Primary-miRNA and application thereof

Abstract

The invention provides a primary miRNA (micro Ribonucleic Acid), a precursor miRNA processed from the primary miRNA or a miRNA molecule. The invention also provides a delivery system, such as an exosome, of the primary-miRNA, precursor miRNA or miRNA molecule, and pharmaceutical compositions containing the same. The invention also provides an application of the primary miRNA, the precursor miRNA or the miRNA molecule in disease treatment and drug preparation.

Description

[0001] This application claims the priority of a Chinese patent application with the application number 202311646805.9 and the invention title "Primary-miRNA and Its Applications", which was filed on December 1, 2023, and the entire content of which is incorporated herein by reference. Technical Field

[0002] The present invention relates to the fields of molecular biology and medicine. Specifically, the present invention relates to precursor miRNAs and miRNA molecules, their delivery systems, and their applications in the treatment of diseases. Background Art

[0003] MicroRNAs (or miRNAs or miRs) are small, non-coding, single-stranded ribonucleic acid molecules (RNAs), which are often 19-25 nucleotides in length. More than 1,000 microRNAs have been identified in the mammalian genome. Mature miRNAs mainly bind to the 3'-untranslated region (3'-UTR) of target messenger RNA (mRNA) by partially or completely pairing with the complementary sequence of the target mRNA, thereby promoting the degradation of target mRNA at the post-transcriptional level, and in some cases, inhibiting the initiation of translation. miRNAs play a key role in many key biological processes, such as the regulation of the cell cycle and growth, apoptosis, cell proliferation, and tissue development.

[0004] miRNA genes are usually transcribed into primary transcripts of miRNAs - primary microRNAs (i.e., primary-miRNAs, pri-miRNAs). The primary-miRNAs are cleaved into precursors of miRNAs (i.e., precursor-miRNAs, pre-miRNAs), which are further processed to produce mature and functional miRNAs.

[0005] There is still a need in the art for improved constructs containing primary-miRNAs, precursor-miRNAs, and mature microRNAs with higher specificity and fewer off-target effects, as well as suitable delivery systems for safely, precisely, and efficiently delivering artificial miRNAs or siRNAs to target tissues.

[0006] Parkinson's disease is a common neurodegenerative disease with an incidence rate of 2% in people over 60 years old. Although some clinical methods have been used to relieve the symptoms of Parkinson's disease and improve the motor function of Parkinson's disease patients, there is currently no treatment method that can stop or reverse the degenerative process of Parkinson's disease.

[0007] Parkinson's disease is divided into familial or sporadic, and the majority of patients (about 90%) have sporadic Parkinson's disease. LRRK2 mutations are the most common genetic cause of Parkinson's disease, accounting for 5 - 13% of familial Parkinson's disease and 1 - 5% of the sporadic form. The protein encoded by the LRRK2 gene has 2,527 amino acids and contains multiple functional domains. The most common mutations in LRRK2 are concentrated in the GTPase domain (R1441C / G / H) and the kinase domain (G2019S and I2020T), and the hyper-enzymatic activity of these mutants is associated with many pathogenic features of Parkinson's disease, including dopaminergic neuron death, abnormal protein aggregation, impaired mitochondrial function, inflammation, and oxidative damage. On the other hand, researchers have also found that the kinase activity of wild-type LRRK2 is abnormally increased in the substantia nigra dopaminergic neurons of some Parkinson's disease patients. Therefore, LRRK2 is a promising therapeutic target for this disease.

[0008] There is also a need in the art for better RNA-based therapeutic or prophylactic methods and agents for the treatment or prevention of Parkinson's disease. Summary of the Invention

[0009] The present invention provides polynucleotides that function as microRNAs (or miRNAs or miRs) or siRNAs for regulating (increasing or decreasing) the level or amount of target gene mRNA. The polynucleotides provided by the present invention include precursor molecules that are processed intracellularly prior to regulation. The regulatory polynucleotides or their processed forms can be encoded in plasmids, vectors, genomes, or other nucleic acid expression vectors for delivery to cells.

[0010] The polynucleotides provided by the present invention include primary microRNAs (pri-miRNAs or pri-miRs) or precursor microRNAs (pre-miRNAs or pre-miRs), which are processed intracellularly to generate highly specific artificial microRNAs or siRNAs.

[0011] The term "microRNA (or miRNA or miR)" herein refers to a non-coding RNA that is 19 - 25 nucleotides in length and binds to the 3′UTR of a nucleic acid molecule and downregulates gene expression (by reducing nucleic acid molecule stability or by inhibiting translation). The regulatory polynucleotides of the present invention can comprise one or more microRNA sequences, microRNA seeds, or artificial microRNAs, for example, sequences that function as microRNAs.

[0012] The term "pri-miRNA" in this article refers to primary microRNA. Pri-miRNA is the primary transcript of miRNA genes. The term "pre-miRNA" refers to precursor microRNA. Pre-miRNA is about 70 bases long and is generated in the nucleus after pri-miRNA is cleaved by Drosha. Pre-miRNA is exported to the cytoplasm by exportin 5, where they are processed by the nuclease Dicer to form mature miRNA.

[0013] The term "siRNA" in this article refers to small interfering RNA, which is sometimes also referred to as short interfering RNA or silencing RNA. It is a class of double-stranded RNA, usually 17-24 base pairs in length. It blocks translation by degrading mRNA with a nucleotide sequence complementary to the antisense strand (also known as the guide strand) of siRNA, thereby interfering with the expression of specific genes.

[0014] The polynucleotide provided by the present invention can efficiently deliver an exogenous nucleotide sequence to exosomes, specifically inhibit the target gene in the target cells after the exosomes reach the target cells, and can largely avoid the side effects caused by off-target effects.

[0015] In one aspect of the present invention, there is provided a primary microRNA, namely pri-miRNA, wherein the pri-miRNA comprises an RNA sequence targeting a target mRNA and a stem-loop structure.

[0016] Specifically, in one aspect of the present invention, there is provided a pri-miRNA, wherein the pri-miRNA has the following structure:

[0017]

[0018] Wherein, "|" represents base pairing (fully complementary or substantially fully complementary), (A 1 A 2 …A a-1 A a ) is the first RNA sequence; (B b B b-1 …B 2 B 1 ) is the second RNA sequence, (A 1 A 2 …A a-1 A a ) is fully complementary or substantially fully complementary to (B b B b-1 …B 2 B 1 ), where a and b are each independently an integer of about 15-29, preferably an integer of about 18-22;

[0019] [M 1 M 2 …M m-1 M m is the 5'-terminal flanking structural sequence; [N n N n-1 …N 2 N 1 is the 3'-terminal flanking structural sequence, wherein m and n are each independently an integer of about 25-50, and preferably, m < n;

[0020] is the spacer sequence for forming the stem-loop structure, called the C stem-loop,

[0021] wherein c is an integer of about 10-30, preferably an integer of about 16-20.

[0022] The pri-miRNA provided by the present invention generates pre-miRNA and then miRNA after biological processing (in vivo, in tissues or in cells, etc.) (which can be abbreviated as "processing" in this article), and finally generates an RNA sequence targeting the target mRNA. In the present invention, the structure composed of the 5'-terminal flanking structural sequence [M 1 M 2 …M m-1 M m and the first RNA sequence (A 1 A 2 …A a-1 A a ) is also called the 5' arm, and the first RNA sequence (A 1 A 2 …A a-1 A a ) is called the 5' arm RNA sequence or 5' arm miRNA. Correspondingly, the structure composed of the 3'-terminal flanking structural sequence [N n N n-1 …N 2 N 1 and the second RNA sequence (B b B b-1 …B 2 B 1 ) is also called the 3' arm, and the second RNA sequence (B b B b-1 …B 2 B 1) is called the 3'-arm RNA sequence or 3'-arm miRNA. The pre-miRNA provided by the present invention contains an RNA sequence targeting the target mRNA, which can be located or positioned on the 5'-arm or 3'-arm of the stem-loop structure of the regulatory polynucleotide, that is, the first miRNA sequence or the second miRNA sequence. The pre-miRNA provided by the present invention can generate one or two single-stranded mature miRNAs. Processed from the 5'-terminal arm and 3'-terminal arm of the precursor, the single-stranded mature miRNA corresponding to the first miRNA sequence (A 1 A 2 …A a-1 A a ) can be called miRNA-5p, and the mature miRNA corresponding to the second miRNA sequence (B b B b-1 …B 2 B 1 ) can be called miRNA-3p.

[0023] The miRNA can be substantially complementary to at least a part of the sequence of the mRNA of the coding gene. "Substantially complementary" means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming a secondary structure. Generally, two "substantially complementary" nucleotide sequences have at least 70% of the nucleotides complementary to each other; preferably, at least 80% of the nucleotides are complementary; more preferably, at least 90% of the nucleotides are complementary; further preferably, at least 95% of the nucleotides are complementary; such as 98%, 99% or 100%. Functionally, the miRNA interferes with the post-transcriptional degradation of the mRNA expressing the specific gene with the complementary nucleotide sequence, thereby preventing translation.

[0024] In one aspect of the present invention, the length of the miRNA is 15-29 nucleotides (nt), preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, 22 nt. A large number of experiments have proved that when the length of the RNA sequence is less than 18 nt, especially less than 15 nt, most of the RNA sequences are ineffective and will not play a role, while when the length of the RNA sequence is greater than 22 nt, especially greater than 25 nt, not only the cost of the line is greatly increased, but also the effect is not better than that of the RNA sequence with a length of 18-22 nt, and the economic benefit is poor. Therefore, when the length of the miRNA sequence is 15-25 nt, especially 18-22 nt, the effect is the best.

[0025] In one aspect of the present invention, the miRNAs obtained by biologically processing the pri-miRNA provided by the present invention and having the first miRNA sequence or the second miRNA sequence are all active, that is, both the 5'-arm miRNA and the 3'-arm miRNA are active.

[0026] In one aspect of the present invention, the pri-miRNA provided by the present invention, after biological processing, basically only yields miRNAs with sequences of the first miRNA sequence or the second miRNA sequence, while the other RNA sequence does not form or hardly forms miRNAs. In one embodiment of the present invention, the miRNA with the sequence of the first miRNA sequence obtained after in vivo processing of the pri-miRNA provided by the present invention is active, that is, the 5'-arm miRNA is active, while it is hardly possible to obtain the miRNA with the sequence of the second miRNA sequence, that is, the 3'-arm miRNA is not active or hardly active.

[0027] In the present invention, it is advantageous that the provided pri-miRNA has high guide strand activity and low passenger strand activity.

[0028] In one aspect of the present invention, the miRNA that hardly forms after biological processing of the pri-miRNA provided by the present invention accounts for less than 40%, preferably less than 10%, more preferably less than 5%, for example, less than or equal to 1% of the total miRNAs obtained after processing of the pri-miRNA.

[0029] In one aspect of the present invention, the mRNA or protein target knockdown (KD) achieved by the miRNA with sequences of the first miRNA sequence or the second miRNA sequence obtained after biological processing of the pri-miRNA provided by the present invention is at least higher than about 50%, 75%, 90%, 95%, or reaches 99%.

[0030] In one aspect of the present invention, the mRNA or protein target knockdown achieved by the miRNA that hardly forms after biological processing of the pri-miRNA provided by the present invention is lower than about 40%, 10%, 5%, or is close to 0.

[0031] In one aspect of the present invention, the miRNA with sequences of the first miRNA sequence or the second miRNA sequence obtained after biological processing of the pri-miRNA provided by the present invention does not produce off-target effects.

[0032] In one aspect of the present invention, in the pri-miRNA provided by the present invention, the second miRNA sequence (B b B b-1 …B 2 B 1 ) is completely complementary to the first miRNA sequence (A 1 A 2 …A a-1 A a ).

[0033] In one aspect of the present invention, the second miRNA sequence (B b B b-1 …B 2 B 1 ) of the pri-miRNA provided by the present invention is substantially complementary to the first miRNA sequence (A 1 A 2 …A a-1 A a ), but has several nucleotide unpaired regions. In one embodiment of the present invention, a is greater than b, preferably a is 1-3 greater than b, more preferably 1 or 2 greater, that is, the first miRNA sequence (A 1 A 2 …A a-1 A a ) of the 5'-arm has more nucleotides than the second miRNA sequence (B b B b-1 …B 2 B 1 ) of the 3'-arm, for example, 1-3 more nucleotides, preferably 1 or 2 more nucleotides. In one embodiment of the present invention, the unpaired bases or regions (regions formed by two or three consecutive unpaired bases) of the first miRNA sequence (A 1 A 2 …A a-1 A a ) and the second miRNA sequence (B b B b-1 …B 2 B 1 ) form a bubble structure: that is, the bases in the (A 1 A 2 …A a-1 A a ) that are not complementary to the (B b B b-1 …B 2 B 1 ) are located in the middle of the stem formed by the first RNA sequence (A 1 A 2 …A a-1 A a ) and the second RNA sequence (B b B b-1 …B 2 B 1 ), rather than at both ends of the stem. In one embodiment of the present invention, the first miRNA sequence (A 1 A 2 …A a-1 A a ) and the second miRNA sequence (B b Bb-1 …B 2 B 1 ) The unpaired bases are non-adjacent bases.

[0034] In one embodiment of the present invention, A a is C or G.

[0035] In one aspect of the present invention, the first RNA sequence or the second RNA sequence in the provided pri-miRNA is an RNA sequence that is complementary or substantially complementary to the RNA sequence for inhibiting the expression of a target gene, and the target genes for inhibition include the EGFR gene, the KRAS gene, the VEGFR gene, the mTOR gene, the TNF-α gene, the integrin-α gene, the B7 gene, the TGF-β1 gene, the H2-K gene, the H2-D gene, the H2-L gene, the HLA gene, the GDF15 gene, miRNA-21, miRNA-214, the TNC gene, the PTP1B gene, the mHTT gene, the LRRK2 gene, and the α-synuclein gene.

[0036] In one embodiment of the present invention, the target gene for inhibition of the provided pri-miRNA is the LRRK2 gene.

[0037] In one embodiment of the present invention, the first RNA sequence (A 1 A 2 …A a-1 A a ) is selected from the group consisting of the following nucleic acid sequences:

[0038] ATGTAAAATAGCTCGAAGCGC(SEQ ID NO:21); ACAAACAAGTGACAGAATCAG(SEQ ID NO:22); AAAGATATCAAACTGGGGTGG(SEQ ID NO:23); GTATAATTTGGAAGCCTAGGG(SEQ ID NO:24); AGAAAACAAGTAGCTAGTGGTA(SEQ ID NO:25); TGAAAATGAAGAAGGACTCCTG(SEQ ID NO:26); TCTTACTCAACAGATGTTCGTC(SEQ ID NO:27); TGAATGATGTAGGATCTGCAGC(SEQ ID NO:28); TCTAAGAGAGTTGACAATGCA(SEQ ID NO:29); TCAAACAGCACATGTAAAGCT(SEQ ID NO:30); TCTATCTGTTTTCCTTCCTGGA(SEQ ID NO:31); ATAAAGGACCAAGCCAAGAAGG(SEQ ID NO:32); ATCACTTTGAGCAAACACACT(SEQ ID NO:33); TTTACACTGGCATTATGAACT(SEQ ID NO:34); ATAAAGGACCAAGCCAAGAAG(SEQ ID NO:35); TGCAACAGCAACAAAGAGAAT(SEQ ID NO:36); TCCTAAAGCAGAAATGACCTC(SEQ ID NO:37); TTAATTTGCACAGAAGTGACC(SEQ ID NO:38).

[0039] In one embodiment of the present invention, the combination of the first RNA sequence (A 1 A 2 …A a-1 A a ) and the second miRNA sequence (B b B b-1 …B 2 B 1 ) is selected from the following nucleic acid sequence groups:

[0040]

[0041]

[0042] The polynucleotides provided by the present invention, such as the aforementioned pri-miRNA, comprise modular elements or sequence motifs assembled according to a set of rules that result in highly specific target recognition and a high 5'-arm miRNA / 3'-arm miRNA ratio. These RNA, especially the modular or sequence motifs of pri-miRNA, include double-stranded regions, flanking regions, loops, non-Watson-Crick wobble G-U pairs (abbreviated as "wobble pairs" or "G-U pairs"). It has been found that the accurate recognition of RNA helices (A-type or B-type) by RBPs to form stable RNA-protein complexes may depend on the non-Watson-Crick wobble G-U pairs observed in naturally occurring pri-miRNA. Studies on the three-dimensional structures of large RNA-protein complexes have found that wobble G-U pairs are key structural elements that distort the deep groove of RNA to allow the natural folding of RNA and are recognized by RBPs. These RNA, especially the modular or sequence motifs of pre-miRNA, form RNA secondary or tertiary structures including loops, bulges, mismatches, wobbles, and / or combinations thereof.

[0043] In one embodiment of the present invention, 1-3 base pairs adjacent to the stem formed by the C stem-loop of the pri-miRNA and the first miRNA sequence (A 1 A 2 …A a-1 A a ) and the second miRNA sequence (B b B b-1 …B 2 B 1 ) are complementary or are non-Watson-Crick wobble G-U pairs (abbreviated as "wobble pairs" or "G-U pairs"). In yet another embodiment of the present invention, 1-2 base pairs adjacent to the stem formed by the C stem-loop of the pri-miRNA and the first miRNA sequence (A 1 A 2 …A a-1 A a ) and the second miRNA sequence (B b B b-1 …B 2 B 1 ) are wobble pairs (G-U).

[0044] In one embodiment of the present invention, the sequence of the C stem-loop is selected from:

[0045] TTTTTGCCTCCAACTGA (SEQ ID NO: 39);

[0046] GTTTTGGCCTCTGACTGAC (SEQ ID NO: 40);

[0047] GTTTTGGCCACTGACTGAC (SEQ ID NO: 59);

[0048] TTTTTGGCCTCTGACTGAA (SEQ ID NO: 60).

[0049] In the present invention, the [M 1 M 2 …M m-1 M m in the aforementioned pri-miRNA provided by the present invention is the 5'-terminal flanking structural sequence; the [N n N n-1 …N 2 N 1 is the 3'-terminal flanking structural sequence, and the [M 1 M 2 …M m-1 M m and the [N n N n-1 …N 2 N 1 form a stem or a stem-loop structure. This stem-loop secondary structure contains one or more base pair mismatches in the stem. These mismatched base pairs create unpaired regions within the stem. In some embodiments, the length of the mismatched region can be 1 to 5 nucleotides, such as 1, 2, 3, 4, or 5 nucleotides.

[0050] In one aspect of the present invention, in the pri-miRNA provided by the present invention, the 5'-terminal flanking structural sequence [M 1 M 2 …M m-1 M m and the 3'-terminal flanking structural sequence [N n N n-1 …N 2 N 1 form a stem that is adjacent to the stem formed by the first RNA sequence (A 1 A 2 …A a-1 A a ) and the second RNA sequence (B b B b-1 …B 2 B 1 ) and there are base pairs.

[0051] In one aspect of the present invention, in the pri-miRNA provided by the present invention, the 5'-terminal flanking structural sequence [M 1 M 2 …M m-1 M m and the 3'-terminal flanking structural sequence [Nn N n-1 …N 2 N 1 have a sequence identity greater than 80%, preferably greater than 90%, preferably greater than 95%, and preferably 100% with the corresponding structural sequences of pri-miRNA of mammals (preferably humans), preferably pri-miR155, whose sequence is as shown in SEQ ID NO: 20, independently or simultaneously.

[0052] In one embodiment of the present invention, the 5'-terminal flanking structural sequence [M 1 M 2 …M m-1 M m is selected from:

[0053] CTGAAGGCTTGCTGTGAGCTGTATGCTG (SEQ ID NO: 61);

[0054] CTGAAGGCTTGCTGTAGGCTGTATGCTG (SEQ ID NO: 62);

[0055] TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 63);

[0056] TGGAGGCTTGCTTTGGGCTGTATGCTG (SEQ ID NO: 64).

[0057] In one embodiment of the present invention, the 3'-terminal flanking structural sequence [N n N n-1 …N 2 N 1 is selected from:

[0058]

[0059] In one embodiment of the present invention, the combination of the sequences of the 5'-terminal flanking structural sequence [M 1 M 2 …M m-1 M m and the 3'-terminal flanking structural sequence [N n N n-1 …N 2 N 1 is selected from:

[0060]

[0061] In one aspect of the present invention, the loop of the C stem-loop in the provided pri-miRNA has sequences capable of forming base pairs, thereby forming a stem-loop structure as shown below

[0062]

[0063] where x is an integer of about 4 - 5, preferably 4; y is an integer of about 1 - 3, preferably 2.

[0064] In one embodiment of the present invention, the C x C x+1 C x+y is UUG.

[0065] In one embodiment of the present invention, the nucleotide sequence of the C stem-loop in the provided pri-miRNA is TTTTTGCCTCCAACTGA (SEQ ID NO: 39).

[0066] In one embodiment of the present invention, the 5'-flanking structural sequence [M 1 M 2 …M m-1 M m is selected from:

[0067] CTGAAGGCTTGCTGTGAGCTGTATGCTG (SEQ ID NO: 61);

[0068] CTGAAGGCTTGCTGTAGGCTGTATGCTG (SEQ ID NO: 62).

[0069] In one embodiment of the present invention, the 3'-flanking structural sequence [N n N n-1 …N 2 N 1 is selected from:

[0070] GTGTATGATGCTCGTTATCAGCATTCACAT (SEQ ID NO: 65);

[0071] GTGTATGATGCCTGTTACTAGCATTCACAT (SEQ ID NO: 66).

[0072] In one embodiment of the present invention, the 5'-flanking structural sequence [M 1 M 2 …M m-1 M m and the 3'-flanking structural sequence [Nn N n-1 …N 2 N 1 of the sequence is selected from:

[0073]

[0074] In one embodiment of the present invention, the nucleotide sequence of the first miRNA sequence is shown as any one of SEQ ID NO: 21 to SEQ ID NO: 32.

[0075] In one embodiment of the present invention, the pri-miRNA is a nucleic acid molecule having a nucleotide sequence shown as any one of SEQ ID NO: 1 to SEQ ID NO: 12.

[0076] In one aspect of the present invention, the 5'-terminal flanking structural sequence [M 1 M 2 …M m-1 M m and the 3'-terminal flanking structural sequence [N n N n-1 …N 2 N 1 have 2-3 stem structures formed by complementary or substantially complementary sequences, and the non-complementary or missing nucleotides between the complementary sequences form 1-2 bubble structures. In one embodiment of the present invention, the 3'-terminal flanking structural sequence [N n N n-1 …N 2 N 1 has a fragment about 10-20 nucleotides longer at the 3'-end than the 5'-terminal flanking structural sequence [M 1 M 2 …M m- 1 M m .

[0077] In one embodiment of the present invention, the sequence of the 5'-terminal flanking structural sequence [M 1 M 2 …M m-1 M m is selected from:

[0078] TGGAGGCTTGCTGAAGGCTGTATGCTG <![CDATA[(SEQ ID NO : 63);]]> TGGAGGCTTGCTTTGGGCTGTATGCTG <![CDATA[(SEQ ID NO : 64).]]>

[0079] In one embodiment of the present invention, the sequence of the 3'-terminal flanking structural sequence [N n N n-1 …N 2 N 1 is selected from:

[0080]

[0081] In one embodiment of the present invention, the 5'-terminal flanking structural sequence [M 1 M 2 …M m-1 M m and the 3'-terminal flanking structural sequence [N n N n-1 …N 2 N 1 are selected from the following combinations:

[0082]

[0083] In one embodiment of the present invention, the sequence of the C stem-loop is selected from:

[0084]

[0085]

[0086] In one embodiment of the present invention, the nucleotide sequence of the first miRNA sequence is as shown in any one of SEQ ID NO: 33 to SEQ ID NO: 38. Preferably, the nucleotide sequence of the first miRNA sequence is as shown in SEQ ID NO: 35.

[0087] In one embodiment of the present invention, the pri-miRNA is a nucleic acid molecule having a nucleotide sequence as shown in any one of SEQ ID NO: 13 to SEQ ID NO: 19. Preferably, it is a nucleic acid molecule having the nucleotide sequence as shown in SEQ ID NO: 15.

[0088] In one aspect of the present invention, a pre-miRNA is provided, which has the following structure:

[0089]

[0090] Wherein, "|" represents base pairing, (A 1 A 2 …A a-1 A a ) is the first RNA sequence; (B b B b-1 …B 2 B 1 ) is the second RNA sequence, and (A 1 A 2 …A a-1 A a ) pairs with (B b Bb-1 …B 2 B 1 ) are completely complementary or substantially completely complementary;

[0091] The spacer sequence that forms the stem-loop structure is called the C stem-loop.

[0092] Wherein (A 1 A 2 …A a-1 A a ), (B b B b-1 …B 2 B 1 ) and the C stem-loop are as described above.

[0093] In one aspect of the present invention, the pre-miRNA provided by the present invention is obtained by processing the pri-miRNA of the present invention described above.

[0094] In one aspect of the present invention, an RNA molecule is provided, and its structure is:

[0095] 5’(A 1 A 2 …A a-1 A a )3’or 5’[(B 1 B 2 …B b-1 B b )3’.

[0096] Wherein (A 1 A 2 …A a-1 A a ) and (B b B b-1 …B 2 B 1 ) are as described above.

[0097] In one aspect of the present invention, the RNA molecule is obtained by processing the pri-miRNA or pre-miRNA of the present invention described above.

[0098] In one aspect of the present invention, siRNA is also provided. SiRNA, also known as short interfering RNA or silencing RNA, is a double-stranded RNA molecule with a length generally of 20-29 base pairs, and its double strands extend 2 nucleotides beyond the other end at both ends of the RNA. The corresponding siRNA can be obtained by processing the pri-miRNA or pre-RNA provided by the present invention above.

[0099] In one aspect of the present invention, there is provided a vector comprising a sequence encoding the aforementioned pri-miRNA, pre-miRNA or RNA molecule of the present invention. In yet another aspect of the present invention, the vector is an expression vector. The sequence encoding the pri-miRNA, pre-miRNA or RNA molecule of the present invention may be located downstream of a promoter of the vector (such as, but not limited to, CMV, U6, CBA or CBA promoter with SV40 intron). Additionally, the sequence encoding the pri-miRNA, pre-miRNA or RNA molecule of the present invention may be located upstream of a polyadenylation sequence.

[0100] In one embodiment of the present invention, the vector is a plasmid. In one embodiment of the present invention, after administration to a mammal, the plasmid can be enriched, transcribed and / or expressed in tissues (including: liver, lung, gastrointestinal tract, mammary gland, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, especially the liver), and the RNA fragment of the present invention is encapsulated in exosomes in the cells of the tissue.

[0101] In one embodiment of the present invention, the vector is a viral vector. For example, it can be a baculovirus expression vector, an adenovirus vector, a retrovirus vector, a herpesvirus vector or a lentivirus vector, etc. In one embodiment of the present invention, the vector is an adenovirus vector. Preferably, the adenovirus is adeno-associated virus type 5, adeno-associated virus type 8 or adeno-associated virus type 9. More preferably, the adenovirus is adeno-associated virus type 5.

[0102] In one embodiment of the present invention, after administration of the plasmid or viral vector to a mammal, it is enriched and expressed in the liver, and its product is largely encapsulated in exosomes.

[0103] In one aspect of the present invention, there is provided a cell comprising the aforementioned pri-miRNA, pre-miRNA or RNA molecule of the present invention. The cell of the present invention comprising the pri-miRNA, pre-miRNA or RNA molecule can be obtained by transfecting a cell with a plasmid or viral vector comprising a sequence encoding the aforementioned pri-miRNA, pre-miRNA or RNA molecule of the present invention. Transfecting a cell with a nucleic acid construct can be carried out using a variety of methods. These methods include but are not limited to cationic lipid transfection, electroporation, viral transfection and calcium phosphate transfection.

[0104] In one aspect of the present invention, there is provided an exosome having an RNA that inhibits gene expression, and the RNA is the pri-miRNA, pre-miRNA or RNA molecule of the present invention as described above. In one embodiment of the present invention, the exosome is an exosome derived from human tissues or cells. The tissues include liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes. In one embodiment of the present invention, the exosome is an exosome derived from the liver or liver cells.

[0105] The exosomes of the present invention can be purified using known exosome purification techniques. For example, exosomes can be purified by tangential flow filtration (TFF) or ultracentrifugation, such as 100,000 x g for 1-2 hours. Alternative or additional purification methods can be used, such as antibody-based methods, for example immunoprecipitation using specific antibodies, magnetic bead purification, resin-based purification. Subsequently, the exosomes can be quantified and characterized.

[0106] The pri-miRNA, pre-miRNA or RNA provided by the present invention inhibits its specific target gene in different tissues and treats related diseases. For example: siRNA of the REGFR gene, siRNA of the TNC gene or a combination of the two for the treatment of glioblastoma, siRNA of the PTP1B gene for the treatment of obesity, siRNA of the mHTT gene for the treatment of Huntington's disease, siRNA of the LRRK2 gene for the treatment of Parkinson's; siRNA of the EGFR gene for the treatment of diseases such as lung cancer induced by high expression or mutation of the EGFR gene; siRNA of the TNF-α gene, siRNA of the integrin-α gene, siRNA of the B7 gene or any combination of the above three for the treatment of colitis or colon cancer, etc.

[0107] In one aspect of the present invention, there is provided a pharmaceutical composition containing the nucleic acid, vector or exosome as described above. The pharmaceutical composition further includes a pharmaceutically acceptable carrier or excipient for delivering the nucleic acid, vector or exosome to a subject.

[0108] The administration methods of the drug include oral administration, inhalation, subcutaneous injection, intramuscular injection, and intravenous injection. That is, the drug can be administered by oral administration, inhalation, subcutaneous injection, intramuscular injection, or intravenous injection. The dosage form of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc. After the plasmid or viral vector in the drug is administered to a mammal, it accumulates in tissues (including: liver, lung, gastrointestinal tract, mammary gland, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, especially the liver), and the products expressed are abundantly encapsulated in exosomes in the cells of this tissue and delivered to the target tissue to exert a therapeutic effect.

[0109] The pharmaceutical composition can be used to treat various diseases, including tumors, acute and chronic infectious diseases, or other acute and chronic diseases. Among them, the acute and chronic infectious diseases include: viral influenza, viral hepatitis, AIDS, viral diseases such as SARS, bacterial diseases (such as tuberculosis, bacterial pneumonia), and acute and chronic infectious diseases caused by various other pathogenic microorganisms. The other acute and chronic diseases include: respiratory diseases, immune system diseases, blood and hematopoietic system diseases, circulatory system diseases such as cardiovascular and cerebrovascular diseases, endocrine system metabolic diseases, digestive system diseases, nervous system diseases, urinary system diseases, reproductive system diseases, and locomotor system diseases. For example, the diseases are cancer, pulmonary fibrosis, colitis, obesity, cardiovascular diseases caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.

[0110] In one aspect of the present invention, a method for treating a disease is provided, which includes administering the nucleic acid, vector, or exosome as described above to an object. The diseases include tumors, acute and chronic infectious diseases, or other acute and chronic diseases. In one aspect of the present invention, the use of the nucleic acid, vector, or exosome as described above in the preparation of a drug for treating a disease is also provided.

[0111] Those skilled in the art understand that the actual dosage of administration varies depending on various factors, such as the vector, target cells or tissues, the general condition of the subject to be treated, the degree of transformation / modification sought, the administration route, the administration method, the type of transformation / modification sought, and so on. Detailed implementation manners

[0112] The following will further illustrate the essential content and beneficial effects of the present invention in combination with examples. These examples are only used to illustrate the present invention and not to limit the present invention.

[0113] Example 1 Materials and methods

[0114] Table 1 Cells, materials, and kits:

[0115]

[0116]

[0117] Example 2 Nucleic Acid Synthesis and Plasmid Preparation

[0118] 1. Entrust Jinweizhi Biotechnology Co., Ltd. in Jiangsu to synthesize the nucleic acid fragments in Table 2 below.

[0119] Table 2 Sequences and Structures of pri-miRNA Fragments

[0120]

[0121]

[0122]

[0123] Among them, the first miRNA sequence and the second miRNA sequence carried by the 5' arm and the 3' arm of each pri-miRNA fragment are shown in Table 3 below.

[0124] Table 3 miRNA Sequences of the 5' Arm and 3' Arm of pri-miRNA Fragments

[0125]

[0126] 2. Construct plasmids containing the above pri-miRNA fragments and expressing the miRNAs contained

[0127] Insert the above pri-miRNA fragments into the pcDNA6.2-EmGFP-mir9 vector respectively to prepare LRRK2_miRNA plasmids, and the obtained plasmid names are LRRK2-1 to LRRK2-19 respectively.

[0128] Example 3 Cell and Exosome Preparation and Analysis

[0129] Transfect the plasmids prepared in Example 2 into HEK293T cells and observe the exosomes in the cell culture medium. Nanoparticle tracking analysis (NTA) shows that the number of exosomes secreted by each group is similar, the size distribution is similar, and the peak is between 128 - 131 nm. Transmission electron microscopy (TEM) confirms that the purified exosomes present a typical round vesicle morphology and the correct size. In addition, the enrichment of specific exosomal markers (CD63, TSG101, and CD9) is detected only in the purified exosomes and not in the cell culture medium. Extract exosomal RNA for miRNAseq and analyze the miRNA composition.

[0130] The results are shown in Table 4 below

[0131] Table 4 miRNA composition detection

[0132]

[0133] Example 4 miRNA activity

[0134] 1. Detection of relative miRNA activity by reporter gene

[0135] Insert the miRNA target (LRRK2 gene) sequence into the pmirGLO vector (Promega) to prepare LRRK2_pmirGLO, and name the obtained plasmid LRRK_pmirGLO.

[0136] The pmirGLO vector (Promega) can simultaneously express firefly luciferase and Renilla luciferase. Insert the pri-miRNA fragment of Table 2 with a target sequence for the LRRK2 gene downstream of the firefly luciferin gene in the pmirGLO vector at the 3'UTR to construct LRRK2_pmirGLO for detecting the activity of miRNAs targeting LRRK2.

[0137] Plate 293T cells (Cell Bank of the Chinese Academy of Sciences) in a 96-well white plate at a density of 20,000 cells per well overnight. Mix 20 μl of optiMEM, 100 ng of LRRK2_pmirGLO plasmid, 300 ng of miRNA plasmid, 0.8 μl of Lipofectamin 3000 (Thermo Fisher), and 0.8 μl of P3000 (Thermo Fisher) per well and incubate at room temperature for 10 minutes. Add all the transfection complexes to the cells in the 96-well plate. After 24 hours, add the reporter gene substrate (Promega) to detect the luminescence signal value, and calculate the relative miRNA activity through the Firefly / Renilla ratio.

[0138] The results are shown in Table 5 below

[0139] Table 5 Reporter gene activity detection

[0140]

[0141] 2. Changes in LRRK2 mRNA and protein levels

[0142] Plate 293T cells in a 6-well white plate at a density of 1.2E6 cells per well overnight. Transfect 2.5 μg of miRNA plasmid into 293T cells using Lipofectamin 3000 according to the instructions. Harvest the cells after 48 hours.

[0143] Extract cellular mRNA and use qPCR to detect changes in LRRK2 mRNA. Extract RNA using a total RNA extraction kit (UE) according to the instructions, add reverse transcription reagents (Takara) for reverse transcription, and use LRRK2 / GAPDH / β-acti primers for qPCR. The primer sequences are as follows:

[0144] Forward primer sequence (5' to 3') Reverse primer sequence (5' to 3') LRRK2 TTTTGATGCCATGCACTCATTTC GGAATCGCTAGGGAATGTAAACA GAPDH GAGAAGGCTGGGGCTCATTT TGATGACCCTTTTGGCTCCC β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

[0145] Use Western Blotting to detect changes in cellular LRRK2 protein. Take some cells and lyse them using RIPA (Beyotime), measure the total protein concentration using the BCA method (Adamas life), dilute the BSA standard, add 20 μL of the sample or standard to each well, add 200 μL of the reaction reagent, incubate at 37 °C for 30 minutes, measure the OD value at 562 nm using a microplate reader (Thermo Fisher), and calculate the total protein concentration of the sample according to the standard curve;

[0146] After adding 4X LDS (Thermo Fisher) to the sample, heat it at 70 °C for 10 min, load and run the gel and transfer the membrane using SDS-PAGE (Elabscience), add antibodies against LRRK2 (Abcam) and β-actin (Abcam) for incubation, and image and perform gray scale analysis on the LRRK2 and β-acti bands using a TANON 5200 multi imager and software.

[0147] The results are shown in Tables 6 and 7 below.

[0148] Table 6 miRNA activity detection - mRNA target knockdown (KD) effect

[0149]

[0150]

[0151] Table 7 miRNA activity detection - protein target knockdown (KD) effect

[0152]

[0153] The above is an explanation of the present invention and should not be regarded as a limitation on the present invention. Unless otherwise indicated, the practice of the present invention will use conventional techniques in organic chemistry, polymer chemistry, biotechnology, etc. Obviously, in addition to what is specifically described in the above description and examples, the present invention can be implemented in other ways. Other aspects and improvements within the scope of the present invention will be obvious to those skilled in the art to which the present invention pertains. According to the teachings of the present invention, many changes and variations are possible, and thus it is within the scope of the present invention.

Claims

1. A pri-miRNA, wherein the pri-miRNA comprises an RNA sequence targeting a target mRNA and a stem-loop structure, The pri-miRNA has the following structure: in, "|" indicates base pairing, (A1A2…A a-1 A a ) is the first RNA sequence (RNA-5p); (B b B b-1 ...B2B1) is the second RNA sequence (RNA-3p), (A1A2...A a-1 A a ) and (B b B b-1 …B2B1) are fully complementary or substantially fully complementary, wherein a and b are each independently an integer of about 15-29, preferably an integer of about 18-22; [M1M2…M m-1 M m ] is the 5' flanking structure sequence; [N n N n-1 ...N2N1] is a 3'-end flanking structure sequence, wherein m and n are each independently an integer of about 25-50, preferably, m <n; The separation sequence that forms the stem-loop structure is called the C stem-loop. wherein c is an integer of about 10-30, preferably an integer of about 16-20, The first RNA sequence or the second RNA sequence is an RNA sequence that is complementary or substantially complementary to an RNA sequence that inhibits the expression of a target gene, such as an EGFR gene, a KRAS gene, a VEGFR gene, a mTOR gene, a TNF-α gene, an integrin-α gene, a B7 gene, a TGF-β1 gene, a H2-K gene, a H2-D gene, a H2-L gene, a HLA gene, a GDF15 gene, miRNA-21, miRNA-214, a TNC gene, a PTP1B gene, a mHTT gene, a LRRK2 gene, and an α-synuclein gene.

2. The pri-miRNA according to claim 1, wherein (A1A2 ... A a-1 A a ) is a nucleotide sequence selected from SEQ ID NOs: 21-38, ATGTAAAATAGCTCGAAGCGC (SEQ ID NO: 21); ACAAACAAGTGACAGAATCAG (SEQ ID NO: 22); AAAGATATCAAACTGGGGTGG (SEQ ID NO: 23); GTATAATTTGGAAGCCTAGGG (SEQ ID NO: 24); AGAAAACAAGTAGCTAGTGGTA (SEQ ID NO: 25); TGAAAATGAAGAAGGACTCCTG (SEQ ID NO: 26); TCTTACTCAACAGATGTTCGTC (SEQ ID NO: 27); TGAATGATGTAGGATCTGCAGC (SEQ ID NO: 28); TCTAAGAGAGTTGACAATGCA (SEQ ID NO: 29); TCAAACAGCACATGTAAAGCT (SEQ ID NO: 30); TCTATCTGTTTTCCTTCCTGGA (SEQ ID NO: 31); ATAAAGGACCAAGCCAAGAAGG (SEQ ID NO: 32); ATCACTTTGAGCAACACACT (SEQ ID NO: 33); TTTACACTGGCATTATGAACT(SEQ ID NO: 34); ATAAAGGACCAAGCCAAGAAG (SEQ ID NO: 35); TGCAACAGCAACAAAGAGAAT (SEQ ID NO: 36); TCCTAAAGCAGAAATGACCTC (SEQ ID NO: 37); TTAATTTGCACAGAAGTGACC (SEQ ID NO: 38), Preferably, the (A1A2...A a-1 A a ) and (B b B b-1 ...B2B1) is selected from the following nucleic acid sequence group:

3. The pri-miRNA according to claim 1, wherein the C stem loop is (A1A2 ... A a-1 A a ) and (B b B b-1 …B2B1) contains 1-3 complementary base pairs adjacent to the stem, including a non-Watson-Crick wobble GU pair.

4. The pri-miRNA according to claim 1, wherein the sequence of the C stem loop is selected from: TTTTTGCCTCCAACTGA (SEQ ID NO: 39); GTTTTGGCCTCTGACTGAC (SEQ ID NO: 40); GTTTTGGCCACTGACTGAC (SEQ ID NO: 59); TTTTTGGCCTCTGACTGAA (SEQ ID NO: 60).

5. The pri-miRNA according to claim 1, wherein the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' flanking sequence [N n N n-1 ...N2N1] forms a stem that is connected to the first RNA sequence (A1A2...A a-1 A a ) and the second RNA sequence (B b B b-1 …B2B1) formed by the stem of base pairs.

6. The pri-miRNA according to claim 1, wherein the 5' end flanking structure sequence [M1M2...M m-1 M m ] and the 3' flanking sequence [N n N n-1 ...N2N1] is selected from the group consisting of the following sequences:

7. The pri-miRNA according to claim 1, which after being processed in vivo, substantially only obtains miRNA having the sequence of the first miRNA sequence.

8. The pri-miRNA according to claim 1, wherein the C stem-loop has a sequence that can form base pairs, thereby forming a stem-loop structure as shown below wherein x is an integer of about 4-5, preferably 4; y is an integer of about 1-3, preferably 2, More preferably, wherein said C x C x+1 C x+y For UUG. 9 . A cell and exosomes secreted therefrom, comprising the pri-miRNA according to any one of claims 1 to 8, or a pre-miRNA or miRNA molecule processed from the pri-miRNA.

10. A method for treating a disease, comprising administering the pri-miRNA according to any one of claims 1 to 8, or the pre-miRNA or miRNA molecule processed from the pri-miRNA, or the cell according to claim 9 or the exosomes thereof, Optionally, the disease is a tumor, an acute or chronic infectious disease or other acute or chronic disease, for example, the disease is cancer, pulmonary fibrosis, colitis, obesity, cardiovascular disease caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease or graft-versus-host disease.

Images