Application of AvRRM1 gene in regulating the endophytic fungus Heteromorpha to promote rice growth

Abstract

The present invention discloses the application of the AvRRM1 gene in regulating the endophytic fungus Heteromorpha to promote rice growth, and belongs to the field of genetic engineering technology. The nucleotide sequence of the AvRRM1 gene is shown in SEQ ID NO.1, and the application includes using biological technology to down-regulate the expression of the AvRRM1 gene in the Heteromorpha to improve the growth-promoting effect of Heteromorpha on rice. The present invention discloses for the first time the gene AvRRM1 that regulates rice growth in the rice endophytic fungus Heteromorpha. Functional verification of the gene found that knocking out the AvRRM1 gene made the strain's promotion of rice growth more significant. The research results have great application potential in sustainable agriculture. The present invention provides a feasible solution for promoting rice growth and increasing rice yield.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to application of the AvRRM1 gene in regulating the endophytic fungus Heteromorpha heterotropha to promote rice growth. Background Art

[0002] Rice ( Oryza sativa Rice (L.) is an annual aquatic herb belonging to the genus Oryza in the Poaceae family and is a key food crop for humanity. The healthy, stable, and sustainable development of the rice industry is crucial for ensuring food security and the development of the rice processing industry. With increasing awareness of ecological conservation, the search for environmentally friendly, ecologically safe, efficient, economical, and scalable strategies to reduce fertilizer use and stabilize rice yields is a common practice in the field.

[0003] In recent years, the application of beneficial microorganisms in agriculture has been increasing year by year. Endophytic fungi, as beneficial fungi that colonize healthy plants, have a wide range of biological functions. Mycologists and ecologists are increasingly interested in their use in promoting the growth and nutrient absorption of host plants. It has been reported that symbiotic fungi can secrete auxin-like substances to stimulate the development of plant roots, thereby enhancing the root system's absorption and utilization of nutrients, promoting plant growth and increasing yield (Chen, et al . Functional analysis of auxin derived from a symbiotic mycobiont. Frontiers in Plant Science , 2023.).

[0004] Wild rice, the origin of cultivated rice, possesses a variety of powerful and unique traits, including disease resistance and drought tolerance. Wild rice is reported to possess unique microbial community mechanisms, particularly within the rhizosphere, which possesses enormous potential for domestication. These core microorganisms can serve as bioinoculants for crops, promoting sustainable production. For example, patent document CN115287194A discloses the isolation of a strain of Acrocalymma vagum from wild rice roots. By colonizing rice root tissue, this strain significantly improves rice seedling quality and increases rice yield. Therefore, this biotechnology, which utilizes endophytic fungi to enhance plant quality and efficiency, could become a new approach alongside traditional high-yield variety breeding and transgenic cultivation techniques, and holds broad application prospects.

[0005] At present, there are few studies on the genes in endophytic fungi that regulate plant growth. By exploring the molecular mechanism of the interaction between endophytic fungi and plants, discovering key regulatory genes, and then using molecular biological methods to transform the relevant properties of endophytic fungi to enhance the growth of the interacting objects, they can be developed into microbial agents for use in agricultural production, which has important application value. Summary of the Invention

[0006] The purpose of the present invention is to explore genes from rice endophytes that have the ability to regulate host growth promotion, and provide a theoretical basis and related genes for the improvement of the endophyte-rice symbiotic system and the stable increase of rice yield.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] The present invention identified and cloned a gene with RNA sequence recognition and binding properties from Acrocalymma vagum A21-1-1, deposited with CCTCC NO: M 2021278, and named it AvRRM1. The gene's expression was significantly upregulated in a symbiotic system between Acrocalymma vagum A21-1-1 and rice.

[0009] Specifically, the AvRRM1 gene is 1330 bp in length, and its nucleotide sequence is shown in SEQ ID NO. 1. The gene sequence contains introns. AvRRM1 encodes a protein sequence consisting of 333 amino acid residues, and its amino acid sequence is shown in SEQ ID NO. 2.

[0010] This study knocked out the AvRRM1 gene in the genome of Acrocalymma vagum, generating the mutant ΔAvRRM1. Compared to the wild-type strain, this mutant significantly enhanced rice growth. Specifically, rice seedlings colonized with the mutant showed significant increases in plant height, root length, fresh weight, and chlorophyll content.

[0011] The above results indicate that the AvRRM1 gene is a key gene regulating the rice growth-promoting ability of the rice endophytic fungus Acrocalymmavagum.

[0012] Therefore, the present invention provides an application of the AvRRM1 gene in regulating the endophytic fungus Heteromorpha to promote rice growth. The application includes: using biological technology to downregulate the expression of the AvRRM1 gene in the Heteromorpha to enhance the growth-promoting effect of the Heteromorpha on rice. The nucleotide sequence of the AvRRM1 gene is as shown in SEQ ID NO.1 or has more than 70% homology with the sequence shown in SEQ ID NO.1 and the encoded protein has the same function.

[0013] In the present invention, the Acrocalymma vagum is an endophytic fungus that can coexist with rice and has the function of promoting rice growth, and is not limited to Acrocalymma vagum. A21-1-1 strain.

[0014] The present invention utilizes techniques known in the art to knock out the AvRRM1 gene in the genome of the rice endophytic fungus Heteromorpha. Compared to wild-type strains, the AvRRM1 knockout mutant exhibits enhanced rice growth-promoting properties. Such biological techniques may include, but are not limited to, genetic engineering techniques.

[0015] Furthermore, the application includes: using a gene homologous recombination method to knock out the AvRRM1 gene in the heteromorphic anastomosis to obtain a mutant strain, and then co-culturing the mutant strain with rice to allow it to colonize in the rice root tissue.

[0016] Furthermore, the Acrocalymmavagum heteromorphum can be Acrocalymmavagum with a preservation number of CCTCC NO: M 2021278. A21-1-1; can also be the strain disclosed in patent document CN115287194A.

[0017] Furthermore, the rice growth index includes at least one of rice stem and leaf height, root length, and stem and leaf and root fresh weight.

[0018] Another object of the present invention is to provide a method for promoting rice growth, which comprises: first, obtaining the upstream and downstream fragments of the AvRRM1 gene by PCR amplification reaction, cloning them into a gene knockout vector to construct a recombinant plasmid, then introducing the target fragments into Heteromorpha by Agrobacterium-mediated transformation technology to undergo homologous recombination, screening to obtain a mutant strain in which the AvRRM1 gene is knocked out, and then co-culturing the mutant strain with rice to obtain an AvRRM1 gene knockout strain-rice symbiotic system.

[0019] Furthermore, the sequences of the primer pair required for the PCR amplification reaction of the upstream fragment of the AvRRM1 gene are shown in SEQ ID NO.3 and SEQ ID NO.4; the sequences of the primer pair required for the PCR amplification reaction of the downstream fragment of the AvRRM1 gene are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0020] Furthermore, the gene knockout vector is a PKO1B vector; and the Agrobacterium is Agrobacterium AGL1.

[0021] Furthermore, before co-cultivation, the mutant strain was inoculated into PDA medium for activation culture and cultured in the dark at 25°C for 7 days.

[0022] Furthermore, the co-cultivation includes: inoculating the mutant strain into sterilized barley grains to obtain solid fermentation fertilizer, mixing it with rice planting matrix, and then transplanting germinated rice seeds into the mixed matrix for cultivation.

[0023] The present invention has the following beneficial effects:

[0024] The present invention discloses for the first time the gene AvRRM1 that regulates rice growth in the rice endophytic fungus Heteromorpha. Functional verification of the gene found that knocking out the AvRRM1 gene made the strain more significantly promoting rice growth. This research result has great application potential in sustainable agriculture. The present invention provides a feasible solution for promoting rice growth and increasing rice yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Figure 2 is a colony morphology diagram, where A is the colony morphology of the wild type; B is the colony morphology of the AvRRM1 deletion mutant strain; and C is the colony morphology of the AvRRM1 complemented strain.

[0026] Figure 2 This is a picture showing the AvRRM1 deletion mutant colonizing rice roots under a microscope.

[0027] Figure 3 The growth of rice in symbiosis with endophytic fungi in a pot experiment, where A is a photo of rice plants in pots; B is a photo of the specific morphology of rice seedlings after being pulled out of the soil matrix and cleaned.

[0028] Figure 4 The statistical results of rice plant height are shown in the figure. * indicates significant differences between groups, ** indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001.

[0029] Figure 5 The statistical results of rice fresh weight are shown in the figure. * indicates significant difference between groups, and **** indicates P < 0.0001.

[0030] Figure 6 The statistical results of rice root length are shown in the figure. * indicates significant differences between groups, * indicates P < 0.05, ** indicates P < 0.01, and **** indicates P < 0.0001.

[0031] Figure 7 The statistical results of rice chlorophyll content are shown in the figure. * indicates significant difference between groups, and ** indicates P < 0.01. DETAILED DESCRIPTION

[0032] The technical solution of the present invention is further described in detail below through specific examples. It should be understood that the implementation of the present invention is not limited to the following examples, and any form of modification and / or change made to the present invention will fall within the scope of protection of the present invention.

[0033] In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following examples, unless otherwise specified, are all conventional methods in the art.

[0034] This paper uses an endophytic fungus, Acrocalymma vagum A21-1-1, isolated from the roots of Yunnan wild rice in the previous work of the research group as the material, and studies the symbiotic interaction between Acrocalymmavagum A21-1-1 and rice by knocking out the AvRRM1 gene, in order to clarify the symbiotic interaction between Acrocalymma vagum and rice. The molecular mechanism by which A21-1-1 promotes rice growth is of great significance.

[0035] Acrocalymma vagum A21-1-1 was isolated from the roots of Oryza vagum and deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China on March 25, 2021, with the deposit number: CCTCC NO: M2021278. It was tested as alive by the collection center on April 1, 2021.

[0036] Example 1: AvRRM1 gene analysis

[0037] Previous studies have shown that the bacterium Acrocalymma vagum A21-1-1 colonizes the root tissues of rice plants and significantly promotes their growth. This mutually beneficial symbiotic relationship provides a foundation for studying the molecular mechanisms of rice growth.

[0038] Our research on Acrocalymma vagum Proteomic analysis of A21-1-1 co-cultured with rice revealed that a RRM protein was significantly upregulated. We selected this gene as a candidate gene and named it AvRRM1 to explore its role in Acrocalymma vagum A21-1-1 plays a role in promoting host growth.

[0039] Specifically, genome sequencing revealed that the nucleotide sequence of the AvRRM1 gene is shown in SEQ ID NO.1. The gene sequence contains introns, and the amino acid sequence encoded by the gene is shown in SEQ ID NO.2.

[0040] Example 2: Verification of AvRRM1 gene function

[0041] Endophyte tested: Acrocalymma vagum A21-1-1;

[0042] Test plant: Rice Oryza sativa L., conventional variety, CO39.

[0043] 1. Strain culture

[0044] The A21-1-1 strain stored on the PDA slant was inoculated on potato dextrose agar (PDA) solid medium for activation culture and cultured at 25°C in the dark for 7 days before use.

[0045] PDA medium: Contains 20 g glucose, 200 g potatoes, and 15 g agar per liter. Weigh the potatoes needed for the desired volume of medium, boil them in water, mash them, dissolve them, and filter them. Add the glucose and agar, and sterilize them by autoclaving at 121°C for 20 min.

[0046] 2. Obtaining the mutant strains ΔAvRRM1 and ΔAvRRM1c

[0047] Genomic DNA extraction: Use a toothpick to remove a 1×1 cm piece of fresh mycelial cake, 5-7 days old. Mix this with an appropriate amount of quartz sand and 500 μL of Extraction Buffer (1 M KCl, 100 mM Tris-HCl (pH 7.5), 10 mM EDTA). Mix the mixture in an MP Fast Prep®-24 homogenizer (65 Hz, 120 s). Centrifuge the mixture at 12,000 rpm for 10 min. Pipette the supernatant (300-350 μL) and mix with an equal volume of isopropanol. Vortex the mixture 7-8 times, then centrifuge at 12,000 rpm for 10 min. Discard the supernatant, add 800 μL of 70% ethanol, invert and mix 7-8 times, and centrifuge at 12,000 rpm for 2 min. Discard the supernatant, and place the centrifuge tube upside down on absorbent paper until the alcohol evaporates. Add 50 μL of dd H2O and dissolve at room temperature for 3 h, then store in a -20°C refrigerator.

[0048] Design upstream and downstream primers for the target gene, and use genomic DNA from strain A21-1-1 as a template to amplify the upstream and downstream fragments of the AvRRM1 gene, the AvRRM1 gene fragment, and the resistance gene G418 fragment. Specific primers are shown in Table 1.

[0049] Table 1

[0050] Primer name Sequence (5'-3') AvRRM1UP Forward GTACCCGGGGATCCTCTAGACAGCTTCGACATCTTGACAAG AvRRM1UP Reverse GCATTGATGTGTTGACCTCCGGTGGCCTAGTCTGGATGGGGC AvRRM1Down Forward CTTCTTGACGAGTTCTTCTGAAGTAATTAAGCCCTGTCTGC AvRRM1Down Reverse CGACGGCCAGTGCCAAGCTTGATAATCTTAACACGAAG AvRRM1cForward CAATCACAATGGCCGGATCCATGACCGAGGTGTCATCC AvRRM1cReverse CTTGCTCACCATCCCGGGGATGTAACGGCCACGGGGCGGGTAG G418 Forward GGAGGTCAACACATCAATGC G418 Reverse TCAGAAGAACTCGTCAAGAAGGCG

[0051] The pKO1B vector was digested with restriction endonucleases XbaI and HindIII. Following the instructions of the ClonExpress II OneStep Cloning Kit (Vazyme, China), the G418 resistance gene fragment was ligated to the upstream and downstream fragments of the target gene, respectively. These fragments were then ligated to the pKO1B vector. This construct was then used to construct a knockout vector and transformed into competent E. coli DH5α. Well-grown transformants were selected and placed in 1 mL of LB liquid medium (supplemented with 50 μg / mL kanamycin) and shaken at 200 rpm at 37°C for 4-6 hours. 1-2 μL of the bacterial culture was then added to the verification system for PCR amplification and gel electrophoresis.

[0052] Plasmids were extracted according to the instructions of AxyPrep-96 (Axygen, US). The plasmids were then transferred into competent Agrobacterium AGL1 and transformed into wild-type Acrocalymma vagum A21-1-1 via Agrobacterium-mediated transformation. DNA from the transformants was extracted for fragment length and copy number verification. The correct transformants were inoculated onto PDA medium for subsequent experiments and then onto PDA slants for storage, yielding the mutant ΔAvRRM1. The growth of ΔAvRRM1 on PDA medium is shown in Figure 2. Figure 1 As shown in B.

[0053] In addition, the AvRRM1 gene fragment was constructed on the overexpression vector pKD5-GFP by homologous recombination, transformed into Escherichia coli DH5α, the plasmid was extracted, and transformed into AGL1 Agrobacterium by freeze-thaw method. Finally, it was transformed into AvRRM1 knockout mutant by Agrobacterium-mediated transformation method. The complemented strain ΔAvRRM1c was obtained by sequencing verification. The growth of the complemented strain ΔAvRRM1c on PDA medium is shown in Figure 2. Figure 1 As shown in C.

[0054] Results showed that the knockout mutant strain ΔAvRRM1 and the complemented strain ΔAvRRM1c showed no significant differences in colony morphology from the wild-type strain. However, the knockout mutant strain ΔAvRRM1 grew faster than the wild-type and complemented strain ΔAvRRM1c, and within the same growth period, the mutant strain had a larger colony diameter. The hyphae were white, circular, radially symmetrical, with a pale yellowish back and cracks, and the aerial hyphae were not thriving.

[0055] Example 3: Effect of solid fermentation fertilizer on the growth promotion of potted rice

[0056] 1. Rice seed germination: Wash rice seeds with clean water, 1% NaClO (soak for 10 min), and sterile water in sequence. Place the washed seeds in a glass basin containing moistened absorbent paper and germinate at 37°C in the dark for 2 days.

[0057] 2. Preparation of bacterial fertilizer: wild type Acrocalymma vagum A21-1-1 and the mutant strains obtained in Example 2 were cultured in PDA medium for 7 days. The resulting cakes were then placed in 150 mL of PDB medium and incubated at 25°C, 150 rpm, for 3 days. The mycelial suspension was then poured into autoclaved barley grains (121°C for 30 min) (150 mL of culture medium per 200 g of barley grains) and fermented at 25°C for 20 days.

[0058] 3. Pot Planting: Allow the fermented fertilizer to dry naturally. Mix the dried fertilizer with the rice planting medium and place it in a planting pot. Plant the germinated rice seeds in the pot containing the fermented fertilizer (30 seeds and 40g of fertilizer per pot). Use sterile barley seed fertilizer as a control group.

[0059] 4. Rice Plant Phenotypic Analysis: After culturing the rice for 24 days, the chlorophyll content of the rice leaves was measured using a chlorophyll content meter SPAD-502 (Japan). The rice seedlings were pulled out of the soil matrix with their roots, repeatedly washed with clean water, and the water on the rice plants was absorbed using absorbent paper. The rice stem and leaf height, root length, and stem, leaf, and root fresh weights were measured.

[0060] 5. Result analysis:

[0061] like Figure 2 As shown, rice roots infected with the knockout mutant were sectioned and stained for observation. Observation of the cross-sections of the rice roots revealed that the knockout mutant strain produced numerous conidia that entered the epidermis but did not enter the vascular tissue of the rice roots, indicating that the knockout mutant had successfully colonized the rice roots.

[0062] like Figure 3-Figure 7 As shown, in the pot experiment, compared with the wild-type strain, the stem and leaf height of rice co-cultured with ΔAvRRM1 increased by 40.13%, the root length increased by 67.1%, the fresh weight increased by 82.3%, and the chlorophyll content increased significantly by 18.15%.

Claims

1. Application of the AvRRM1 gene in regulating the endophytic fungus Heteromorpha to promote rice growth, characterized in that: The application includes: using biological technology to downregulate the expression of the AvRRM1 gene in the Acrocalymmavagum, thereby improving the growth-promoting effect of the Acrocalymmavagum on rice; the Acrocalymmavagum is Acrocalymmavagum A21-1-1 with a preservation number of CCTCC NO: M 2021278; the nucleotide sequence of the AvRRM1 gene is shown in SEQ ID NO.1; and the rice growth indicator includes at least one of rice stem and leaf height, root length, stem and leaf and root fresh weight, and chlorophyll content.

2. The use according to claim 1, characterized in that The application includes: using a gene homologous recombination method to knock out the AvRRM1 gene in the heteromorphic anastomosis to obtain a mutant strain, and then co-culturing the mutant strain with rice to make it colonize in the rice root tissue.

3. A method for promoting rice growth, characterized in that: include: First, upstream and downstream fragments of the AvRRM1 gene were obtained by PCR amplification and then cloned into a gene knockout vector to construct a recombinant plasmid. The nucleotide sequence of the AvRRM1 gene is shown in SEQ ID NO.

1. Then, the target fragments were introduced into Acrocalymma vagum A21-1-1 with a deposition number of CCTCCNO: M 2021278 through Agrobacterium-mediated transformation technology to undergo homologous recombination. A mutant strain with the AvRRM1 gene knocked out was screened and obtained. The mutant strain was then co-cultured with rice to obtain an AvRRM1 gene knockout strain-rice symbiotic system.

4. The method according to claim 3, wherein The sequences of the primer pair required for the PCR amplification reaction of the upstream fragment of the AvRRM1 gene are shown in SEQ ID NO.3 and SEQ ID NO.4; the sequences of the primer pair required for the PCR amplification reaction of the downstream fragment of the AvRRM1 gene are shown in SEQ ID NO.5 and SEQ ID NO.

6.

5. The method according to claim 3, wherein The gene knockout vector is a PKO1B vector; the Agrobacterium is Agrobacterium AGL1.

6. The method according to claim 3, wherein Before co-cultivation, the mutant strain was inoculated into PDA medium for activation culture and cultured in the dark at 25°C for 7 days.

7. The method according to claim 3, wherein The co-cultivation comprises: inoculating the mutant strain into sterilized barley grains for cultivation to obtain solid fermentation fertilizer, mixing the fertilizer with rice planting matrix, and then transplanting germinated rice seeds into the mixed matrix for cultivation.

Images