high-quality next generation, and having advantages such as high reliability, high efficiency, and low cost. Brief Description of the Drawings

[0015] Figure 1 It is the peak map of the SNP1-2 molecular marker position in the promoter region of the HNRNPA2B1 gene. Detailed Embodiments

[0016] In order to enable those skilled in the art to better understand the solution of this application, the following will clearly and completely describe this application in combination with the embodiments and the drawings. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative efforts shall fall within the protection scope of this application. The instruments and reagents used in the embodiments are all from commercial channels unless otherwise specified.

[0017] Example 1 A total of 235 experimental breeding bulls were selected, which were from Beijing Dairy Cattle Center, Shanghai Bright Holstein Husbandry Co., Ltd. and Shandong Oaks Breeding Bull Station respectively. The semen of the breeding bulls was collected, and genomic DNA was extracted by conventional methods and diluted to 50 ng / μL for standby. At the same time, the semen collection volume, sperm density, sperm motility, sperm malformation rate, post-thaw sperm motility, final motility and other trait indexes of each breeding bull were detected and recorded.

[0018] According to the gene sequence of the HNRNPA2B1 gene (NCBI reference sequence Gene ID: 507564), amplification primers were designed, and PCR amplification was carried out using the genomic DNA of the breeding bulls as a template.

[0019] PCR amplification system (25 μL): template (50 ng / μL) 1 μL, 1 μL of upstream and downstream primers at 10 μmol / L each, 12.5 μL of 2×Taq PCR MasterMix, ddH 2 O 9.5 μL.

[0020] PCR reaction conditions: denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min, and preservation at 4°C.

[0021] The obtained PCR products were sent to Beijing Genomics Institute for sequencing. The sequencing results of different samples were compared using SnapGene software. Combining with the sequencing peak map, the SNP sites in the target fragment were determined as: SNP1: g.-1713A>C, SNP2: g. -1684G>T, as Figure 1 shown.

[0022] The gene frequencies, genotype frequencies, and allele frequencies were calculated using Excel software, and the association analysis of the polymorphism of SNP1-2 sites of the HNRNPA2B1 gene was performed using SPSS 26.0 software. The experimental results were expressed as "mean ± standard error". When P < 0.01, it indicated a highly significant difference, and when P < 0.05, it indicated a significant difference, as shown in Table 1 below.

[0023] Table 1 Results of the association analysis between SNP sites in the promoter region of the HNRNPA2B1 gene and semen quality Note: Different superscript letters in the same column indicate significant differences (P < 0.05); the same superscript letters or no letters indicate no significant differences (P > 0.05).

[0024] As can be seen from Table 1, when the genotype of SNP1 site is AA and the genotype of SNP2 site is GG, the semen collection volume is the highest and the sperm malformation rate is the lowest. It can be used as a molecular marker for screening individuals with a low sperm malformation rate.

[0025] Example 2 Primers were designed for the sequence SEQ ID NO:1 containing two SNP molecular markers of g. -1713A>C and g. -1684G>T, and the primer sequences are as follows: Forward primer: AATCAGACAAGTGCCCAATCG, SEQ ID NO:2, Reverse primer: ACAAAGCGCATTTTCCCCTC, SEQ ID NO:3.

[0026] The sequence SEQ ID NO: 1 containing the SNP1-2 polymorphic sites is specifically as follows: AATCAGACAAGTGCCCAATCGATTACAATAATTAGTGTGAATTTTTCCTCTAGACATTAACAATCTGAAGAGTCGTCTATGTAATTTAATTCTAACTTGGGTTTCTTCTTAGAGACCTTTCCAATCACTAGTTGAAAAACTAAAACATACCGAGATGCTCCAGTTACATTTCGTGCCACTT A TGAAAACAAATCAGCTATTTCTGCACTT GCATCCGCTCCCCTTAAACCCCTACCCCACCCGGCTTAAAGAGGCCTTAGCGCCCGGCCCCTAACCCCGCCAAAGGAGAGCGCGGGCCTCGTGGTCAGCGCATCCGAGGGGAGAAACAAAAGGCCGCGGCGCGGGGGCTCAAGGGCACTGCGCCACGGGGCCCGAGCCTCTCCCCACCCGCGGCGGCCACGTAACGGAGCGCCCGCCGCAGTCTGCGGACACTCGGCTGCGCGGATGCGGGAGAATGCACCGCCCTCCCTGGAGGCCCAAGTCGCCGACCAAGCACGGGACGGGAAGGAAGGCCCCCTCAACCTCGTCCGGGATGGGGGAGGGGAGGGGAAAATGCGCTTTGT. Among them, SNP1 is located at the 182nd position of this sequence, and SNP2 is located at the 211th position of this sequence.

[0027] Collect the semen of experimental breeding bulls, extract the total DNA as a template, perform PCR amplification using SEQ ID NO: 2 - 3 as primers, and sequence the amplification products to identify the polymorphism of SNP sites. At the same time, detect the semen quality of experimental bulls. The results show that the genotype combinations of SNP1 - 2 sites correspond to the sperm malformation rate trait, that is, the haplotype combinations corresponding to the sperm malformation rate from low to high are AG / AG, AG / CT, and CT / CT in sequence.

[0028] In this article, specific examples are used to elaborate on the inventive concept in detail. The description of the above embodiments is only used to help understand the core idea of the present invention. It should be noted that for those of ordinary skill in the art, any obvious modifications, equivalent substitutions, or other improvements made without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. A bovine sperm deformity rate-related SNP molecular marker based on the HNRNPA2B1 gene, characterized in that: It includes SNP1 and SNP2, wherein SNP1 is located at position 69733358 of chr4 in the cattle genome, and the polymorphism is C or A; SNP2 is located at position 69733387 of chr4 in the cattle genome, and the polymorphism is T or G.

2. The SNP molecular marker according to claim 1, characterized in that: The SNP1 is the 182nd nucleotide of SEQ ID NO: 1 in the sequence list, which is C or A; the SNP2 is the 211th nucleotide of SEQ ID NO: 1 in the sequence list, which is T or G.

3. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

4. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The product is a detection kit, which includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequence is shown in SEQ ID NO: 2-3.

5. Use of the product according to claim 3 or 4, characterized in that: Used to assess the sperm deformity rate of bulls.

6. A method for evaluating the rate of sperm deformity in bulls, characterized in that: The genotype of the SNP molecular markers according to claim 1 or 2 is detected in the semen of the bull to be tested, wherein the SNP molecular markers include SNP1 and SNP2, and the bull sperm deformity rate is evaluated according to the genotypes of SNP1 and SNP2 of the bull to be tested; the haplotype combination with the lowest bull sperm deformity rate is AG / AG.

7. The method according to claim 6, characterized in that The following steps are involved: (1) Using the genomic DNA of the blood or semen of the bull to be tested as a template; (2) Designing specific primers for the SNP molecular markers described in claim 1 or 2, wherein the SNP molecular markers include SNP1 and SNP2, and performing PCR reaction to obtain the amplified product sequence; (3) Sequencing was used to determine the genotypes of SNP1 and SNP2 in the amplified product sequence. The haplotype combinations of SNP1 and SNP2 in the order of low to high sperm deformity rates in bulls were AG / AG, AG / CT, and CT / CT.

Images