Lipase mutant

Abstract

The invention relates to the technical field of gene engineering and protein modification, in particular to a lipase mutant and application thereof in synthesis of a pregabalin key chiral intermediate. According to the invention, on the basis of thermomyces lanuginosus lipase TL, a large amount of mutation screening is carried out, so that the lipase mutant of which the catalytic efficiency of hydrolysis of 2-carboxyethyl-3-cyano-5-methyl ethyl hexanoate (CNDE) is remarkably improved is finally obtained. Wherein the catalytic constant Kcat of the single-point mutant containing S254A reaches 100.2 and is 45 times of that of a wild type, the enantiomer selectivity ee value of the single-point mutant containing S254A is also higher than that of the wild type, and an unexpected technical effect is achieved. The lipase mutant can be applied to efficient synthesis of a pregabalin key chiral intermediate, and has a wide prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and protein modification, and particularly relates to a lipase mutant and its application in the synthesis of a key chiral intermediate of pregabalin. Background Art

[0002] Currently, most chiral drugs synthesized chemically are racemic drugs. However, usually only one enantiomer has strong affinity with the receptor, high activity, good efficacy, and few adverse reactions, while the other enantiomer not only has no pharmacological effect, but may also offset the effect of part of the effective enantiomer, and even cause serious adverse reactions. In order to obtain a single chiral drug, various chiral technologies have been used in the preparation of drug intermediates in recent years. Chiral technology usually performs asymmetric synthesis or resolution on a certain chiral intermediate in the chemical synthesis route, and then synthesizes a single chiral drug. Compared with chemical resolution methods, enzymatic resolution has the advantages of fewer side reactions, easy separation and purification of products, and less environmental pollution.

[0003] Hydrolytic enzymes are mostly used in enzymatic resolution, and among them, lipase (lipase, EC3.1.1.3) is more widely used. Lipase, also known as glycerol ester hydrolase and triacylglycerol acyl hydrolase, is a type of hydrolase that can hydrolyze triglycerides to generate free fatty acids with different chain lengths and glycerol. From the perspective of catalytic characteristics, lipase has mild reaction conditions, few by-products, and does not require coenzymes for the reaction. At the same time, it has high chemoselectivity and stereoisomerism. At the same time, lipase also has functions such as catalyzing ester hydrolysis, ester synthesis, transesterification, ammonolysis, alcoholysis, and drug synthesis.

[0004] The main sources of lipase are plants, animals, and microorganisms. Microorganisms have the characteristics of a large variety, fast reproduction, and easy mutation. The lipases secreted by them are diverse in type, have a broad substrate spectrum, and can adapt to different pH values and temperature ranges. The enzymatic properties of some microbial strains obtained from extreme environments are more prominent. Currently, it is found that the microorganisms producing lipase are very widely distributed, and more than 60 genera have been isolated and identified, including 10 genera of yeasts, 23 genera of other fungi, 4 genera of actinomycetes, and 28 genera of bacteria. High-yield lipase fungal strains mostly come from Rhizopus, Aspergillus, Penicillium, Mucor, Geotrichum, etc.

[0005] In the synthesis of chiral drugs in non-aqueous phase, lipase can catalyze reactions such as ester hydrolysis, transesterification, and ammonolysis, and can resolve racemic alcohols, acids, esters, and amines. It has become an important technical means for the preparation of optically pure chiral drugs. Pregabalin is a marketed γ-aminobutyric acid (GABA) analogue, which is used to treat adult epilepsy, neuropathic pain, migraine, and generalized anxiety disorder. Due to the increasing demand for pregabalin, a large number of chemical and enzymatic synthesis routes have been developed. (S)-2-Carboxyethyl-3-cyano-5-methylhexanoic acid is a key chiral intermediate for the synthesis of pregabalin. At present, it has been reported that commercially available lipases Lipolase and Lipozyme TLIM are used as biocatalysts to kinetically resolve ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE) to prepare (S)-2-carboxyethyl-3-cyano-5-methylhexanoic acid. However, due to the low catalytic reaction efficiency and poor enantioselectivity of the existing lipases during the CNDE resolution process, the process production cost is high. Therefore, there is a need to develop lipases with higher catalytic efficiency and better enantioselectivity. Summary of the Invention

[0006] In order to solve the problems of the prior art, the present invention provides a lipase mutant and its application in the synthesis of a key chiral intermediate of pregabalin. Based on the lipase TL of Thermomyces lanuginosus ( Thermomyces Lanuginosus ), through a large number of mutation screenings, a lipase mutant with a significantly increased catalytic reaction rate for the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE) is finally obtained, laying a foundation for its wide use in the efficient synthesis of the key chiral intermediate of pregabalin.

[0007] The present invention provides a lipase mutant, which comprises an amino acid sequence having at least 90% identity with SEQ ID NO:2, and comprises amino acid substitutions at at least one position selected from the following group: 3, 27, 38, 58, 91, 96, 111, 163, 226, 227, 228, 230, 231, 232, 233, 235, 236, 237, 238, 240, 241, 251, 254, 256.

[0008] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:2.

[0009] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity compared to SEQ ID NO:2.

[0010] In some embodiments of the present invention, the mutant comprises a substitution or combination of substitutions of at least one amino acid from the following group: S3C, S3C / R232C, D27R, G38A, S58M, G91T, D96E, D111A, G163K, T226A, L227T, V228A, V230T, T231A / E / G / N / R / S, R232C / T, N233C / T, I235T, V236A, K237R, I238T, G240A, I241A, N251T, D254A / S, P256T.

[0011] The present invention also relates to a DNA molecule encoding the above lipase mutant.

[0012] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0013] The present invention also relates to a host cell comprising the above recombinant expression vector.

[0014] The host cell is Pichia pastoris ( Pichia pastoris ).

[0015] The host cell is Aspergillus niger ( Aspergillus niger ).

[0016] The host cell is Trichoderma reesei ( Trichoderma reesei ).

[0017] Based on the wild-type lipase TL, the present invention provides a mutant comprising a substitution or combination of substitutions of at least one amino acid from the following group: S3C, S3C / R232C, D27R, G38A, S58M, G91T, D96E, D111A, G163K, T226A, L227T, V228A, V230T, T231A / E / G / N / R / S, R232C / T, N233C / T, I235T, V236A, K237R, I238T, G240A, I241A, N251T, D254A / S, P256T, which can significantly improve the catalytic efficiency of the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE). Among them, the single-point mutant containing S254A has a catalytic constant KThe cat reached 100.2, which was 45 times that of the wild type, and the enantioselectivity ee value reached 98.8%, which was also higher than that of the wild type, achieving unexpected technical effects. The lipase mutant can be widely used in the synthesis of the key chiral intermediate of pregabalin, and has broad application prospects. Description of the Drawings

[0018] Figure 1 It is the map of the recombinant plasmid pPIC9K-TL. Detailed Implementation Modes

[0019] The method of the present invention will be further described below in conjunction with examples. For the experimental methods without specific conditions indicated in the following examples, they can generally be carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual" written by J. Sambrook et al., or according to the conditions recommended by the manufacturer. Those skilled in the relevant art of this field can better understand and master the present invention with the help of the examples. However, the protection scope and the scope of the claims of the present invention are not limited to the specific cases provided, but should include the protection scope that can be extended by those skilled in the art on the basis of this specification without creative labor.

[0020] Experimental Materials and Reagents: Strains and Vectors: Escherichia coli DH5α, Pichia pastoris GS115, and the vector pPIC9k were purchased from Invitrogen Corporation.

[0021] Enzymes and Kits: PCR enzymes and ligases were purchased from Takara Corporation, restriction endonucleases were purchased from Fermentas Corporation, plasmid extraction kits and gel purification and recovery kits were purchased from Omega Corporation, and the GeneMorph II Random Mutagenesis Kit was purchased from Beijing Bomaisi Biotechnology Co., Ltd.

[0022] Medium Formulas: Escherichia coli Medium (LB Medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; LB + Amp Medium: LB medium plus 100 μg / mL ampicillin; LB + Kana Medium: LB medium plus 50 μg / mL kanamycin; Yeast Medium (YPD Medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast Screening Medium (MD Medium): 2% glucose, 1.34% YNB, 4×10 -5 % biotin, 2% agar powder; BMGY Medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10-5 1% biotin, 1% glycerol; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol.

[0023] The present invention will be described in detail below in conjunction with embodiments.

[0024] Example 1 Synthesis of Lipase Gene and Obtaining of Recombinant Plasmid The wild-type lipase gene was named TL, its nucleotide sequence was SEQ ID NO: 1, and its encoded amino acid sequence was SEQ ID NO: 2. This gene was synthesized by Shanghai Jierui Bioengineering Co., Ltd.

[0025] According to the 5'-end of the gene, the PCR primer was designed to contain the EcoRI restriction enzyme site, and the 3'-end primer was designed to contain the NotI restriction enzyme site. The primer sequences were as follows: 5'-end primer TL-F: GGC GAATTC GAAGTGAGCCAGGACCTGTTC (the underlined part is the recognition site of the restriction enzyme EcoRI); 3'-end primer TL-R: ATA GCGGCCGC TCACAGACAGGTGCCGATCAG (the underlined part is the recognition site of the restriction enzyme NotI).

[0026] Using the synthesized lipase TL gene SEQ ID NO: 1 as a template, PCR amplification was carried out with the above primers. The PCR amplification system was: 1 μL of template, 1 μL of upstream primer TL-F, 1 μL of downstream primer TL-R, 10 μL of 5×PSBuffer, 4 μL of dNTPs (2.5 mM), 1 μL of Primer-Star DNA polymerase, and 32 μL of ddH 2 O, and the total reaction system was 50 μL. The PCR cycling program was: pre-denaturation at 95°C for 5 min, 30 cycles: 94°C for 30 sec, 56°C for 30 sec, 72°C for 1 min, and 72°C for 10 min; the PCR product was recovered by gel, digested with EcoRI and NotI, and then ligated overnight at 16°C with the pPIC-9k vector digested with the same enzymes and transformed into Escherichia coli DH5a. It was spread on an LB + Amp plate and cultured upside down at 37°C. After the transformants appeared, colony PCR was used to verify the positive clones. After sequencing verification, the correct recombinant plasmid pPIC9K-TL ( Figure 1 ) was finally obtained.

[0027] Example 2 Screening of Lipase Mutants To further improve the catalytic efficiency of lipase TL for the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE), without destroying the protein secondary structure and active center, a large number of random screening of mutation sites of this enzyme was further carried out.

[0028] (1) Construction of mutant library Using the synthesized lipase TL gene SEQ ID NO: 1 as a template, error-prone PCR amplification was carried out with the above primers and TL-F, TL-R respectively. The 100ul error-prone PCR reaction system: buffer without Mg 2+ , 0.2uM primer, 7mM MgCl 2 , 0.2mM MnCl 2 , 0.2mM dGTP, 0.2mM dATP, 1.0mM dCTP, 1.0mM dTTP, 50ng template, 5U taq enzyme. The PCR cycling program was: pre-denaturation at 95°C for 5 min, 30 cycles: 94°C for 30 sec, 56°C for 30 sec, 72°C for 1 min, 72°C for 10 min; the PCR products were recovered by gel, digested with EcoRI and NotI, and then ligated overnight at 16°C with the pPIC-9k vector digested with the same enzymes and transformed into Escherichia coli DH5a. The transformation mixture was spread on an LB + Amp plate and cultured inverted at 37°C. After the transformants appeared, all colonies were washed with water and the plasmids were extracted, which was the lipase mutant library.

[0029] (2) Pichia pastoris transformation The Pichia pastoris GS115 strain was activated on a YPD plate and cultured at 30°C for 48 h. Then, the activated GS115 monoclonal was inoculated into 5 mL of YPD liquid medium and cultured at 30°C and 220 rpm for about 18 h. Then, the bacterial liquid was transferred to a triangular flask containing 50 ml of YPD liquid medium and cultured at 30°C and 220 rpm for about 5 h. The cell density was detected by an ultraviolet spectrophotometer. After the OD600 value was in the range of 1.1 - 1.3, 5 ml of cells were collected into a sterilized EP tube by centrifugation at 4°C and 6000 rpm for 3 min. The supernatant was gently discarded, and the residual supernatant was blotted dry with a sterilized filter paper. Then, the cells were resuspended with 2 mL of pre-cooled sterilized water and centrifuged at 4°C and 6000 rpm for 3 min. The supernatant was gently discarded, and the cells were resuspended with 2 mL of pre-cooled sorbitol (1 mol / L); centrifuged at 4°C and 6000 rpm for 3 min, the supernatant was gently discarded, and the cells were gently resuspended with 100 - 150 μl of pre-cooled sorbitol (1 mol / L).

[0030] The constructed lipase TL and the plasmid of the lipase mutant library were linearized with Sac I respectively. After the linearized fragments were purified and recovered, they were transformed into Pichia pastoris GS115 by electroporation respectively, and Pichia pastoris recombinant strains were screened on MD plates.

[0031] Single clone transformants were picked and transferred to 48-well plates containing 1 ml of BMGY medium. After shaking culture at 30 °C and 800 rpm for 1 day, 0.5% methanol was added every day. After induction expression for 2 days, the cells were removed by centrifugation to obtain the supernatant containing lipase, namely lipase enzyme solution. The catalytic reaction rate of lipase on the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate was detected by a high-throughput screening method.

[0032] (3)Mutant screening 20 μl of lipase enzyme solution was aspirated and added to 180 μl of pH 8.0 buffer for 10-fold dilution.

[0033] 180 μl of substrate (10 mM potassium phosphate buffer, pH 7.2, 0.01% bromophenol blue, 100 mM ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate) and 20 μl of diluted lipase enzyme solution were added to the enzyme-labeled plate and mixed evenly to obtain the reaction solution; the lipase TL enzyme solution was used as a control. The rate of the reaction solution changing from blue to yellow was used as the screening index. The faster the color changed from blue to yellow, the higher the reaction rate of lipase catalyzing the hydrolysis of the substrate ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate.

[0034] The results of multiple rounds of error-prone PCR screening showed that the catalytic reaction rates of 33 lipase mutants on the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate were greatly improved. The lipase sequences were cloned from these mutants and sequenced. After sequence alignment, the mutation sites and their combinations that could significantly improve the catalytic reaction rate of lipase on the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate were finally determined, which were: S3C, S3C / R232C, D27R, G38A, S58M, G91T, D96E, D111A, G163K, T226A, L227T, V228A, V230T, T231A / E / G / N / R / S, R232C / T, N233C / T, I235T, V236A, K237R, I238T, G240A, I241A, N251T, D254A / S, P256T.

[0035] Example 3 Catalytic efficiency of lipase mutants on the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE) The meaning of the Michaelis constant ( K m) is that the enzymatic reaction reaches the maximum velocity ( VThe concentration of the substrate (S) when the enzyme's maximum value is half. It is a characteristic physical quantity of the enzyme, and its size is related to the properties of the enzyme. K The smaller m is, the lower the substrate concentration required for the enzyme to react, that is, the greater the affinity between the enzyme and the substrate.

[0036] K cat is also called the turnover number. V The max is calculated by dividing the enzyme concentration. K cat represents how many moles of substrate can be converted into product per mole of enzyme per unit time. K The larger the cat, the higher the activity of the enzyme.

[0037] The Pichia pastoris strains expressing the recombinant lipase TL and its lipase mutant constructed in Example 2 were inoculated into shake flasks containing BMGY medium, and after shaking culture at 30°C and 220rpm for 1 day, they were transferred to fresh BMMY medium and 0.5% methanol was added every day. After induced expression for 3 days, the cells were removed by centrifugation to obtain a supernatant containing lipase, i.e., a lipase enzyme solution. The enzyme solution was diluted with PBS buffer to an enzyme activity of 50 U / ml.

[0038] The kinetic constants and enantiomeric selectivity of lipase in the supernatant were measured according to the following methods.

[0039] (1) Determination of enzyme-catalyzed reaction kinetic constants Michaelis constants of lipase TL and its mutants ( K m) and the maximum reaction rate ( V The reaction temperature was 40 °C, the buffer pH was 7.5 (100 mM Tris-HCl), and the substrate 2-carboxyethyl-3-cyano-5-methylhexanoate (2-100 mM) was diluted to the corresponding concentration with 5% acetonitrile.

[0040] (2) Determination of enantioselective ee value The 1L reaction system contained 150mM calcium acetate, 3M substrate 2-carboxyethyl-3-cyano-5-methylhexanoic acid ethyl ester, and 5% lipase enzyme solution. The temperature was controlled at 30°C, the stirring was 400rpm, the pH was automatically controlled to 7.0 with 5M NaOH, and the conversion rate and enantiomer ee value were detected by gas phase sampling every 10 hours.

[0041] The specific results are shown in Table 1.

[0042] Table 1 Kinetic constants and enantioselective ee values ​​of the lipase mutants for CNDE catalysis Lipase m (mM) <![CDATA V max (umol mg −1 min −1 )]]> <![CDATA K cat(min -1 )]]> <![CDATA K cat / K m (min −1 mM −1 )]]> ee value Wild-type TL 37.5 0.075 2.2 0.06 95.1% S3C single-point mutant 19.8 2.21 66.3 3.35 98.4% R232C single-point mutant 18.6 1.53 45.9 2.47 98.25% S3C / R232C double-point mutant 15.3 2.71 81.3 5.31 96.41% V228A single-point mutant 15.8 2.81 88.6 5.61 99.34% I238T single-point mutant 17.2 1.89 56.7 3.30 98.38% S254A single-point mutant 16.9 3.34 100.2 5.93 98.8% From the results in Table 1, it can be seen that compared with the wild-type lipase TL, the lipase mutants provided by the present invention have significantly improved enzymatic reaction kinetic constants for ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE), indicating that their catalytic efficiency for the hydrolysis of CNDE has been greatly improved. Among them, the catalytic constant Kcat value of the single-point mutant S254A reaches up to 100.2, which is 45 times that of the wild-type, and its enantioselectivity ee value reaches 99.34%, significantly higher than that of the wild-type.

[0043] The lipase mutants provided by the present invention can significantly improve the catalytic efficiency for the hydrolysis of ethyl 2-carboxyethyl-3-cyano-5-methylhexanoate (CNDE) and are widely used in the preparation of the key chiral intermediate (S)-2-carboxyethyl-3-cyano-5-methylhexanoic acid for the synthesis of pregabalin.

Claims

1. A lipase mutant, characterized in that the mutant comprises an amino acid sequence having at least 90% identity with SEQ ID NO:2, and comprises an amino acid substitution at at least one position selected from the following group: 3, 27, 38, 58, 91, 96, 111, 163, 226, 227, 228, 230, 231, 232, 233, 235, 236, 237, 238, 240, 241, 251, 254, 256 as compared with SEQ ID NO:

2.

2. The mutant according to claim 1, characterized in that the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity as compared with SEQ ID NO:

2.

3. The mutant according to claim 1, characterized in that the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity as compared with SEQ ID NO:

2.

4. The mutant according to any one of claims 1-3, characterized in that the mutant comprises at least one amino acid substitution or combination of substitutions selected from the following group: S3C, S3C / R232C, D27R, G38A, S58M, G91T, D96E, D111A, G163K, T226A, L227T, V228A, V230T, T231A / E / G / N / R / S, R232C / T, N233C / T, I235T, V236A, K237R, I238T, G240A, I241A, N251T, D254A / S, P256T.

5. A DNA molecule encoding the lipase mutant according to any one of claims 1-4.

6. A recombinant expression plasmid comprising the DNA molecule according to claim 5.

7. A host cell, characterized in that the host cell comprises the recombinant expression plasmid according to claim 6.

8. The host cell according to claim 7, characterized in that The host cell described above is Pichia pastoris ( Pichia pastoris ).

9. The host cell according to claim 7, characterized in that The host cell described is Aspergillus niger ( Aspergillus niger ).

10. The host cell according to claim 7, characterized in that The host cell described is Trichoderma reesei ( Trichoderma reesei ).

Images