A primer pair and kit for detecting trehalose-positive bibersteinia biberaiana

Abstract

The application discloses a primer pair and a kit for detecting Bibersteinia trehalosi, and belongs to the technical field of pathogenic microorganism detection. The application aims to improve the sensitivity and specificity of detection of Bibersteinia trehalosi. The application provides a primer pair for detecting Bibersteinia trehalosi, wherein the primer pair is shown as SEQ ID NO. 1 and SEQ ID NO. 2. The detection method is stable in batch-to-batch repeatability and intra-batch repeatability, and is suitable for large-scale clinical detection.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of pathogenic microorganism detection, and particularly relates to a primer pair and a kit for detecting Bibersteinia trehalosi. BACKGROUND

[0002] Bibersteinia trehalosi (B.trehalosi) is a gram-negative pathogenic bacterium causing respiratory tract disease in ruminants, mainly infecting sheep, goats and cattle. The bacterium was once classified as Mannheimia of Pasteurellaceae, and was reclassified as Bibersteinia of Pasteurellaceae in 2007 according to phylogenetic studies. In recent years, the bacterium has received extensive attention worldwide. The bacterium is often colonized in the upper respiratory tract of healthy ruminants, and can cause severe respiratory tract disease when the body's immunity is low. The clinical symptoms mainly include fever, loss of appetite, depression, repeated cough, and eye and nose secretions. It is worth noting that Bibersteinia trehalosi can also be used as a zoonosis bacterium, which can cause brain abscess, facial carbuncle, urinary system infection and pulmonary infection.

[0003] The conventional method for detecting Bibersteinia trehalosi is to use enzyme-linked immunosorbent assay or microbiological method, but there are problems of low detection sensitivity, low specificity and long time. SUMMARY

[0004] The purpose of the present application is to improve the sensitivity and specificity of detecting Bibersteinia trehalosi.

[0005] The present application provides a primer pair for detecting Bibersteinia trehalosi, which is represented by SEQ ID NO. 1 and SEQ ID NO. 2.

[0006] The present application provides a kit for detecting Bibersteinia trehalosi, which comprises the primer pair of claim 1 and a fluorescent probe represented by SEQ ID NO. 3.

[0007] Further limited, the concentration of the primer pair is 10 μM.

[0008] Further limited, the concentration of the probe is 10 μM.

[0009] Further limited, the system of the kit further comprises 2xOne Step U Mix, One Step U Enzyme MIX, ROX II reference dye, positive control and negative control.

[0010] Further specifying, the positive control is a recombinant vector containing the nucleic acid molecule shown in SEQ ID NO.4, and the negative control is water.

[0011] Further specified, the real-time PCR system is 10 μL, including 2.7 μL water, 5 μL 2xOne Stepu Mix, 0.5 μL One StepU Enzyme MIX, 0.2 μL each of Bt-F, Bt-R, and Bt-P, 0.2 μL ROX II reference dye, and 1 μL template.

[0012] This invention provides the application of the above-mentioned primer pair in the preparation of a kit for detecting Trehalose-Biberstanbacterium.

[0013] This invention provides the application of the nucleic acid molecule shown in SEQ ID NO.4 as a marker for detecting Bibersteinia trehalosi.

[0014] Further specifying, the primer sequences for amplifying SEQ ID NO.4 are those shown in SEQ ID NO.1 and SEQ ID NO.2.

[0015] Beneficial effects: (1) The detection primer set of the present invention is designed for the conserved gene sequence of trehalose-bibstein bacillus. Using this primer set to detect Pasteurella multocida, hemolytic Mansonia, Haemophilus spp., Mycoplasma sheepii and Mycoplasma caprine pneumonia subsp. spp., no bands were amplified, indicating that the primer set has strong specificity.

[0016] (2) The present invention has high detection sensitivity for trehalose biberstein bacteria, reaching 10 copies / μL genome and 8.7 cfu / mL of trehalose biberstein bacteria.

[0017] (3) The detection method of the present invention is significantly superior to the conventional PCR method, and improves the sensitivity of detection.

[0018] (4) The detection method of the present invention has stable inter-batch and intra-batch repeatability, and is suitable for large-scale clinical testing. Attached Figure Description

[0019] Figure 1 The amplification curve results of B. trehalosi real-time PCR are shown in the figure.

[0020] Figure 2 The standard curve results for B. trehalosi real-time PCR are shown in the figure.

[0021] Figure 3 The image shows the specificity test results of B. trehalosi quantitative PCR. Detailed Implementation

[0022] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are now clearly and completely described. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] The experimental materials used in the examples are as follows:

[0024] The plasmid extraction kit was the Gene JET Plasmid Mini prep Kit (Thermo Scientific), the gel extraction kit was the Gene JET Gel Extraction Kit (Thermo Scientific), the DNA extraction kit was the EasyPureViral DNA / RNA Kit (ER201) purchased from Beijing TransGen Biotech Co., Ltd., and the HiScripto II U OneStep qRT-PCR Probe Kit (Q223) purchased from Novizan Biotechnology Co., Ltd.

[0025] Example 1: Establishment of quantitative real-time PCR for B. trehalosi

[0026] 1. Design of primers and probes for B. trehalosi real-time PCR.

[0027] The gene sequence is shown in SEQ ID NO.4. Based on the determined gene sequence, quantitative PCR amplification primers were designed, and probe primers were designed in the middle of the designed amplification primers. The sequences of the quantitative PCR primers and probes are as follows:

[0028] Table 1. Primer and probe sequences

[0029]

[0030] 2. Preparation of B. trehalosi real-time PCR plasmid standards.

[0031] (1) Amplification of the target fragment

[0032] Bacterial genomes were extracted using the EasyPure Viral DNA / RNA Kit. Using the bacterial genomes as templates, the target fragment was amplified using the primers listed above in a 10 μL PCR system (5 μL 2×Taq PCR Mix, 1 μL each of 10 μM forward and reverse primers, 1 μL bacterial DNA, and 2.7 μL ddH2O). The amplification conditions were: 95℃ for 5 min; 95℃ for 30 s, 53℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 10 min; 4℃ for 30 min. After amplification, the PCR products were analyzed by 1% agarose gel electrophoresis, and the target fragment was purified using a gel extraction kit.

[0033] The target fragment sequence amplified by B. trehalosi is SEQ ID NO.4:

[0034] AGAAAGGTAATGAGCCAAGAATAACAAGAGTCAACTTCGGACTGTAATACCACAT CACGGCAAAGAAGATAAAAGAGAATAATAAATCTAGAACAGAAGTTAATGCTTGC.

[0035] (2) Connection transformation

[0036] The recovered gel product was ligated into the pMD18-T vector (TaKaRa), and the ligation product was added to DH5α competent cells (ice bath for 30 min; heat shock at 42°C for 90 s; ice bath for 2 min). The bacterial culture was transferred to antibiotic-free LB medium and cultured at 37°C and 200 rpm with shaking for 45 min. 50 μL of the bacterial culture was evenly spread on LB agar plates containing ampicillin and incubated overnight at 37°C.

[0037] (3) Screening and identification of positive clones

[0038] Single colonies were picked from LB agar plates and added to 5 mL of ampicillin-resistant LB medium. The culture was incubated at 37°C and 200 rpm for 12 h with shaking. Using the corresponding primers, bacterial culture PCR was performed for verification (amplification of the target fragment), followed by sequencing. Plasmids were extracted using a plasmid DNA mini-extraction kit. The correctly identified positive recombinant plasmid was named pMD-Bt. The plasmid concentration was determined using a NanoDrop instrument; the concentration of the pMD-Bt recombinant plasmid was 431 ng / μL. The copy number of the recombinant plasmid was calculated to be 1.40 × 10⁻⁶. 11 Copies / μL were used as plasmid standards.

[0039] The formula for calculating the copy number is as follows: Copy number = plasmid concentration × 6.02 × 10⁻⁶23 / (660×total plasmid length).

[0040] 3. B. trehalosi real-time PCR method.

[0041] DNA was extracted from the samples using the EasyPure Viral DNA / RNA Kit. Real-time PCR was performed using the HiScripto II U OneStep qRT-PCR Probe Kit. The reaction mixture consisted of 10 μL of water, 2.7 μL of 2×One StepU Mix, 1 μL of One StepU Enzyme MIX, 0.2 μL each of forward and reverse primers, 0.2 μL of probe, 0.2 μL of ROX II reference dye, and 1 μL of template. The PCR program was: 95℃ for 5 min; 95℃ for 10 s, 53℃ for 30 s, for 45 cycles.

[0042] To plot the standard curve for singlet quantitative PCR amplification, the plasmid standard was serially diluted 10-fold (using 10... 1 10 2 10 3 10 4 10 5 10 6 10 7 Amplification was performed using copies / μL (7 dilutions) as template, with a negative control included. The reaction was conducted on an Applied Biosystems QuantStudio 5 real-time quantitative PCR instrument, and amplification curves were obtained. The correlation coefficient R was analyzed using software. 2 The value is 1.000, indicating a good linear relationship, which meets the requirements of the standard curve (R0). 2 >0.99), the standard curve established is as follows Figure 1 and Figure 2 As shown. B.trehalosi: Y = -3.256log(X) + 39.761R 2 =1.000Eff% = 102.818%

[0043] (1) Sensitivity test:

[0044] B. trehalosi bacterial culture was serially diluted 10-fold and subjected to quantitative real-time PCR. The lowest detectable concentration of B. trehalosi was 8.7 cfu / mL, compared to only 330.8 cfu / mL by conventional PCR. The results indicate that the sensitivity of quantitative real-time PCR for B. trehalosi is 38 times higher than that of conventional PCR, and it can be used for clinical sample detection.

[0045] (2) Specificity test:

[0046] Using *B. trehalosi* standard as a positive control, and *Pasteurella multocida*, *Mannheimia haemolytica*, *Histophilus somni*, *Salmonella*, *Clostridium perfringens*, *Escherichia coli* K99, and water as samples, DNA was extracted and used as templates for quantitative real-time PCR. Based on the established optimal reaction conditions, quantitative real-time PCR amplification was performed, and the results are as follows: Figure 3 As shown, the standard can be detected with an amplification curve, while no amplification curves were observed for other pathogens and the negative control, indicating that the method has good specificity.

[0047] (3) Repeatability test:

[0048] The B. trehalosi recombinant plasmid was serially diluted 10-fold and then mixed in equal proportions to obtain three concentration gradients (final concentrations of 10, ... 6 copies / μL, 10 4 copies / μL, 10 2 A plasmid mixture of (copy / μL) was used, with water as a negative control. The established quantitative real-time PCR method was used for three repeated detections to perform intra-group repeatability tests. Inter-group repeatability tests were performed on the same concentration of standard diluted at three different time points. The results were statistically analyzed to evaluate the repeatability of the method, and the results are shown in Table 2. Table 2 shows that the intra-group coefficient of variation was less than 2%, and the inter-group coefficient of variation was less than 2%, indicating that the single-array quantitative real-time PCR method established in this invention has good repeatability.

[0049] Table 2. Repeatability results of singleton quantitative PCR

[0050]

[0051]

[0052] Example 2: Clinical Sample Testing

[0053] The established B. trehalosi real-time PCR method was used to detect a total of 393 clinical sheep respiratory disease samples collected from six regions. DNA was extracted from the samples using the EasyPure Viral DNA / RNA Kit, and real-time PCR was performed using the HiScripto II U One Step qRT-PCR Probe Kit. The reaction mixture consisted of 10 μL of water, 2.7 μL of 2×One StepU Mix, 1 μL of One StepU Enzyme MIX, 0.2 μL each of forward and reverse primers, 0.2 μL of probe, 0.2 μL of ROX II reference dye, and 1 μL of sample template. The real-time PCR reaction program was: 95℃ for 5 min; 95℃ for 10 s, 53℃ for 30 s, for 45 cycles. Analysis of the quantitative PCR amplification curves and Ct values ​​(Table 3) showed that B. trehalosi was prevalent in six regions, with an overall positive rate of 9.67%. The highest positive rate was found in Heilongjiang Province, reaching 18.33%. This indicates that B. trehalosi poses a serious threat to my country's aquaculture industry, and sensitive and specific detection methods provide an important means for the control of the pathogen.

[0054] Table 3. Clinical sample testing results from different regions

[0055] Province / Region Total number of samples Number of positive samples Positive rate of B. trehalosi Heilongjiang 60 11 18.33％ Jiangsu 55 3 5.45％ Liaoning 80 6 7.50％ Shandong 70 6 8.57％ Hunan 50 8 16.00％ Xinjiang 78 4 5.13％ Total 393 38 9.67％

[0056] Example 3. Markers for identifying B. trehalosi

[0057] The target fragment sequence is SEQ ID NO.4: AGAAAGGTAATGAGCCAAGAATAACAAGAGTCAACTTCGGACTGTAATACCACATCAC GGCAAAGAAGATAAAAGAGAATAATAAATCTAGAACAGAAGTTAATGCTTGC; as a marker, its presence or absence can be used to identify the presence or absence of B. trehalosi. If the sample to be identified contains SEQ ID NO.4, it proves that the sample contains B. trehalosi.

Claims

1. A method for detecting Trehalose-Bissaurus ( Bibersteinia trehalosi The primer pair of ) is characterized in that, The primer pairs are shown in SEQ ID NO.1 and SEQ ID NO.2; the target is shown in SEQ ID NO.

4.

2. A kit for detecting *Trebolobacterium trehalose*, characterized in that, The kit includes the primer pair and fluorescent probe as described in claim 1, wherein the fluorescent probe is shown in SEQ ID NO.

3.

3. The reagent kit according to claim 2, characterized in that, The concentration of the primer pair was 10 μM.

4. The reagent kit according to claim 2, characterized in that, The concentration of the probe is 10 μM.

5. The reagent kit according to claim 2, characterized in that, The kit system also includes 2xOne StepUMix, One StepU Enzyme MIX, ROX II reference dye, positive control, and negative control.

6. The reagent kit according to claim 5, characterized in that, The positive control was a recombinant vector containing the nucleic acid molecule shown in SEQ ID NO.4, and the negative control was water.

7. The reagent kit according to claim 2, characterized in that, The quantitative PCR system consisted of 10 μL of water, 5 μL of 2xOne Stepu Mix, 0.5 μL of One StepU Enzyme MIX, 0.2 μL each of primers and probes, 0.2 μL of ROX II reference dye, and 1 μL of template.

8. The use of the primer pair according to claim 1 in the preparation of a kit for detecting Trehalose-Biberstanbacterium.

Images