A specific DNA fragment for sex identification of Pelteobagrus ussuriensis and a method for sex identification

Abstract

The present application discloses a specific DNA fragment for sex identification of Pelteobagrus ussuriensis and a method for sex identification, specifically relating to the technical field of sex identification of Pelteobagrus ussuriensis. The above-mentioned identification method includes the following steps: Dissect 5 female and 5 male Pelteobagrus ussuriensis of a full-sib family to determine the physiological sex; respectively extract DNA from the muscles of female samples and male samples, construct a paired-end genomic DNA library with an insert fragment size of 300 bp, and perform high-throughput sequencing; based on the GWAS and Fst methods, identify that the sex chromosome of Pelteobagrus ussuriensis is chromosome 8, and then screen for Indels within the sex determination region on chromosome 8; screen a 601-bp male-specific DNA sequence and design and synthesize primers; use PCR amplification and agarose gel electrophoresis detection, and the result without specific bands is female, and the one with a 356-bp band is male. This scheme has the advantages of strong specificity, simple primer composition, and more intuitive identification of the sex of Pelteobagrus ussuriensis.

Description

Technical Field

[0001] The present application relates to the technical field of gender identification of Pseudobagrus ussuriensis, and particularly relates to a specific DNA fragment for gender identification of Pseudobagrus ussuriensis and a method for gender identification. Background Art

[0002] Pseudobagrus ussuriensis ( Pseudobagrus ussuriensis ) is also known as Pseudobagrus ussuriensis, belonging to the order Siluriformes, family Bagridae, genus Pseudobagrus, commonly known as bull tail. It has a long body, a flat head, thick and wide in the front part, and laterally compressed in the rear part, with a smooth and scaleless body surface. It is widely distributed in waters such as the Heilongjiang River, the Ussuri River, and the Pearl River. Pseudobagrus ussuriensis has tender meat, a delicious taste, and no intermuscular spines, and is regarded as a precious fish in northern China and is highly favored by consumers. At present, the research on Pseudobagrus ussuriensis mostly focuses on artificial breeding, aquaculture, nutrition, and physiology, etc., and there has been no breakthrough in the key technologies related to monosex breeding.

[0003] Pseudobagrus ussuriensis has significant sexual dimorphism, and there are obvious differences in body size between male and female individuals. Male individuals are significantly larger than female individuals. Therefore, carrying out the research on the breeding of all-male fry of Pseudobagrus ussuriensis and conducting monosex aquaculture are of great significance for improving its aquaculture yield.

[0004] For this reason, Chinese invention patent CN2020111663121 discloses multiplex PCR primers and a detection method for gender detection of Pseudobagrus ussuriensis. In this method, by integrating three gender-specific markers, a multiplex PCR system for gender detection of Pseudobagrus ussuriensis is constructed for gender identification of Pseudobagrus ussuriensis, that is, gender identification of Pseudobagrus ussuriensis.

[0005] However, in the above primer design and identification method, there are the following disadvantages: 1. Gender-specific sequence part: BLAST alignment of the 3 segments of gender-specific sequences used in patent CN2020111663121 in the NCBI database did not find homologous sequences in the reference genome of Pseudobagrus ussuriensis. This indicates that the 3 segments of gender-specific sequences used in this patent are population-specific. When applying this method to carry out gender identification in the reference genome sequencing population of Pseudobagrus ussuriensis, the identification may fail because this population does not contain these 3 segments of sequences. 2. Primer part: Multiple primers may interfere with each other, resulting in competitive effects between primers or reduced amplification efficiency, and even causing non-specific amplification; 3. Identification method part: When identifying gender in the above scheme, it is necessary to simultaneously determine whether there are amplification bands at 246 bp, 597 bp, and 823 bp in an individual. Both the reaction system of the primer and the identification method are very troublesome and cannot be obtained intuitively. Summary of the Invention

[0006] The present invention provides a specific DNA fragment for sex identification of Pseudobagrus ussuriensis and a method for sex identification. This solution has the advantages of strong specificity, simple primer composition, and can more intuitively and quickly identify the sex of Pseudobagrus ussuriensis.

[0007] The object of the present invention is achieved through the following technical solutions:

[0008] A specific DNA fragment for sex identification of Pseudobagrus ussuriensis, and the sequence of the specific DNA fragment is shown in SEQ ID NO:1.

[0009] Preferably, the designed sex-specific primers include a forward primer FP and a reverse primer RP;

[0010] Forward primer FP: 5’-GTAGCTGAGAGGAGTAACTGGTGGA-3’; SEQ ID NO:2;

[0011] Reverse primer RP: 5’-ACAGGTGAGCACCTCAGCACCA-3’; SEQ ID NO:3.

[0012] The present invention also provides a method for sex identification of Pseudobagrus ussuriensis. This method includes the following steps: performing a PCR amplification reaction and an agarose gel electrophoresis detection using the described PCR primers. If a 356bp band appears in the result, it is male, and if no specific band appears, it is female. The PCR amplification sequence for sex identification of Pseudobagrus ussuriensis is shown in SEQ ID NO:4.

[0013] Preferably, the PCR amplification conditions are: 94°C for 4 minutes; 94°C for 30 seconds, 66°C for 30 seconds, 72°C for 30 seconds, for 35 cycles; 72°C for 7 minutes of extension.

[0014] Preferably, the total volume of the PCR amplification reaction system is 20 μL: 2×Premix Taq 10 μL, 10 mM primers each 0.8 μL, ddH2O 7.4 μL, genomic DNA 1 μL.

[0015] Compared with the prior art, the advantages or beneficial effects of the technical solution of the present application include:

[0016] 1. In the identification method of the present application, it only needs to be judged that if there is no specific band in the result, it is female, and if there is a 356bp band, it is male, which is more intuitive and has a high accuracy rate.

[0017] 2. The sex-specific sequences are derived from the re-sequencing data of multiple male and female Pelteobagrus ussuriensis individuals. By designing upstream and downstream primers, they are respectively combined with both ends of the target DNA sequence, thereby ensuring the specificity of amplification and the universality among different geographical populations within the species. Description of the Drawings

[0018] Figure 1 This is the gel electrophoresis diagram for identifying the sexes of Pelteobagrus ussuriensis in the present invention (where: ♂1 - 52 represent male Pelteobagrus ussuriensis samples; ♀1 - 52 represent female Pelteobagrus ussuriensis samples). Detailed Embodiment

[0019] The following will combine the drawings and embodiments to detail the implementation manner of the present application, so as to fully understand how the present application uses technical means to solve technical problems and the implementation process of achieving corresponding technical effects and implement accordingly. Each feature in the embodiments of the present application and in the embodiments can be combined with each other on the premise of not conflicting, and the formed technical solutions are all within the protection scope of the present application.

[0020] It should be clear that the following described embodiments are only a part of the embodiments of the present application, rather than all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments in the present application without creative efforts fall within the protection scope of the present application.

[0021] Embodiment 1: This embodiment provides a method for sex identification of Pelteobagrus ussuriensis, including the following steps:

[0022] S01. Collect 30 Pelteobagrus ussuriensis of full-sib families from the breeding base, and anatomize them to determine their physiological sexes.

[0023] S02. Randomly select 5 female muscle samples and 5 male muscle samples for DNA extraction, and construct a double-ended genomic DNA library with an insert fragment size of 300 bp according to the requirements of the Illumina library construction process.

[0024] S03. Use the Illumina NovaSeq sequencing platform to perform high-throughput sequencing on the genome, with a sequencing volume of 12 Gb per sample and a sequencing strategy of Pair-End 150 bp.

[0025] S04. Based on high-throughput sequencing sequences, using the GWAS (Genome-Wide Association Study) and Fst (Fixation Index between populations) methods, the sex chromosome of Pelteobagrus ussuriensis was identified as chromosome 8. Subsequently, a collinearity analysis was performed on the female and male genomes, and a 601-bp male-specific Indel marker (Insertion-Deletion marker) was found in the male genome sequence. The nucleotide sequence of this Indel marker is shown in SEQ ID NO.1.

[0026] SEQ ID NO:1 is as follows:

[0027] GCTGCAGCCCAAATACATACATACAAACATACATATAAACATACATAGATGGACACTTAAAGTAGCTGAGAGGAGTAACTGGTGGAAAATATATGTTTAAAGCACTTTAAAATATAACTGGCAAAAAATATTTTGAAATGCTTTATTTATTTATTTCTAAACTTTTATTATTGTTTGTTTTAATTCCTTTTACTATTTCACTTAATACTTTGCATGCAGATTTTTTTTTCCCCAAAAACAAATTTAATGAAGTTCATATACATGTAACTGTCATCCAACGGCCTTGTAGCAGTTGTCCAATAGTGCAATTCAAATAATGTTATTTCTCTTATTTATCATTTAATTAACTCAGTTTTTATCTTGACTGAAATATCTATCTAGCCACAGTGATGTCATGGTGCTGAGGTGCTCACCTGTTAAATTAAATTAAATTCATTATGGAAAGTTTTAAACATACACAAACACAATTGTGACTTTAATTTCATATGAATTATTTTCAACATTTATTGCTACAATATAAACAAACCCAGGGCCTATGAAATATTTTAATCAATCAATCAATCAAAGGGTATATTTACTCATACATGACCAGTGCATAATC

[0028] S05. Based on the sex-specific sequences obtained by analyzing and screening high-throughput sequencing data, Primer 3 Plus was used to design PCR verification primers. The primer sequences are shown in SEQ ID NO:2 and SEQ ID NO:3:

[0029] F: 5’-GTAGCTGAGAGGAGTAACTGGTGGA-3’; SEQ ID NO.2;

[0030] R: 5’-ACAGGTGAGCACCTCAGCACCA-3’; as shown in SEQ ID NO.3.

[0031] The primers were designed within the specific sequence region. In theory, the primers could only amplify the sequences in the specific region. The amplified sequence is as shown in SEQ ID NO:4:

[0032] SEQ ID NO:4 is:

[0033] GTAGCTGAGAGGAGTAACTGGTGGAAAATATATGTTTAAAGCACTTTAAAATATAACTGGCAAAAAATATTTTGAAATGCTTTATTTATTTATTTCTAAACTTTTATTATTGTTTGTTTTAATTCCTTTTACTATTTCACTTAATACTTTGCATGCAGATTTTTTTTTCCCCAAAAACAAATTTAATGAAGTTCATATACATGTAACTGTCATCCAACGGCCTTGTAGCAGTTGTCCAATAGTGCAATTCAAATAATGTTATTTCTCTTATTTATCATTTAATTAACTCAGTTTTTATCTTGACTGAAATATCTATCCAGCCACAGTGATGTCATGGTGCTGAGGTGCTCACCTGT

[0034] Example 2: The accuracy of the sex identification method for Pseudobagrus ussuriensis in Example 1 was verified in this example:

[0035] 1. Verification of sample DNA extraction

[0036] 52 female fish and 52 male fish were randomly selected from the Pseudobagrus ussuriensis breeding population. A small amount of fin rays were cut, and genomic DNA was extracted using the DNA extraction kit (product number: DP304) from Tiangen Biochemical Technology (Beijing) Co., Ltd. The extraction method is described in the kit instruction manual.

[0037] DNA polymerase: 2×Hieff Canace® Plus PCR Master Mix(With Dye) (purchased from Yeasen Biotechnology (Shanghai) Co., Ltd., product number: 10154ES08)

[0038] The PCR reaction conditions were as follows: 94°C for 4 min; 94°C for 30 s, 66°C for 30 s, 72°C for 30 s, for 35 cycles; extension at 72°C for 7 min.

[0039] The PCR reaction system was 20 μL: 10 μL of 2×Premix Taq; 0.8 μL of each 10 mM primer; 7.4 μL of ddH2O; 1 μL of genomic DNA.

[0040] 2. Agarose gel electrophoresis diagram

[0041] Agarose gel: gel concentration 2%, voltage 130 V, 40 min; sample loading volume 2 μL.

[0042] DNA polymerase: Gold Band DL 2,000 DNA Marker (purchased from Yeasen Biotechnology (Shanghai) Co., Ltd., product number: 10501ES80), consisting of 6 DNA fragments, namely: 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp.

[0043] The electrophoresis results of the PCR products are shown in Figure 1 .

[0044] A single band of 356 bp was amplified from 52 male fish, while no amplification band was observed in 52 female fish, which was consistent with the results of gonad identification by dissection, and the identification accuracy rate was 100%. It indicated that the pair of male-specific primers screened in the present invention could achieve the purpose of identifying the genders of female and male Pelteobagrus ussuriensis.

Claims

1. A specific DNA fragment for sex identification of Pseudobagrus ussuriensis, characterized in that, The sequence of the male-specific DNA fragment is SEQ ID NO:

1.

2. A primer for sex identification of Pseudobagrus ussuriensis, characterized in that, Designed from the specific DNA fragment SEQ ID NO: 1, the primer sequences are as follows: Forward primer FP: 5’-GTAGCTGAGAGGAGTAACTGGTGGA-3’; Reverse primer RP: 5’-ACAGGTGAGCACCTCAGCACCA-3’.

3. A method for sex identification of Pelteobagrus ussuriensis, characterized in that It includes the following steps: Using the primers described in claim 2 for PCR amplification and agarose gel electrophoresis detection, individuals showing a single band of 356 bp are male Ussuri yellow catfish, and individuals without specific bands are female Ussuri yellow catfish; among them, the PCR amplification sequence is as shown in SEQ ID NO:

4.

4. The method for identifying the sex of Pseudobagrus ussuriensis according to claim 3, wherein The PCR amplification conditions are: 94°C, 4 Min; 94°C, 30 S, 66°C, 30 S, 72°C, 30 S, 35 cycles; 72°C extension for 7 Min.

5. According to the method for identifying the sex of Ussuri yellow catfish described in claim 3, the total volume of the PCR amplification reaction system is 20 μL, which is: 2×Premix Taq 10 μL, 10 mM forward and reverse primers each 0.8 μL, ddH2O 7.4 μL, genomic DNA 1 μL.

Images