Compositions for assessing biological age and uses thereof

Abstract

The invention provides a marker and a probe composition for evaluating the biological age and application of the marker and the probe composition. The marker is an MYOM3 gene, an SCTR gene, an LINC01122 gene, an MOGAT2 gene, a TRPM1 gene and / or an RPL23AP87 gene. According to the present invention, with the application of the marker, the methylation state of the genes can be sensitively and specifically detected, and the marker is used for constructing the age prediction model based on DNA methylation so as to detect the biological age.

Description

Technical Field

[0001] This application belongs to the field of molecular biology, involves gene detection, and specifically relates to a composition for evaluating biological age and its uses. Background Art

[0002] According to the results of the 2021 May census, the proportion of the population aged 60 and above in China exceeded 18%, indicating that China is already facing a serious aging problem. Age is a key risk factor for inducing diseases and disabilities in the elderly. In addition to comprehensively building a health service system for the elderly, promoting healthy aging is also one of the important measures of Healthy China 2030. The aging process is manifested as the decline of individual organ functions, the occurrence of chronic diseases, and even death. Due to individual differences (including environmental and genetic factors, etc.), individuals with the same chronological age show different degrees of decline in physiological functions and health status, reflecting their biological age.

[0003] Currently, some studies have focused on the fact that certain molecular changes during the aging process can reflect the degree of decline or loss of physiological functions, as well as the mechanism of the occurrence of aging-related diseases. Therefore, the assessment of an individual's biological age can be achieved through molecular detection. Intervention can be carried out according to the degree of body aging reflected by the individual's biological age to restore / maintain physiological functions, delay the aging rate, and thus is expected to prevent the occurrence and death of aging-related diseases.

[0004] Compared with the genetic regulation of DNA sequences, the epigenetic regulation process is mostly reversible. Therefore, epigenetics has broad prospects for targeted intervention and treatment of related diseases through external conditions. More and more studies have shown that DNA methylation is closely related to the body aging process. As one of the research focuses in the field of epigenetics, DNA methylation refers to the process in which the 5'-end cytosine in CpG dinucleotides on the genomic DNA sequence is converted into 5'-end methylcytosine under the catalysis of DNA methyltransferase. Currently, many studies have proved that the overall level of genomic methylation decreases with the deepening of the aging degree. However, the existing methylation age markers are numerous and mostly come from European and American populations, which is not conducive to the methylation age assessment of the Chinese population.

[0005] This application identifies and enriches genomic regions containing CpGs, calculates the methylation level of the Chinese population in the CpG-enriched intervals to improve the stability of DNA methylation, and screens methylation markers that can be used to evaluate human biological age. Therefore, the purpose of this application is to provide a novel biomolecular marker for evaluating biological age, as well as the corresponding method. Summary of the Invention

[0006] The purpose of this application is to provide a composition for evaluating biological age and its uses.

[0007] The specific technical solution of this application is as follows:

[0008] 1. A biomarker for evaluating biological age, wherein the biomarker is the MYOM3 gene, the SCTR gene, the LINC01122 gene, the MOGAT2 gene, the TRPM1 gene, and / or the RPL23AP87 gene.

[0009] 2. The biomarker according to item 1, wherein the target sequence of the MYOM3 gene comprises a sequence shown in any one of SEQ ID NO: 1-6 or a sequence shown in any one of SEQ ID NO: 1-6;

[0010] The target sequence of the SCTR gene comprises a sequence shown in any one of SEQ ID NO: 7-12 or a sequence shown in any one of SEQ ID NO: 7-12;

[0011] The target sequence of the LINC01122 gene comprises a sequence shown in any one of SEQ ID NO: 13-18 or a sequence shown in any one of SEQ ID NO: 13-18;

[0012] The target sequence of the MOGAT2 gene comprises a sequence shown in any one of SEQ ID NO: 19-24 or a sequence shown in any one of SEQ ID NO: 19-24;

[0013] The target sequence of the TRPM1 gene comprises a sequence shown in any one of SEQ ID NO: 25-30 or a sequence shown in any one of SEQ ID NO: 25-30;

[0014] The target sequence of the RPL23AP87 gene is shown in any one of SEQ ID NO: 31-36, or comprises a sequence shown in any one of SEQ ID NO: 31-36.

[0015] 3. A probe composition, wherein the probe composition comprises a probe targeting the methylation of the biomarker described in item 1 or item 2.

[0016] 4. The probe composition according to item 3, wherein the probe composition comprises a first probe composition for high methylation and a second probe composition for low methylation. The first probe composition is used to hybridize with the CG hypermethylated region after bisulfite conversion, and the second probe composition is used to hybridize with the CG hypomethylated region after bisulfite conversion.

[0017] 5. The probe composition according to item 4, wherein the first probe composition comprises n probes, and the n probes hybridize with each nucleotide of the sense strand and / or the antisense strand of the region of CG hypermethylation after bisulfite conversion. Preferably, the second probe composition comprises m probes, and the m probes hybridize with each nucleotide of the sense strand and the antisense strand of the region of CG hypomethylation after bisulfite conversion. Further preferably, both n and m are any integer from 1 to 10.

[0018] 6. The probe composition according to item 5, wherein there are x 1 nucleotides overlapping between the (n - 1)th probe and the nth probe. Preferably, x 1 is any integer from 0 to 100;

[0019] Preferably, there are x 2 nucleotides overlapping between the (m - 1)th probe and the mth probe. Preferably, x 2 is any integer from 0 to 100;

[0020] Further preferably, the first probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 37 - 48; the second probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 49 - 60.

[0021] 7. Use of a nucleic acid for detecting a biomarker in the preparation of a kit for evaluating biological age, wherein the biomarker is the MYOM3 gene, the SCTR gene, the LINC01122 gene, the MOGAT2 gene, the TRPM1 gene, and / or the RPL23AP87 gene.

[0022] 8. The use according to item 7, wherein the target sequence of the MYOM3 gene comprises the sequence shown in any one of SEQ ID NOs: 1 - 6 or the sequence shown in any one of SEQ ID NOs: 1 - 6;

[0023] The target sequence of the SCTR gene comprises the sequence shown in any one of SEQ ID NOs: 7 - 12 or the sequence shown in any one of SEQ ID NOs: 7 - 12;

[0024] The target sequence of the LINC01122 gene comprises the sequence shown in any one of SEQ ID NOs: 13 - 18 or the sequence shown in any one of SEQ ID NOs: 13 - 18;

[0025] The target sequence of the MOGAT2 gene comprises a sequence shown in any one of SEQ ID NOs: 19 - 24 or a sequence shown in any one of SEQ ID NOs: 19 - 24;

[0026] The target sequence of the TRPM1 gene comprises a sequence shown in any one of SEQ ID NOs: 25 - 30 or a sequence shown in any one of SEQ ID NOs: 25 - 30;

[0027] The target sequence of the RPL23AP87 gene is shown in any one of SEQ ID NOs: 31 - 36, or comprises a sequence shown in any one of SEQ ID NOs: 31 - 36.

[0028] 9. The use according to item 7 or 8, wherein the nucleic acid is for targeting a methylated biomarker for evaluating biological age.

[0029] 10. The use according to any one of items 7 - 9, wherein the nucleic acid is the probe composition according to any one of items 3 - 6.

[0030] 11. The use according to any one of items 7 - 9, wherein the nucleic acid comprises:

[0031] Primers, which are fragments of at least 9 nucleotides in the target sequences of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene and / or RPL23AP87 gene, and the fragments contain at least one CpG dinucleotide sequence;

[0032] Preferably, the nucleic acid further comprises:

[0033] Probes, which are fragments of at least 15 nucleotides that hybridize with the target sequences of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene and / or RPL23AP87 gene under medium stringency or stringent conditions, and the fragments contain at least one CpG dinucleotide sequence.

[0034] 12. The use according to any one of items 7 - 11, wherein the nucleic acid further comprises:

[0035] A blocker that preferentially binds to the target sequence in the unmethylated state.

[0036] 13. A composition for evaluating biological age, wherein the composition comprises a nucleic acid for detecting the methylation of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene and / or RPL23AP87 gene.

[0037] 14. The composition according to item 13, wherein the target sequence of the MYOM3 gene comprises the sequence shown in any one of SEQ ID NOs: 1-6 or the sequence shown in any one of SEQ ID NOs: 1-6;

[0038] The target sequence of the SCTR gene comprises the sequence shown in any one of SEQ ID NOs: 7-12 or the sequence shown in any one of SEQ ID NOs: 7-12;

[0039] The target sequence of the LINC01122 gene comprises the sequence shown in any one of SEQ ID NOs: 13-18 or the sequence shown in any one of SEQ ID NOs: 13-18;

[0040] The target sequence of the MOGAT2 gene comprises the sequence shown in any one of SEQ ID NOs: 19-24 or the sequence shown in any one of SEQ ID NOs: 19-24;

[0041] The target sequence of the TRPM1 gene comprises the sequence shown in any one of SEQ ID NOs: 25-30 or the sequence shown in any one of SEQ ID NOs: 25-30;

[0042] The target sequence of the RPL23AP87 gene is shown in any one of SEQ ID NOs: 31-36, or comprises the sequence shown in any one of SEQ ID NOs: 31-36.

[0043] 15. The composition according to item 13 or 14, wherein the nucleic acid comprises the probe composition described in any one of items 3-6.

[0044] 16. The composition according to item 13 or 14, wherein the nucleic acid comprises:

[0045] Primers, which are fragments of at least 9 nucleotides in the target sequence of the marker, and the fragment contains at least one CpG dinucleotide sequence.

[0046] 17. The composition according to item 16, wherein the nucleic acid further comprises:

[0047] Probes, which hybridize with at least 15 nucleotide fragments in the target sequence of the marker under medium stringency or stringent conditions, and the fragment contains at least one CpG dinucleotide sequence.

[0048] 18. The composition according to any one of items 13 - 17, further comprising a reagent for converting the 5 - position unmethylated cytosine base of the target sequence of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene, and / or RPL23AP87 gene into uracil.

[0049] 19. The composition according to any one of items 13 - 18, wherein the nucleic acid further comprises:

[0050] A blocker that preferentially binds to the target sequence in an unmethylated state.

[0051] 20. A kit comprising a reagent for detecting the biomarker described in item 1 or 2, the probe composition described in any one of items 3 - 6, or the composition described in any one of items 13 - 19.

[0052] 21. A chip comprising a reagent for detecting the biomarker described in item 1 or 2, the probe composition described in any one of items 3 - 6, or the composition described in any one of items 13 - 19.

[0053] The present application has the following beneficial effects:

[0054] The present application has screened out biomarkers MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene, and / or RPL23AP87 gene that can sensitively and specifically detect age - related biomarkers, and determined the target sequences with abnormal methylation of related biomarkers, and can sensitively and specifically detect the methylation status of this gene. The biomarker can be used to construct an age prediction model based on DNA methylation, and thus can be used for the detection of biological age, and has excellent accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 It is a schematic diagram of the feature screening process for nested cross - validation. Among them, there are 5 groups in the outer loop, and the training set for each group of the outer loop is further split into 5 groups. Taking the first group of the outer loop as an example, its training set is split into 5 groups (i.e., the inner loop). For each group (a total of 5 groups) of the training set in this inner loop, age is used as the response variable, methylation as the independent variable, and gender as the covariate. A multiple linear regression model is made for each enrichment interval, and the p - value corresponding to the age coefficient is corrected using the False Discovery Rate (FDR) method to obtain the corrected q - value. We select the top 1000 enrichment intervals with the smallest q - value. Finally, the top 1000 enrichment intervals of the 5 subgroups in the inner loop are combined as candidate interval biomarkers.

[0056] Figure 2Schematic diagram for independently verifying the consistency between the methylation age and the true age of the sample. Among them, the abscissa is the methylation age predicted by 6 methylation markers, and the ordinate is the calendar age of the sample. Detailed implementation mode

[0057] The following provides a detailed description of the present application. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0058] Unless otherwise specified, the implementation of the present application will adopt conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry, and genetics techniques, all of which are within the scope of conventional technical means in the art. Such techniques are described in detail in the literature, such as Molecular Cloning: A Laboratory Manual, Second Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (M.J. Gait, 1984 Edition); Animal Cell Culture (R.I. Freshney, 1987 Edition); Methods in Enzymology series (Academic Press, Inc., USA); Current Protocols in Molecular Biology (F.M. Ausubel et al., 1987 Edition, updated regularly); PCR: The Polymerase Chain Reaction (Mullis et al., 1994 Edition). The primers, probes, blockers, and kits used in the present application can be prepared using standard techniques well-known in the art.

[0059] Unless otherwise defined, the technical and scientific terms used in the present application have the same meaning as commonly understood by those of ordinary skill in the art to which the present application belongs.

[0060] It should be noted that in the specification and claims, certain terms are used to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. The specification and claims do not distinguish components by the difference in nouns, but by the difference in the functions of the components. For example, the terms "comprising" or "including" mentioned throughout the specification and claims are open-ended terms, and should therefore be interpreted as "including but not limited to". The following description in the specification is the preferred embodiment for implementing the present application, however, the description is for the purpose of the general principles of the specification and is not intended to limit the scope of the present application. The protection scope of the present application shall be subject to what is defined by the appended claims.

[0061] Definition

[0062] The "stringent hybridization conditions" and "stringent" in the present application refer to the conditions under which a probe hybridizes to its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and vary in different circumstances. Longer sequences hybridize specifically at higher temperatures. Detailed guidance on nucleic acid hybridization can be found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays". Generally, stringent conditions are about 5-10 °C below the melting temperature (Tm) of a particular nucleic acid at a defined ionic strength and pH. At the temperature of Tm (at the defined ionic strength, pH and nucleic acid concentration), 50% of the probes complementary to the target hybridize to the target sequence evenly. Stringent conditions can also be achieved by increasing the destabilizer. For selective or specific hybridization, the positive signal is twice the background hybridization, preferably 10 times. Exemplary stringent hybridization conditions are as follows: Hybridize at 42 °C in a solution of 50% formamide, 5x SSC and 1% SDS, or hybridize at 65 °C in a solution of 5x SSC and 1% SDS, and then wash at 65 °C in a solution of 0.2x SSC and 0.1% SDS.

[0063] Also, if the polypeptides encoded by the nucleic acids are substantially similar, nucleic acids that do not hybridize under stringent conditions are still substantially similar. In such cases, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. By way of example, "moderately stringent hybridization conditions" include hybridization at 37°C in a solution of 40% formamide, 1 M sodium chloride, and 1% SDS, and washing in a solution of 1x SSC at 45°C. One of ordinary skill in the art can readily obtain guidance in the prior art for obtaining conditions that achieve the same stringency. For PCR, a temperature of about 36°C is typically suitable for low-stringency amplification, and the annealing temperature ranges from 32°C to 48°C based on the length of the primers. For highly stringent PCR amplification, it is generally at 62°C, and the annealing temperature for highly stringent hybridization ranges from 50°C to 65°C based on the length and specificity of the primers. For the cycling conditions for highly stringent and low-stringency amplification, typically, they include: a denaturation stage at 90-95°C for 30 seconds to 2 minutes, an annealing stage for 30 seconds to 2 minutes, and an extension stage at about 72°C for 1 to 2 minutes. Tools and guidance for low- and high-stringency amplification reactions are available in the prior art.

[0064] "Oligonucleotide" as used in this application refers to a molecule composed of two or more nucleotides, preferably a molecule composed of more than three nucleotides, and its exact size can depend on many factors, which in turn are determined by the ultimate function and use of the oligonucleotide. In certain specific embodiments, the oligonucleotide can include a length of 10 nucleotides to 100 nucleotides. In certain specific embodiments, the oligonucleotide can include a length of 10 nucleotides to 30 nucleotides, or can have a length of 20 and 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.

[0065] "Primer" as used in this application means an oligonucleotide that can serve as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand, i.e., in the presence of nucleotides and an inducer such as DNA or RNA polymerase and at an appropriate temperature and pH, whether it is naturally occurring in a purified restriction digest or synthetically produced. The primer can be single-stranded or double-stranded and must be long enough to initiate the synthesis of the desired extension product in the presence of the inducer. The exact length of the primer depends on various factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, oligonucleotide primers typically contain at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides depending on the complexity of the target sequence, but it can contain fewer or more nucleotides. The factors involved in determining the appropriate length of the primer are well known to those skilled in the art.

[0066] The "primer pair" of the present application refers to a primer pair that hybridizes to the opposite strand of a target DNA molecule or to a target DNA region flanking a nucleotide sequence to be amplified.

[0067] The "primer site" of the present application refers to the region of a target DNA or other nucleic acid to which a primer hybridizes.

[0068] The "probe" of the present application, when referring to a nucleic acid sequence, is used in its ordinary meaning and refers to a selected nucleic acid sequence that can hybridize to a target sequence under defined conditions and can be used to detect the presence of the target sequence. The probe is a single-stranded or double-stranded DNA with a length ranging from dozens to hundreds or even thousands of base pairs. Utilizing the denaturation, renaturation of molecules and the high precision of base complementary pairing, it can bind (hybridize) to the complementary unlabeled single-stranded DNA or RNA in a test sample through hydrogen bonds to form a double-stranded complex (hybrid). After washing away the unpaired probes, the results of the hybridization reaction can be detected using detection systems such as autoradiography or enzyme-linked reactions. In the present application, the region that binds or hybridizes complementarily to the probe is the specific target region. Multiple probes are combined into a probe composition. Those skilled in the art should understand that in some cases, a probe can also be used as a primer, and a primer can be used as a probe.

[0069] In the present application, the methylation refers to the methylation process occurring at the 5th carbon atom of cytosine in CpG dinucleotides. As a relatively stable modification state, under the action of DNA methyltransferase, it can be inherited to the newly generated daughter DNA during DNA replication, and it is an important epigenetic mechanism. The methylation described in the present application can be methylation level, methylation degree or methylation state. When analyzing the methylation of such a target sequence, those skilled in the art can use quantitative determination methods to determine the methylation.

[0070] In an embodiment, a variety of different methods can be used to detect DNA methylation changes. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using southern or polymerase chain reaction (PCR) analysis, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high-resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation-specific single-strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO). These assays can be PCR analysis, quantitative analysis using fluorescent labels or southern blot analysis.

[0071] "Methylation assay" in this application refers to any assay for determining the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.

[0072] "Detection" in this application refers to any process of observing a marker or a change in a marker (such as a change in the methylation status of a marker or the expression level of a nucleic acid or protein sequence) in a sample, regardless of whether the marker or the change in the marker is actually detected. In other words, the act of detecting a marker or a change in a marker in a sample is "detection", even if the marker is determined to be absent or below the sensitivity level. Detection can be a quantitative, semi - quantitative or non - quantitative observation, and can be based on a comparison with one or more control samples.

[0073] "Homology", "identity", and "similarity" as used in this application refer to sequence similarity between two nucleic acid molecules. The "homology", "identity", or "similarity" can be determined by comparing positions in each sequence, and the sequences can be aligned for the purpose of comparison. When the equivalent positions in the sequences being compared are occupied by the same base, the molecules are identical at that position; when the equivalent sites are occupied by the same or similar amino acid (e.g., similar in spatial or charged properties) residues, the molecules can be said to be homologous (similar) at that position. The expression of the percentage of homology / similarity or identity refers to a function of the number of identical or similar amino acids at positions shared by the sequences being compared. "Unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity, with the sequences of this application. When comparing two sequences, the presence of deletions or additional residues (amino acids or nucleic acids) also reduces identity and homology / similarity. In a specific embodiment, for two or more sequences or subsequences, determination is made using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below or by, for example, manual alignment and visual inspection provided online by the National Center for Biotechnology Information (NCBI). When comparing and aligning for maximum correspondence over a comparison window or specified region, if their sequences have an identity of about 60%, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher over the defined region, they can be considered to be substantially or significantly homologous, similar, or identical. This definition also pertains to or can be used to test the complement of a sequence. Thus, to the extent permitted by the context herein, for example, if a nucleotide sequence can be predicted to occur naturally in a DNA duplex or can occur naturally in the form of one or both of the complementary strands, a nucleotide sequence complementary to a specified target sequence or its variant is itself considered to be "similar" to the target sequence, and when referring to "similar" nucleic acid sequences, includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Circumstances where similarity must be restricted to the analysis of a single nucleic acid strand sequence can include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In an embodiment, the identity or similarity can be over a region of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides, or over a region of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more than about 100 nucleotides.

[0074] "Amplification" in the present application refers to the process of obtaining multiple copies from a specific locus of a nucleic acid, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known means, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).

[0075] The blocker is for improving the amplification specificity of PCR amplification primers. There is an overlapping region of greater than or equal to 5 nucleotides between the 5' end of the blocker nucleotide sequence and the 3' end nucleotide sequence of the forward or reverse primer. The blocker is complementary to the forward or reverse primer and to the same strand of the target gene target sequence DNA. The melting temperature of the blocker is higher than that of the forward or reverse primer by more than (including) 5°C. The nucleotide sequence of the blocker contains at least one CpG dinucleotide sequence and is complementary to the sequence of the non-methylated target gene target sequence DNA after bisulfite conversion. Therefore, when the genomic DNA of the biological sample to be detected is a mixture of methylated and non-methylated states, especially when the DNA in the methylated state is far less than the DNA in the non-methylated state, after bisulfite conversion, the non-methylated DNA will preferentially bind to the blocker, thus inhibiting the binding of the DNA template to the PCR primer, and thus no PCR amplification occurs. The methylated DNA does not bind to the blocker, thus binds to the primer and undergoes PCR amplification, and then the fragments obtained by amplification are detected directly or indirectly.

[0076] A "label" or "detectable moiety" in the present application is a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxin, or haptens, and proteins that can be made detectable, e.g., by incorporating a radioactive label into a peptide or an antibody that specifically reacts with the peptide.

[0077] Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blotting, Northern blotting, or in situ hybridization). Specifically, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying a target nucleic acid can be used in a PCR reaction. The PCR method generally includes the steps of obtaining a sample, isolating nucleic acid (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acid with one or more oligonucleotide primers that specifically hybridize to the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is generated. Conditions for nucleic acid amplification and amplification product detection are known to those of skill in the art. A variety of improvements to the basic PCR technique have been developed, including but not limited to, anchored PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). The primer pairs in the amplification reaction must anneal to opposite strands of the template nucleic acid and should be positioned at an appropriate distance from each other such that the polymerase can efficiently polymerize across the region and such that the amplification products can be easily detected, for example, using electrophoresis. For example, a computer program such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to assist in designing primers with similar melting temperatures. Generally, oligonucleotide primers are 9-30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length), but oligonucleotide primers can be longer or shorter so long as appropriate amplification conditions are used.

[0078] Detection of amplified products or hybridization complexes is typically achieved using detectable labels. The term "label", when referring to nucleic acids, is intended to include direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, as well as indirect labeling of nucleic acids by reaction with another reagent that has been directly labeled with a detectable substance. Detectable substances include a variety of enzymes, cofactors, fluorescent materials, chemiluminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable cofactor complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; examples of chemiluminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin. Examples of indirect labeling include end-labeling a nucleic acid with biotin such that the nucleic acid can be detected with a fluorescently labeled streptavidin.

[0079] This application provides a biomarker for evaluating biological age, wherein the biomarker is the MYOM3 gene, the SCTR gene, the LINC01122 gene, the MOGAT2 gene, the TRPM1 gene, and / or the RPL23AP87 gene.

[0080] In some embodiments, the target sequence of the MYOM3 gene comprises a sequence shown in any one of SEQ ID NOs: 1-6 or a sequence complementary to a sequence shown in any one of SEQ ID NOs: 1-6;

[0081] In some embodiments, the target sequence of the SCTR gene comprises a sequence shown in any one of SEQ ID NOs: 7-12 or a sequence complementary to a sequence shown in any one of SEQ ID NOs: 7-12;

[0082] In some embodiments, the target sequence of the LINC01122 gene comprises a sequence shown in any one of SEQ ID NOs: 13-18 or a sequence complementary to a sequence shown in any one of SEQ ID NOs: 13-18;

[0083] In some embodiments, the target sequence of the MOGAT2 gene comprises a sequence shown in any one of SEQ ID NOs: 19-24 or a sequence complementary to a sequence shown in any one of SEQ ID NOs: 19-24;

[0084] In some embodiments, the target sequence of the TRPM1 gene comprises the sequence shown in any one of SEQ ID NOs: 25 - 30 or the sequence shown in any one of SEQ ID NOs: 25 - 30;

[0085] In some embodiments, the target sequence of the RPL23AP87 gene is shown in any one of SEQ ID NOs: 31 - 36, or comprises the sequence shown in any one of SEQ ID NOs: 31 - 36.

[0086] In the present application, the MYOM3 gene is one of the three members of the Myomesin gene family found in vertebrates, which is predicted to enable actin filament binding activity and protein homodimerization activity. It is expected to be involved in muscle contraction. And studies have shown that the Myomesin gene family is associated with various muscle diseases such as DCM, HCM, and muscular dystrophy.

[0087] The SCTR gene, also known as the secretin receptor gene, encodes a protein that is a G protein - coupled receptor and belongs to the glucagon - VIP - secretin receptor family. It binds secretin, which is the most potent regulator of pancreatic bicarbonate, electrolyte, and volume secretion. The pathways involved include GPCR downstream signaling and the presynaptic function of kainate receptors.

[0088] The LINC01122 gene belongs to the lncRNA class of genes. Abnormal expression of LINC01122 was found to increase the risk of gastric cancer in the study.

[0089] The MOGAT2 gene can encode an enzyme that catalyzes the synthesis of diacylglycerol from 2 - monoacylglycerol and fatty acyl - CoA. The encoded protein forms a complex with diacylglycerol O - acyltransferase 2 in the endoplasmic reticulum, and then catalyzes the synthesis of triacylglycerol, participating in lipid metabolism. This enzyme is very important for the small intestine to uptake dietary fat.

[0090] The TRPM1 gene encodes member 1 of the melatonin subfamily M of the transient receptor potential ion channels. The melatonin protein is a calcium - permeable cation channel expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene can lead to autosomal - recessive complete congenital stationary night blindness - 1c. The expression of this protein is negatively correlated with melanoma invasiveness, so it is used as a prognostic marker for melanoma metastasis.

[0091] The RPL23AP87 gene is a pseudogene, and its function remains to be studied. Pseudogenes, also known as false genes, are non-functional remnants formed during the evolution of gene families. It is similar to normal genes but has lost the normal function of DNA sequences. Pseudogenes can be regarded as non-functional genomic DNA copies that are very similar to coding gene sequences in the genome. Generally, they are not transcribed and have no clear physiological significance.

[0092] SEQ ID NO:1 is the nucleotide sequence of the MYOM3 gene:

[0093] ACGAGGCGCGGTCAGGACAGAGGAAGCG

[0094] SEQ ID NO:2 is the complementary sequence of the nucleotide sequence of the MYOM3 gene:

[0095] CGCTTCCTCTGTCCTGACCGCGCCTCGT

[0096] SEQ ID NO:3 is the sequence of an extreme case of the hypermethylated state of the MYOM3 gene:

[0097] ACGAGGCGCGGTTAGGATAGAGGAAGCG

[0098] SEQ ID NO:4 is the sequence of the hypermethylated state of the complementary strand of the MYOM3 gene:

[0099] CGTTTTTTTTGTTTTGATCGCGTTTCGT

[0100] SEQ ID NO:5 is the sequence of an extreme case of the hypomethylated state of the MYOM3 gene:

[0101] ATGAGGTGTGGTTAGGATAGAGGAAGTG

[0102] SEQ ID NO:6 is the sequence of the hypomethylated state of the complementary strand of the MYOM3 gene:

[0103] TGTTTTTTTTGTTTTGATTGTGTTTTGT

[0104] SEQ ID NO:7 is the nucleotide sequence of the SCTR gene:

[0105] TCGCGACGCTCGGCGCTCGCGTCTCCGCGGCTTCTCCGGCCG

[0106] SEQ ID NO:8 is the complementary sequence of the nucleotide sequence of the SCTR gene:

[0107] CGGCCGGAGAAGCCGCGGAGACGCGAGCGCCGAGCGTCGCGA

[0108] SEQ ID NO:9 is the sequence of an extreme case of the hypermethylated state of the SCTR gene:

[0109] TCGCGACGTTCGGCGTTCGCGTTTTCGCGGTTTTTTCGGTCG

[0110] SEQ ID NO:10 is the sequence of the hypermethylated state of the complementary strand of the SCTR gene:

[0111] CGGTCGGAGAAGTCGCGGAGACGCGAGCGTCGAGCGTCGCGA

[0112] SEQ ID NO:11 is the sequence of an extreme case of the hypomethylated state of the SCTR gene:

[0113] TTGTGATGTTTGGTGTTTGTGTTTTTGTGGTTTTTTTGGTTG

[0114] SEQ ID NO:12 is the sequence of the hypomethylated state of the complementary strand of the SCTR gene:

[0115] TGGTTGGAGAAGTTGTGGAGATGTGAGTGTTGAGTGTTGTGA

[0116] SEQ ID NO:13 is the nucleotide sequence of the LINC01122 gene:

[0117] ACGGCTTGATATTTCCGAAGAATATAGTGGGCTTTATTAGCACCAGTTTCGCTCCCTGACTGACGGCTTTTTCAAATTTTTTATCTTATTAATCCG

[0118] SEQ ID NO:14 is the complementary sequence of the nucleotide sequence of the LINC01122 gene:

[0119] CGGATTAATAAGATAAAAAATTTGAAAAAGCCGTCAGTCAGGGAGCGAAACTGGTGCTAA TAAAGCCCACTATATTCTTCGGAAATATCAAGCCGT

[0120] SEQ ID NO:15 is the sequence of an extreme case of the hypermethylated state of the LINC01122 gene:

[0121] ACGGTTTGATATTTTCGAAGAATATAGTGGGTTTTATTAGTATTAGTTTCGTTTTTTGATTGACGGTTTTTTTAAATTTTTTATTTTATTAATTCG

[0122] SEQ ID NO:16 is the sequence of the hypermethylated state of the complementary strand of the LINC01122 gene:

[0123] CGGATTAATAAGATAAAAAATTTGAAAAAGTCGTTAGTTAGGGAGCGAAATTGGTGTTAATAAAGTTTATTATATTTTTCGGAAATATTAAGTCGT

[0124] SEQ ID NO:17 is the sequence of an extreme case of the hypomethylated state of the LINC01122 gene:

[0125] ATGGTTTGATATTTTTGAAGAATATAGTGGGTTTTATTAGTATTAGTTTTGTTTTTTGATTGATGGTTTTTTTAAATTTTTTATTTTATTAATTTG

[0126] SEQ ID NO:18 is the sequence of the hypomethylated state of the complementary strand of the LINC01122 gene:

[0127] TGGATTAATAAGATAAAAAATTTGAAAAAGTTGTTAGTTAGGGAGTGAAATTGGTGTTAATAAAGTTTATTATATTTTTTGGAAATATTAAGTTGT

[0128] SEQ ID NO:19 is the nucleotide sequence of the MOGAT2 gene:

[0129] GCGGGCGCCAGTAGCGGCAGGCGCACGTGCTCCAGCAGGCGTCGCAGCTGGCCGCGGCGGGCCGGCGCGTCGTGGCGCACCCAGCGCATGGCCGCTTCAAACACGGCCTCCTCGCGCGCCACGCCCAGCGCGGGGTCCGCCAGCAGCGCCACCACCTCG

[0130] SEQ ID NO:20 is the complementary sequence of the nucleotide sequence of the MOGAT2 gene:

[0131] CGAGGTGGTGGCGCTGCTGGCGGACCCCGCGCTGGGCGTGGCGCGCGAGGAGGCCGTGTTTGAAGCGGCCATGCGCTGGGTGCGCCACGACGCGCCGGCCCGCCGCGGCCAGCTGCGACGCCTGCTGGAGCACGTGCGCCTGCCGCTACTGGCGCCCGC

[0132] SEQ ID NO:21 is the sequence of an extreme case of the hypermethylated state of the MOGAT2 gene:

[0133] GCGGGCGTTAGTAGCGGTAGGCGTACGTGTTTTAGTAGGCGTCGTAGTTGGTCGCGGCGGGTCGGCGCGTCGTGGCGTATTTAGCGTATGGTCGTTTTAAATACGGTTTTTTCGCGCGTTACGTTTAGCGCGGGGTTCGTTAGTAGCGTTATTATTTCG

[0134] SEQ ID NO:22 is the sequence of the hypermethylated state of the complementary strand of the MOGAT2 gene:

[0135] CGAGGTGGTGGCGTTGTTGGCGGATTTCGCGTTGGGCGTGGCGCGCGAGGAGGTCGTGTTTGAAGCGGTTATGCGTTGGGTGCGTTACGACGCGTCGGTTCGTCGCGGTTAGTTGCGACGTTTGTTGGAGTACGTGCGTTTGTCGTTATTGGCGTTCGT

[0136] SEQ ID NO:23 is the sequence of an extreme case of the hypomethylated state of the MOGAT2 gene:

[0137] GTGGGTGTTAGTAGTGGTAGGTGTATGTGTTTTAGTAGGTGTTGTAGTTGGTTGTGGTGGGTTGGTGTGTTGTGGTGTATTTAGTGTATGGTTGTTTTAAATATGGTTTTTTTGTGTGTTATGTTTAGTGTGGGGTTTGTTAGTAGTGTTATTATTTTG

[0138] SEQ ID NO:24 is the sequence of the hypomethylated state of the complementary strand of the MOGAT2 gene:

[0139] TGAGGTGGTGGTGTTGTTGGTGGATTTTGTGTTGGGTGTGGTGTGTGAGGAGGTTGTGTTTGAAGTGGTTATGTGTTGGGTGTGTTATGATGTGTTGGTTTGTTGTGGTTAGTTGTGATGTTTGTTGGAGTATGTGTGTTTGTTGTTATTGGTGTTTGT

[0140] SEQ ID NO:25 is the nucleotide sequence of the TRPM1 gene:

[0141] TCGGTCTCGGCGCGCCCGTAGAACGCACAGTTCTCGCGCTGGCAGCGCCGCTGCACCGGCCCCGGGCCGCCACGGCCGCACTCACCGTTCGAGCGCGCGGTCGGCGCGTCGGCGTCG

[0142] SEQ ID NO:26 is the complementary sequence of the nucleotide sequence of the TRPM1 gene:

[0143] CGACGCCGACGCGCCGACCGCGCGCTCGAACGGTGAGTGCGGCCGTGGCGGCCCGGGGCCGGTGCAGCGGCGCTGCCAGCGCGAGAACTGTGCGTTCTACGGGCGCGCCGAGACCGA

[0144] SEQ ID NO:27 is the sequence of an extreme case of the hypermethylated state of the TRPM1 gene:

[0145] TCGGTTTCGGCGCGTTCGTAGAACGTATAGTTTTCGCGTTGGTAGCGTCGTTGTATCGGTTTCGGGTCGTTACGGTCGTATTTATCGTTCGAGCGCGCGGTCGGCGCGTCGGCGTCG

[0146] SEQ ID NO:28 is the sequence of the hypermethylated state of the complementary strand of the TRPM1 gene:

[0147] CGACGTCGACGCGTCGATCGCGCGTTCGAACGGTGAGTGCGGTCGTGGCGGTTCGGGGTCGGTGTAGCGGCGTTGTTAGCGCGAGAATTGTGCGTTTTACGGGCGCGTCGAGATCGA

[0148] SEQ ID NO:29 is the sequence of an extreme case of the hypomethylated state of the TRPM1 gene:

[0149] TTGGTTTTGGTGTGTTTGTAGAATGTATAGTTTTTGTGTTGGTAGTGTTGTTGTATTGGTTTTGGGTTGTTATGGTTGTATTTATTGTTTGAGTGTGTGGTTGGTGTGTTGGTGTTG

[0150] SEQ ID NO:30 is the sequence of the hypomethylated state of the complementary strand of the TRPM1 gene:

[0151] TGATGTTGATGTGTTGATTGTGTGTTTGAATGGTGAGTGTGGTTGTGGTGGTTTGGGGTTGGTGTAGTGGTGTTGTTAGTGTGAGAATTGTGTGTTTTATGGGTGTGTTGAGATTGA

[0152] SEQ ID NO:31 is the nucleotide sequence of the RPL23AP87 gene:

[0153] CCGGGACCCCCAACACTGCTGCCCCAGGCCTTGGAAGGAAGACCACGCCAGAGAGTGGCGGATGCCAGGTCTGCCTCGACAATCCATGGGGCTTCCCCGTACATCGGCAGTGGCCTCGGAAGGCAGGCCCAGCACTGGGGCGGTTGTGGAGGGTGCCTAGGACACAGCCAGCTTTGCCCCATGACGTGGGCGCCACGCCAGGGCTACGGGCCCCCCACTCCCCG

[0154] SEQ ID NO:32 is the complementary sequence of the nucleotide sequence of the RPL23AP87 gene:

[0155] CGGGGAGTGGGGGGCCCGTAGCCCTGGCGTGGCGCCCACGTCATGGGGCAAAGCTGGCTGTGTCCTAGGCACCCTCCACAACCGCCCCAGTGCTGGGCCTGCCTTCCGAGGCCACTGCCGATGTACGGGGAAGCCCCATGGATTGTCGAGGCAGACCTGGCATCCGCCACTCTCTGGCGTGGTCTTCCTTCCAAGGCCTGGGGCAGCAGTGTTGGGGGTCCCGG

[0156] SEQ ID NO:33 is the sequence of an extreme case of the hypermethylated state of the RPL23AP87 gene:

[0157] TCGGGATTTTTAATATTGTTGTTTTAGGTTTTGGAAGGAAGATTACGTTAGAGAGTGGCGGATGTTAGGTTTGTTTCGATAATTTATGGGGTTTTTTCGTATATCGGTAGTGGTTTCGGAAGGTAGGTTTAGTATTGGGGCGGTTGTGGAGGGTGTTTAGGATATAGTTAGTTTTGTTTTATGACGTGGGCGTTACGTTAGGGTTACGGGTTTTTTATTTTTCG

[0158] SEQ ID NO:34 is the sequence of the hypermethylated state of the complementary strand of the RPL23AP87 gene:

[0159] CGGGGAGTGGGGGGTTCGTAGTTTTGGCGTGGCGTTTACGTTATGGGGTAAAGTTGGTTGTGTTTTAGGTATTTTTTATAATCGTTTTAGTGTTGGGTTTGTTTTTCGAGGTTATTGTCGATGTACGGGGAAGTTTTATGGATTGTCGAGGTAGATTTGGTATTCGTTATTTTTTGGCGTGGTTTTTTTTTTAAGGTTTGGGGTAGTAGTGTTGGGGGTTTCGG

[0160] SEQ ID NO:35 is the sequence of an extreme case of the hypomethylated state of the RPL23AP87 gene:

[0161] TTGGGATTTTTAATATTGTTGTTTTAGGTTTTGGAAGGAAGATTATGTTAGAGAGTGGTGGATGTTAGGTTTGTTTTGATAATTTATGGGGTTTTTTTGTATATTGGTAGTGGTTTTGGAAGGTAGGTTTAGTATTGGGGTGGTTGTGGAGGGTGTTTAGGATATAGTTAGTTTTGTTTTATGATGTGGGTGTTATGTTAGGGTTATGGGTTTTTTATTTTTTG

[0162] SEQ ID NO:36 is the sequence of the hypomethylated state of the complementary strand of the RPL23AP87 gene:

[0163] TGGGGAGTGGGGGGTTTGTAGTTTTGGTGTGGTGTTTATGTTATGGGGTAAAGTTGGTTGTGTTTTAGGTATTTTTTATAATTGTTTTAGTGTTGGGTTTGTTTTTTGAGGTTATTGTTGATGTATGGGGAAGTTTTATGGATTGTTGAGGTAGATTTGGTATTTGTTATTTTTTGGTGTGGTTTTTTTTTTAAGGTTTGGGGTAGTAGTGTTGGGGGTTTTGG

[0164] In this application, for the above sequences, SEQ ID NO:1-2, 7-8, 13-14, 19-20, 25-26 and 31-32 all refer to the sequences without bisulfite conversion.

[0165] This application provides a probe composition, wherein the probe composition comprises probes targeting the methylation of the above-mentioned markers.

[0166] In some embodiments, the probe composition comprises a first probe composition for hypermethylation and a second probe composition for hypomethylation. The first probe composition is used to hybridize with the CG hypermethylated region after bisulfite conversion, and the second probe composition is used to hybridize with the CG hypomethylated region after bisulfite conversion.

[0167] The CG hypermethylated region refers to the region where the target sequence has a high degree of methylation. Due to the different methylation states of each person, the extreme CG hypermethylated region refers to the region where all CGs of the target sequence are methylated.

[0168] The region of CG hypomethylation refers to the region where less methylation occurs in the target sequence. In the present application, the extreme region of CG hypomethylation refers to the region where all CGs in the target sequence are not methylated.

[0169] The region of bisulfite-converted CG hypermethylation refers to the situation where, after the target sequence is converted by bisulfite, the base C is converted to the base T. However, for the base CG, due to the resistance of 5-methylcytosine residue (5mC), the C in CG will not be converted, so the base C remains unchanged.

[0170] The region of bisulfite-converted CG hypomethylation refers to the situation where, after bisulfite conversion, since all or most of the base CGs on the target sequence are not methylated, all or most of the base Cs are converted to the base T.

[0171] Due to the different methylation states of each person, the sequences obtained by bisulfite conversion are also different. Here, an extreme case of this biomarker is shown, that is, all CGs in this region are in the hypermethylated state, and the hypermethylated state sequence of its complementary strand is shown:

[0172] The sequence of an extreme case of the hypermethylated state of SEQ ID NO:1 is shown as SEQ ID NO:3.

[0173] The sequence of the hypermethylated state of the complementary strand of SEQ ID NO:1 is shown as SEQ ID NO:4.

[0174] Similarly, due to the different methylation states of each person, an extreme case is shown here, that is, all CGs are in the hypomethylated state, and the hypomethylated state sequence of its complementary strand is also shown.

[0175] The sequence of an extreme case of the hypomethylated state of SEQ ID NO:1 is shown as SEQ ID NO:5.

[0176] The sequence of the hypomethylated state of the complementary strand of SEQ ID NO:1 is shown as SEQ ID NO:6.

[0177] The sequence of an extreme case of the hypermethylated state of SEQ ID NO:7 is shown as SEQ ID NO:9.

[0178] The sequence of the hypermethylated state of the complementary strand of SEQ ID NO:7 is shown as SEQ ID NO:10.

[0179] The sequence of an extreme case of the hypomethylated state of SEQ ID NO:7 is shown as SEQ ID NO:11.

[0180] The sequence of the hypomethylated state of the complementary strand of SEQ ID NO:7 is shown in SEQ ID NO:12.

[0181] The sequence of an extreme case of the hypermethylated state of SEQ ID NO:13 is shown in SEQ ID NO:15.

[0182] The sequence of the hypermethylated state of the complementary strand of SEQ ID NO:13 is shown in SEQ ID NO:16.

[0183] The sequence of an extreme case of the hypomethylated state of SEQ ID NO:13 is shown in SEQ ID NO:17.

[0184] The sequence of the hypomethylated state of the complementary strand of SEQ ID NO:13 is shown in SEQ ID NO:18.

[0185] The sequence of an extreme case of the hypermethylated state of SEQ ID NO:19 is shown in SEQ ID NO:21.

[0186] The sequence of the hypermethylated state of the complementary strand of SEQ ID NO:19 is shown in SEQ ID NO:22.

[0187] The sequence of an extreme case of the hypomethylated state of SEQ ID NO:19 is shown in SEQ ID NO:23.

[0188] The sequence of the hypomethylated state of the complementary strand of SEQ ID NO:19 is shown in SEQ ID NO:24.

[0189] The sequence of an extreme case of the hypermethylated state of SEQ ID NO:25 is shown in SEQ ID NO:27.

[0190] The sequence of the hypermethylated state of the complementary strand of SEQ ID NO:25 is shown in SEQ ID NO:28.

[0191] The sequence of an extreme case of the hypomethylated state of SEQ ID NO:25 is shown in SEQ ID NO:29.

[0192] The sequence of the hypomethylated state of the complementary strand of SEQ ID NO:25 is shown in SEQ ID NO:30.

[0193] The sequence of an extreme case of the hypermethylated state of SEQ ID NO:31 is shown in SEQ ID NO:33.

[0194] The sequence of the hypermethylated state of the complementary strand of SEQ ID NO:31 is as shown in SEQ ID NO:34.

[0195] The sequence of an extreme case of the hypomethylated state of SEQ ID NO:31 is as shown in SEQ ID NO:35.

[0196] The sequence of the hypomethylated state of the complementary strand of SEQ ID NO:31 is as shown in SEQ ID NO:36.

[0197] In some embodiments, the first probe composition comprises n probes, and the n probes hybridize to each nucleotide of the sense strand and the antisense strand of the region of CG hypermethylation after bisulfite conversion. The second probe composition comprises m probes, and the m probes hybridize to each nucleotide of the sense strand and / or the antisense strand of the region of CG hypomethylation after bisulfite conversion.

[0198] Regarding the number of probes in the first probe composition and the second probe composition, the present application does not impose any restrictions, and those skilled in the art can select according to needs. For example, m and n can be any integer from 1 to 10, and m and n can be the same or different.

[0199] For example, m and n can be any integer of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. Preferably, m = n = 2.

[0200] In one embodiment, there are x 1 nucleotides overlapping between the (n - 1)th probe and the nth probe. Preferably, x 1 is any integer from 0 to 100;

[0201] Preferably, there are x 2 nucleotides overlapping between the (m - 1)th probe and the mth probe. Preferably, x 2 is any integer from 0 to 100.

[0202] Wherein, x 1 and x 2 can be the same or different. When x 1 is 0, it indicates that the tail of the (n - 1)th probe is connected to the head of the nth probe. Similarly, when x 2 is 0, it indicates that the tail of the (m - 1)th probe is connected to the head of the mth probe.

[0203] In this application, a probe composition is hybridized with a bisulfite-converted target sequence. Among them, the first probe composition with high methylation hybridizes with the CG hypermethylated region, and the second probe composition with low methylation hybridizes with the CG hypomethylated region, so that the methylation level of the target sequence can be detected efficiently and accurately, and then it can be used to evaluate biological age.

[0204] In one embodiment, the first probe composition with high methylation includes one or two of the nucleotide sequences shown in SEQ ID NO: 37-48.

[0205] The nucleotide sequence shown in SEQ ID NO:37 is:

[0206] ACGACCTAATACTAATATCTAAATCTAAACCAAAAAACAATAAAAACGCTTCCTCTATCCTAACCGCGCCTCGTCCAAACTACTCCCAAAATAATTTTACTATCTCCTTCCTACCTAACA

[0207] The nucleotide sequence shown in SEQ ID NO:38 is:

[0208] TACCAAACAAAAAAAAAACAACAAAACTATTCTAAAAACAACCTAAACGAAACGCGATCAAAACAAAAAAAACGTCCTCACTACTCCTTAACCTAAATTCAAACAC CAACATTAAACCGT

[0209] The nucleotide sequence shown in SEQ ID NO:39 is:

[0210] ATCCACGCGAAACCGACTTAAACGAAACCCGAAAAACGACGACCGAAAAAACCGCGAAAACGCGAACGCCGAACGTCGCGAAAAAACAAACCCGAACAAACAAACGACGACCTCCGCCAT

[0211] The nucleotide sequence shown in SEQ ID NO:40 is:

[0212] ATAACGAAAACCGCCGCTTACCTACCCGAACCTACTCCCTCGCGACGCTCGACGCTCGCGTCTCCGCGACTTCTCCGACCGCCGCCTCCCGAACCCCGCCCAAACCGACTCCGCGTAAAC

[0213] The nucleotide sequence shown in SEQ ID NO:41 is as follows:

[0214] CATACAATAACACGAATTAATAAAATAAAAAATTTAAAAAAACCGTCAATCAAAAAACGAAACTAATACTAATAAAACCCACTATATTCTTCGAAAATATCAAACCGTCTATTCCAATAT

[0215] The nucleotide sequence shown in SEQ ID NO:42 is as follows:

[0216] ATATTAAAACAAACGACTTAATATTTCCGAAAAATATAATAAACTTTATTAACACCAATTTCGCTCCCTAACTAACGACTTTTTCAAATTTTTTATCTTATTAATCCGTACTACTATATA

[0217] The nucleotide sequence shown in SEQ ID NO:43 is as follows:

[0218] ACGAACCCCGCGCTAAACGTAACGCGCGAAAAAACCGTATTTAAAACGACCATACGCTAAATACGCCACGACGCGCCGACCCGCCGCGACCAACTACGACGCCTACTAAAACACGTACGC

[0219] The nucleotide sequence shown in SEQ ID NO:44 is as follows:

[0220] ACGCACGTACTCCAACAAACGTCGCAACTAACCGCGACGAACCGACGCGTCGTAACGCACCCAACGCATAACCGCTTCAAACACGACCTCCTCGCGCGCCACGCCCAACGCGAAATCCGC

[0221] The nucleotide sequence shown in SEQ ID NO:45 is as follows:

[0222] ACCGACGCCGACGCGCCGACCGCGCGCTCGAACGATAAATACGACCGTAACGACCCGAAACCGATACAACGACGCTACCAACGCGAAAACTATACGTTCTACGAACGCGCCGAAACCGAA

[0223] The nucleotide sequence shown in SEQ ID NO:46 is as follows:

[0224] CTCGATCTCGACGCGCCCGTAAAACGCACAATTCTCGCGCTAACAACGCCGCTACACCGACCCCGAACCGCCACGACCGCACTCACCGTTCGAACGCGCGATCGACGCGTCGACGTCGAC

[0225] The nucleotide sequence shown in SEQ ID NO:47 is as follows:

[0226] ACTAACTATATCCTAAACACCCTCCACAACCGCCCCAATACTAAACCTACCTTCCGAAACCACTACCGATATACGAAAAAACCCCATAAATTATCGAAACAAACCTAACATCCGCCACTC

[0227] The nucleotide sequence shown in SEQ ID NO:48 is as follows:

[0228] AAATAACGAATACCAAATCTACCTCGACAATCCATAAAACTTCCCCGTACATCGACAATAACCTCGAAAAACAAACCCAACACTAAAACGATTATAAAAAATACCTAAAACACAACCAAC

[0229] The hypomethylated second probe composition comprises one or two of the nucleotide sequences shown in SEQ ID NO:49 - 60.

[0230] The nucleotide sequence shown in SEQ ID NO:49 is as follows:

[0231] ACAACCTAATACTAATATCTAAATCTAAACCAAAAAACAATAAAAACACTTCCTCTATCCTAACCACACCTCATCCAAACTACTCCCAAAATAATTTTACTATCTCCTTCCTACCTAACA

[0232] The nucleotide sequence shown in SEQ ID NO:50 is as follows:

[0233] TACCAAACAAAAAAAAAACAACAAAACTATTCTAAAAACAACCTAAACAAAACACAATCAAAACAAAAAAAACATCCTCACTACTCCTTAACCTAAATTCAAACACCAACATTAAACCAT

[0234] The nucleotide sequence shown in SEQ ID NO:51 is:

[0235] ATCCACACAAAACCAACTTAAACAAAACCCAAAAAACAACAACCAAAAAAACCACAAAAACACAAACACCAAACATCACAAAAAAACAAACCCAAACAAACAAACAACAACCTCCACCAT

[0236] The nucleotide sequence shown in SEQ ID NO:52 is:

[0237] ATAACAAAAACCACCACTTACCTACCCAAACCTACTCCCTCACAACACTCAACACTCACATCTCCACAACTTCTCCAACCACCACCTCCCAAACCCCACCCAAACCAACTCCACATAAAC

[0238] The nucleotide sequence shown in SEQ ID NO:53 is:

[0239] CATACAATAACACAAATTAATAAAATAAAAAATTTAAAAAAACCATCAATCAAAAAACAAAACTAATACTAATAAAACCCACTATATTCTTCAAAAATATCAAACCATCTATTCCAATAT

[0240] The nucleotide sequence shown in SEQ ID NO:54 is:

[0241] ATATTAAAACAAACAACTTAATATTTCCAAAAAATATAATAAACTTTATTAACACCAATTTCACTCCCTAACTAACAACTTTTTCAAATTTTTTATCTTATTAATCCATACTACTATATA

[0242] The nucleotide sequence shown in SEQ ID NO:55 is:

[0243] ACAAACCCCACACTAAACATAACACACAAAAAAACCATATTTAAAACAACCATACACTAAATACACCACAACACACCAACCCACCACAACCAACTACAACACCTACTAAAACACATACAC

[0244] The nucleotide sequence shown in SEQ ID NO:56 is:

[0245] ACACACATACTCCAACAAACATCACAACTAACCACAACAAACCAACACATCATAACACACCCAACACATAACCACTTCAAACACAACCTCCTCACACACCACACCCAACACAAAATCCAC

[0246] The nucleotide sequence shown in SEQ ID NO:57 is:

[0247] ACCAACACCAACACACCAACCACACACTCAAACAATAAATACAACCATAACAACCCAAAACCAATACAACAACACTACCAACACAAAAACTATACATTCTACAAACACACCAAAACCAAA

[0248] The nucleotide sequence shown in SEQ ID NO:58 is:

[0249] CTCAATCTCAACACACCCATAAAACACACAATTCTCACACTAACAACACCACTACACCAACCCCAAACCACCACAACCACACTCACCATTCAAACACACAATCAACACATCAACATCAAC

[0250] The nucleotide sequence shown in SEQ ID NO:59 is:

[0251] ACTAACTATATCCTAAACACCCTCCACAACCACCCCAATACTAAACCTACCTTCCAAAACCACTACCAATATACAAAAAAACCCCATAAATTATCAAAACAAACCTAACATCCACCACTC

[0252] The nucleotide sequence shown in SEQ ID NO:60 is:

[0253] AAATAACAAATACCAAATCTACCTCAACAATCCATAAAACTTCCCCATACATCAACAATAACCTCAAAAAACAAACCCAACACTAAAACAATTATAAAAAATACCTAAAACACAACCAAC

[0254] Specifically, the first probe composition includes the nucleotide sequences shown in SEQ ID NO: 37-38 for hybridizing with the methylated sequence of the MYOM3 gene.

[0255] The first probe composition includes the nucleotide sequences shown in SEQ ID NO: 39-40 for hybridizing with the methylated sequence of the SCTR gene.

[0256] The first probe composition includes the nucleotide sequences shown in SEQ ID NO: 41-42 for hybridizing with the methylated sequence of the LINC01122 gene.

[0257] The first probe composition includes the nucleotide sequences shown in SEQ ID NO: 43-44 for hybridizing with the methylated sequence of the MOGAT2 gene.

[0258] The first probe composition includes the nucleotide sequences shown in SEQ ID NO: 45-46 for hybridizing with the methylated sequence of the TRPM1 gene.

[0259] The first probe composition includes the nucleotide sequences shown in SEQ ID NO: 47-48 for hybridizing with the methylated sequence of the RPL23AP87 gene.

[0260] The second probe composition includes the nucleotide sequences shown in SEQ ID NO: 49-50 for hybridizing with the methylated sequence of the MYOM3 gene.

[0261] The second probe composition includes the nucleotide sequences shown in SEQ ID NO: 51-52 for hybridizing with the methylated sequence of the SCTR gene.

[0262] The second probe composition includes the nucleotide sequences shown in SEQ ID NO: 53-54 for hybridizing with the methylated sequence of the LINC01122 gene.

[0263] The second probe composition includes the nucleotide sequences shown in SEQ ID NO: 55-56 for hybridizing with the methylated sequence of the MOGAT2 gene.

[0264] The second probe composition includes the nucleotide sequences shown in SEQ ID NO: 57-58 for hybridizing with the methylated sequence of the TRPM1 gene.

[0265] The second probe composition comprises the nucleotide sequences shown in SEQ ID NO: 58 - 60 for hybridizing with the methylated sequence of the RPL23AP87 gene.

[0266] The present application provides the use of a nucleic acid for detecting a biomarker in the preparation of a kit for evaluating biological age, wherein the biomarker is the MYOM3 gene, the SCTR gene, the LINC01122 gene, the MOGAT2 gene, the TRPM1 gene, and / or the RPL23AP87 gene. In some embodiments, the target sequence of the MYOM3 gene comprises a sequence shown in any one of SEQ ID NO: 1 - 6 or a sequence shown in any one of SEQ ID NO: 1 - 6;

[0267] In some embodiments, the target sequence of the SCTR gene comprises a sequence shown in any one of SEQ ID NO: 7 - 12 or a sequence shown in any one of SEQ ID NO: 7 - 12;

[0268] In some embodiments, the target sequence of the LINC01122 gene comprises a sequence shown in any one of SEQ ID NO: 13 - 18 or a sequence shown in any one of SEQ ID NO: 13 - 18;

[0269] In some embodiments, the target sequence of the MOGAT2 gene comprises a sequence shown in any one of SEQ ID NO: 19 - 24 or a sequence shown in any one of SEQ ID NO: 19 - 24;

[0270] In some embodiments, the target sequence of the TRPM1 gene comprises a sequence shown in any one of SEQ ID NO: 25 - 30 or a sequence shown in any one of SEQ ID NO: 25 - 30;

[0271] In some embodiments, the target sequence of the RPL23AP87 gene is shown in any one of SEQ ID NO: 31 - 36, or comprises a sequence shown in any one of SEQ ID NO: 31 - 36. In some embodiments, the nucleic acid is for targeting the methylated biomarker of biological age. In some embodiments, the nucleic acid is the probe composition as described above.

[0272] In some embodiments, the nucleic acid comprises:

[0273] Primers, where the primers are fragments of at least 9 nucleotides in the target sequences of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene, and / or RPL23AP87 gene, and the fragments contain at least one CpG dinucleotide sequence;

[0274] Preferably, the nucleic acid further includes:

[0275] Probes, where the probes hybridize with at least 15 nucleotide fragments in the target sequences of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene, and / or RPL23AP87 gene under medium stringency or stringent conditions, and the fragments contain at least one CpG dinucleotide sequence.

[0276] That is, in the present application, when the nucleic acid includes primers and probes, if bisulfite is used to convert the test sample NDA, the nucleic acid includes fragments of at least 9 nucleotides in the sequences after bisulfite conversion of the target sequences of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene, and / or RPL23AP87 gene, and the fragments contain at least one CpG dinucleotide sequence.

[0277] In some embodiments, the nucleic acid further includes:

[0278] Blockers that preferentially bind to target sequences in the non-methylated state.

[0279] The present application provides a composition for evaluating biological age, where the composition contains nucleic acids for detecting the methylation of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene, and / or RPL23AP87 gene. In some embodiments, the target sequence of the MYOM3 gene contains the sequence shown in any one of SEQ ID NO: 1-6 or the sequence shown in any one of SEQ ID NO: 1-6;

[0280] In some embodiments, the target sequence of the SCTR gene contains the sequence shown in any one of SEQ ID NO: 7-12 or the sequence shown in any one of SEQ ID NO: 7-12;

[0281] In some embodiments, the target sequence of the LINC01122 gene contains the sequence shown in any one of SEQ ID NO: 13-18 or the sequence shown in any one of SEQ ID NO: 13-18;

[0282] In some embodiments, the target sequence of the MOGAT2 gene comprises the sequence shown in any one of SEQ ID NOs: 19 - 24 or the sequence shown in any one of SEQ ID NOs: 19 - 24;

[0283] In some embodiments, the target sequence of the TRPM1 gene comprises the sequence shown in any one of SEQ ID NOs: 25 - 30 or the sequence shown in any one of SEQ ID NOs: 25 - 30;

[0284] In some embodiments, the target sequence of the RPL23AP87 gene is shown in any one of SEQ ID NOs: 31 - 36, or comprises the sequence shown in any one of SEQ ID NOs: 31 - 36. In some embodiments, the nucleic acid is used to target the methylated biomarker of biological age. In some embodiments, the nucleic acid is the probe composition as described above.

[0285] In some embodiments, the nucleic acid comprises:

[0286] Primers, the primers are fragments of at least 9 nucleotides in the target sequences of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene and / or RPL23AP87 gene, and the fragments contain at least one CpG dinucleotide sequence. In some embodiments, the nucleic acid further comprises:

[0287] Probes, the probes hybridize with at least 15 - nucleotide fragments in the target sequences of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene and / or RPL23AP87 gene under medium stringency or stringent conditions, and the fragments contain at least one CpG dinucleotide sequence.

[0288] In some embodiments, the composition further comprises a reagent that converts the 5 - unmethylated cytosine base in the target sequences of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, and TRPM1 gene into uracil.

[0289] In the present application, the 5 - unmethylated cytosine base refers to the cytosine whose fifth carbon does not receive a methyl group, that is, the cytosine is not methylated.

[0290] In the present application, the reagent can be, for example, bisulfite, etc.

[0291] In some embodiments, the nucleic acid further comprises:

[0292] A blocker that preferentially binds to a target sequence in an unmethylated state.

[0293] In the present application, by detecting the methylation of one of the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, and TRPM1 gene, or by jointly detecting the methylation of two or more markers, the biological age can be accurately evaluated.

[0294] The present application provides a kit, which contains reagents for detecting the above-mentioned markers, the above-mentioned probe composition, or the above-mentioned composition. In some embodiments, the kit further contains a container for accommodating a biological sample of a subject. In some embodiments, the kit further includes instructions for using and interpreting the test results.

[0295] In the present application, the biological sample can be, for example, a plasma sample.

[0296] The present application does not impose any restrictions on the method for detecting the methylation level of the target sequence using the above-mentioned kit, and those skilled in the art can make selections according to needs. For example, the present application provides a method for detecting the methylation level of the target sequence of a marker using the above-mentioned kit, which includes the following steps:

[0297] Collect a sample from a subject;

[0298] Extract and purify the DNA in the sample;

[0299] Construct a DNA library for sequencing for the purified DNA sample;

[0300] Bisulfite-convert the constructed DNA library;

[0301] Pre-PCR amplify the bisulfite-converted DNA library;

[0302] Use the probe composition to perform hybridization capture on the pre-PCR amplified sample;

[0303] Use PCR to amplify the product after hybridization capture;

[0304] Perform high-throughput next-generation sequencing on the product after hybridization capture and PCR amplification;

[0305] Analyze the sequencing data to determine the methylation level of the sample;

[0306] Calculate the threshold for each marker based on the methylation status of the existing samples, and interpret the age status of the patient based on the methylation level of a certain marker in the sample.

[0307] For another example, the present application provides a method for detecting the methylation level of a target sequence of a biomarker using the above-described kit, which includes the following steps:

[0308] (1) Collect a plasma sample from a subject;

[0309] (2) Isolate DNA from the plasma sample;

[0310] (3) Treat the DNA obtained in step (2) with a reagent to convert the unmethylated cytosine base at position 5 to uracil or other bases, that is, the unmethylated cytosine base at position 5 of the target sequence of the biomarker is converted to uracil or other bases, and the converted base is different from the unmethylated cytosine base at position 5 in terms of hybridization performance and is detectable;

[0311] (4) Contact the DNA treated in step (3) with a DNA polymerase and a primer for the target sequence of the biomarker, so that the treated target sequence of the biomarker is amplified to produce an amplification product or not amplified; if the treated target sequence of the biomarker undergoes DNA polymerization reaction, an amplification product will be produced; if the treated target sequence of the biomarker does not undergo DNA polymerization reaction, it will not be amplified;

[0312] (5) Detect the amplification product with a probe;

[0313] (6) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the biomarker, thereby determining the methylation level of the target sequence of the biomarker.

[0314] The present application provides a chip, which contains a reagent for detecting the above-described biomarker or the above-described probe composition or the above-described composition.

[0315] The chip is also called a gene chip, and its sequencing principle is the hybridization sequencing method, that is, a method for nucleic acid sequence determination by hybridizing with a group of nucleic acid probes with known sequences. Probes of target nucleotides with known sequences are fixed on the surface of a substrate. When the nucleic acid sequence with a fluorescent label in the solution produces complementary matching with the nucleic acid probe at the corresponding position on the gene chip, by determining the position of the probe with the strongest fluorescence intensity, a group of probe sequences with completely complementary sequences is obtained.

[0316] The preparation of the chip mainly uses a glass slide or a silicon wafer as a carrier, and oligonucleotide fragments or cDNA are arranged on the carrier in sequence by in-situ synthesis and microarray methods.

[0317] The chip described in this application is based on the detection of signals from hybridization of bisulfite-treated DNA sequences. Bisulfite treatment converts non-methylated cytosine into uracil, while methylated cytosine remains unchanged. Then, uracil is converted into thymine, and finally, chip hybridization is performed. Finally, the type of base added is determined based on the fluorescence color, and thus whether the site is methylated is determined.

[0318] This application provides a method for assessing biological age, which includes:

[0319] detecting the methylation level of a biomarker, and

[0320] assessing the biological age of a subject based on the methylation level, where the biomarker is the MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, and TRPM1 gene.

[0321] This application also discloses an age prediction model based on DNA methylation, which is characterized in that it uses the above method to assess biological age.

[0322] Examples

[0323] This application generally and / or specifically describes the materials and test methods used in the experiments. In the following examples, if there is no other special description, % represents wt%, that is, weight percentage. For reagents or instruments whose manufacturers are not indicated, they are all conventional reagent products that can be obtained through commercial purchase.

[0324] Example 1: Whole-genome methylation detection

[0325] 1. DNA extraction and quality inspection

[0326] 1.1 DNA extraction

[0327] Sample lysis

[0328] Using an electric continuous pipettor, add 20 μl of Proteinase K and 200 μl of leukocyte lysis buffer I to the sample storage tube, mix well, and incubate at 56 °C for 30 min;

[0329] During sample lysis, use a liquid handling workstation to add the following reagents to a 96DW deep-well plate:

[0330] Table 1

[0331]

[0332]

[0333] Then verify in plasma samples, and its experimental detection method is as follows:

[0334] Upper machine extraction

[0335] Add the lysis products to the Sample Plate in sequence; (Note: To prevent the lysis products from being added to the wrong position, the position after adding the sample needs to be immediately sealed with a silica gel cover, and then the next sample can be added)

[0336] Turn on the AE2130 instrument, place the deep well plate in the instrument in sequence, and then run the program '2517-lysis';

[0337] After about 20 minutes, the instrument pauses. Take out the 'Sample Plate', and use an electric continuous pipettor to add 310 μl of the well-mixed mixture of magnetic beads and binding solution to the deep well plate;

[0338] Put the 'Sample Plate' back into the AE2130 instrument and continue running the program;

[0339] After about 25 minutes, the program runs to completion. Take out the deep well plate and the magnetic sleeve from the instrument, transfer the elution product in the 'Sample Plate' to a 1.5 mL EP tube, freeze it for storage and take a photo for record.

[0340] 1.2 DNA quality inspection

[0341] 1.2.1 Concentration and purity determination

[0342] On the NanoDrop 2000, take 2 μl of the extraction product for concentration and purity determination.

[0343] 1.2.2 Qubit concentration determination

[0344] Use a variable-spacing pipettor to transfer 2 μl of the extraction product to a PCR plate, dilute it 10 times, mix well and measure the concentration in Qubit.

[0345] Integrity test

[0346] Take 6 μl of the diluted product in 1.2.2 for agarose gel electrophoresis to detect the integrity of genomic DNA.

[0347] Note: Immediately carry out the downstream library construction work after the quality inspection

[0348] 2. WGBS library construction

[0349] 2.1 DNA fragmentation and fragment screening

[0350] Vibrate, mix and centrifuge the thawed DNA samples (including positive control products), arrange them in the original order, and can be temporarily stored at 4°C;

[0351] Sample homogenization: Take a low-adsorption PCR plate, add samples in a fixed order, and then add water to the fixed volume of 130μl;

[0352] Mechanical shearing operation: Pipette 130μl of the homogenized sample into the shearing tube, pay attention to the placement and use order of the shearing tube, and shear according to the shearing procedure; after shearing, transfer 129μl to a new purification plate, and add 1μl of sheared λDNA with a concentration of 0.05ng / μl to each sample;

[0353] Interrupt program: peakpower 450, duty factor 30, cycle / burst 194, interrupt time 120s

[0354] Fragment screening: Balance the magnetic beads 30 minutes in advance and perform fragment screening on the automated workstation. It is important to prepare the tips and reagents 10 minutes in advance and check the usage procedures. Prepare the end repair Mix (see Table 2 for specific ingredients) in a new low-adsorption PCR plate in advance, and automatically add the eluted product to the Mix and mix well (if paused, you can choose to directly recover the eluted product and temporarily store it at -20°C).

[0355] Random inspection: The remaining products after screening can be temporarily stored, and 1 to 3 samples from different positions are randomly selected and diluted 10 times for concentration and peak quality inspection.

[0356] 2.2 Library construction

[0357] 2.2.1 End repair reaction + A tail

[0358] The end repair reaction solution can be prepared 10 minutes in advance according to the following system, shaken to mix, centrifuged at 400g for 5s, dispensed into 8 strips of PCR tubes, and then added to a new low-adsorption PCR plate using a dispenser and placed on ice for later use.

[0359] Add 11 μl of the screened product to a low-adsorption PCR plate containing end-repair mix, seal the plate, shake and mix, and centrifuge.

[0360] Table 2

[0361] Reagent Single dosage (ul) Enzyme 1-2 2 Buffer1 1 BufferU 1.5

[0362] Reaction program: hot cover 66℃, 25℃30Min, 56℃20Min, 4℃forever

[0363] 2.2.2 Adding connector

[0364] The reaction solution can be prepared in the following system 5 minutes in advance. After shaking and mixing evenly, centrifuge at 400g for 5s, aliquot into 8-well PCR tubes, and store on an ice box for later use. Use a multichannel pipette to add the reaction solution to the end repair product PCR plate, seal the film, then shake and centrifuge before loading onto the machine for reaction.

[0365] Table 3

[0366] Reagent Single dosage (ul) Enzyme 2 1 Buffer2 1.5 BufferU 0.5 Adapter (2um) 2

[0367] Reaction program: Close the hot lid, 22°C for 40 Min, 4°C forever

[0368] 2.2.3 Adapter product purification

[0369] Prepare the column and collection tube in advance, label the column with the corresponding number, or you can also prepare clean 1.5 mL EP tubes in advance and label them with the corresponding numbers;

[0370] Take 140 μl of DNA Binding Buffer and add it to the sample. After blowing and mixing 5 times, transfer all of it to the corresponding column;

[0371] Centrifuge at 13000 rcf for 30 s (ensure that the liquid can be completely centrifuged down);

[0372] Add 200 μl of DNA Wash Buffer to the column and centrifuge at 13000 rcf for 30 s (ensure that the liquid can be completely centrifuged down);

[0373] Repeat the previous step;

[0374] After centrifugation, place the column on the previously prepared 1.5 mL EP tube and add 22 μl of EB Buffer;

[0375] Centrifuge at 13000 rcf for 30 s (ensure that the liquid can be completely centrifuged down);

[0376] Take 20 μl of the liquid and use it in the next Mix for reaction.

[0377] 2.2.4 Inactivation reaction

[0378] The reaction solution can be prepared in the following system 10 minutes in advance. After shaking and mixing evenly, centrifuge at 400g for 5s, aliquot into 8-well PCR tubes, and store on an ice box for later use. Use a multichannel pipette to add the reaction solution to a new low-binding PCR plate, then add the purified product, seal the film, and shake and centrifuge before loading onto the machine for reaction.

[0379] Table 4

[0380] Reagent Single dosage (ul) Enzyme 4 0.2 Buffer4.1 0.8 Buffer4.2 1 BufferU 2.5

[0381] Reaction program: Hot lid 84°C, 74°C for 10 Min, 4°C forever

[0382] 2.3 Transformation

[0383] After inactivating the sample, add 130 μl of LC chromogenic reagent using a 200 μl multichannel pipette, mix by pipetting up and down 10 times, seal the membrane, and then carry out the transformation reaction. After the reaction is completed, it can be stored at 4 °C for 20 hours.

[0384] Reaction program: Hot lid at 105 °C. 98 °C for 8 Min, 54 °C for 60 Min, 4 °C forever

[0385] After the reaction is completed, remove the sealing membrane and process according to the following steps.

[0386] Prepare the column and collection tube in advance, write the corresponding number on the column, or you can also prepare clean 1.5 ml EP tubes in advance and write the corresponding number on them;

[0387] Take 600 μl of M-Binding Buffer into the column, then transfer all the samples into the column, cover the lid, and invert it up and down 10 times;

[0388] Centrifuge at 13000 rcf for 30 s (ensure that the liquid can be completely separated).

[0389] Add 100 μl of M-Wash Buffer to the column, and centrifuge at 13000 rcf for 30 s (ensure that the liquid can be completely separated).

[0390] Add 200 μl of L-Desulphonation Buffer, let it stand at room temperature for 15 min, and then centrifuge at 13000 rcf for 30 s (ensure that the liquid can be completely separated).

[0391] Add 200 μl of M-Wash Buffer to the column, and centrifuge at 13000 rcf for 30 s (ensure that the liquid can be completely separated).

[0392] Repeat the previous step;

[0393] After centrifugation, place the column on the previously prepared 1.5 mL EP tube, add 10 μl of EB Buffer, and centrifuge at 10000 rcf for 30 s (ensure that the liquid can be completely separated).

[0394] Take 9 μl of the liquid and transfer it to the next Mix for reaction.

[0395] 2.4 Library Amplification

[0396] The PCR reaction solution can be prepared in the following system 5 minutes in advance, dispensed into 8-strip PCR tubes, and the reaction solution is added to a new low-binding PCR plate using a multichannel pipette. Indexes are added respectively and records are made. Finally, the purified product is added. After sealing the film, it is shaken and centrifuged and then put into the machine for reaction.

[0397] Table 5

[0398] Reagent Single dosage (ul) PCR Enzyme 0.5 2X PCR Buffer 12.5 P5N Primer (10pmol / ul) 1.5 P7 Primer (10pmol / ul) 1.5 (added alone)

[0399] Reaction program: Hot lid at 105°C. 94°C for 2 min; (98°C for 10 s, 52°C for 30 s, 68°C for 15 s) for 12 cycles;

[0400] 72°C for 1 min; 4°C forever

[0401] 2.5 Library purification

[0402] After the reaction, remove the sealing film and perform purification on the automated workstation. Note that the pipette tips and reagents should be prepared 10 minutes in advance, photographed and recorded, and the usage procedure should be checked.

[0403] During the automated operation, 1.5 ml low-binding EP tubes for storage can be prepared, and the label printing, pasting and preparation of storage information should be completed. After the purification is completed, transfer the purified product to the labeled tubes using an adjustable-spacing multichannel pipette and make records.

[0404] Subsequently, randomly select 3 samples for concentration and peak map detection, and report any abnormalities to the library construction person in charge.

[0405] 3. Library quality inspection

[0406] Use the Bioptic Qsep100 fully automatic nucleic acid and protein analysis system or the Agilent 2100 bioanalyzer to detect the fragment distribution of the library;

[0407] Use qPCR to quality inspect the effective concentration of the library.

[0408] 4. Library loading

[0409] The library sequencing platform is the illumina Nova 6000 sequencer, and the sequencing mode is PE150.

[0410] 5. Requirements for data technical parameters:

[0411] Sequencing data ≥ 90 G / specimen,

[0412] BS conversion rate ≥ 99%,

[0413] Data redundancy < 23% (the number of duplicate reads in mapping divided by the number of mapping reads),

[0414] The proportion of clean reads in the original data > 85%

[0415] After deduplication: Genome-wide coverage above 1× > 90%, genome-wide coverage above 5× > 85%

[0416] Coverage rate of 5× mCG (excluding sex chromosomes) > 70%.

[0417] Example 2 Screening of candidate CpG enrichment intervals

[0418] 1. Biomarker screening

[0419] The method for screening methylation intervals related to age is as follows:

[0420] Quality control: Use the fastp software to analyze the quality of 1238 cases of WGBS raw sequencing data, and perform filtering, truncation, or removal of low-quality reads to obtain the corresponding clean data;

[0421] Alignment and deduplication: Use the Bismark bowtie2 alignment software to align the quality-controlled clean data to the reference genome (hg38); Use deduplicate_bismark to deduplicate the initially aligned bam file;

[0422] Extract methylation site information: Use Bismark_methylation_extractor to extract the corresponding methylation site information to obtain the final methylation CG file (including all single CG site information files);

[0423] Construction of CpG enrichment regions: Scan CpG sites across the whole genome to identify CpG enrichment regions, requiring that the obtained intervals meet the following conditions: 1) The distance between two CpG sites shall not exceed L bp; 2) At least cover 3 CpGs; 3) The maximum length of the enrichment region shall not exceed 400 bp, to obtain the candidate region region1. Limited by the sequencing read length, it is recommended to set L to a number less than 150 to obtain a shorter CG-rich interval that covers at least 3 CpG sites to improve the stability of methylation levels.

[0424] Screening of age-related candidate intervals: For the 1215 samples in batch 1, according to Figure 1Perform splitting using the 5×5 nested cross-validation as shown: there are 5 groups in the outer loop, and for the training set of each group in the outer loop, it is further split into 5 groups. Taking the first group in the outer loop as an example, split its training set into 5 groups (i.e., the inner loop). For each group (a total of 5 groups) in this inner loop, using age as the response variable, methylation as the independent variable, and gender as the covariate, construct a multiple linear regression model for each CpG enrichment interval. Use the False Discovery Rate (FDR) method to correct the p-values corresponding to the age coefficients to obtain the corrected q-values. We select the top 1000 enrichment intervals with the smallest q-values. Finally, combine the top 1000 enrichment intervals of the 5 groups in the inner loop, and after removing duplicates, obtain 1235 candidate interval markers. Repeat the above analysis process, and sequentially screen for candidate CpG enrichment intervals in the other 4 groups of the outer loop, obtaining 1234, 1260, 1288, and 1282 candidate intervals in turn. Combine the 5 groups of candidate intervals and remove duplicates to finally obtain 1966 candidate markers.

[0425] For the 1966 candidate intervals screened above, calculate the correlation between each candidate interval and age respectively, and extract the 6 candidate intervals with the largest correlation coefficients.

[0426] Construction and evaluation of the age prediction model in Example 3

[0427] First, for the first group in the outer loop in Example 2 ( Figure 1 ), using age as the response variable and 6 candidate intervals as the independent variables, on the training set, construct an age prediction model based on DNA methylation using an elastic regression network. Use this model to make predictions on the training set and the test set respectively, obtain the predicted ages of the training set and the test set respectively, and calculate the correlation coefficient (R) and the mean absolute error (Mean Absolute Error, MAE) between the predicted biological age and the calendar age. The calculation results can objectively reflect the prediction accuracy of the model, and evaluate the quality of the model numerically. Among them, the closer R is to 1, the higher the degree of conformity between the predicted age and the true age of the sample; the closer MAE is to 0, the smaller the error between the biological age predicted by the model and the calendar age of the sample. Apply the model to the test set samples, and the prediction result is that the average correlation coefficient R = 0.90 between the biological age predicted based on methylation markers and the calendar age, and the average absolute error MAE = 5.5.

[0428] Example 4 Independent validation set evaluation

[0429] Similarly, use the model obtained in Example 3 to detect in 12 independent validation sets, and calculate to obtain the evaluation index R = 0.93 ( Figure 2), MAE = 6.1. It can be seen from the results that the model still obtains stable evaluation results on the cross-platform independent validation set.

[0430] In summary, the inventors of the present application have obtained methylation genes related to biological age, determined the corresponding target sequences, and through the target sequences of these methylation genes, the methylation status of the genes can be detected sensitively and specifically, so that it can be used for the detection of biological age, and the composition described in the present application has excellent accuracy.

[0431] The above are only the preferred embodiments of the present application, and are not intended to limit the present application in other forms. Any person skilled in the art may use the technical content disclosed above to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present application without departing from the technical solution content of the present application still belong to the protection scope of the technical solution of the present application.

Claims

1. A marker for assessing biological age, wherein: The markers are MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene and / or RPL23AP87 gene.

2. The marker according to claim 1, wherein The target sequence of the MYOM3 gene comprises a sequence as shown in any one of SEQ ID NOs: 1-6 or a sequence as shown in any one of SEQ ID NOs: 1-6; The target sequence of the SCTR gene comprises a sequence as shown in any one of SEQ ID NOs: 7-12 or a sequence as shown in any one of SEQ ID NOs: 7-12; The target sequence of the LINC01122 gene comprises a sequence as shown in any one of SEQ ID NOs: 13-18 or a sequence as shown in any one of SEQ ID NOs: 13-18; The target sequence of the MOGAT2 gene comprises a sequence as shown in any one of SEQ ID NOs: 19-24 or a sequence as shown in any one of SEQ ID NOs: 19-24; The target sequence of the TRPM1 gene comprises a sequence as shown in any one of SEQ ID NOs: 25-30 or a sequence as shown in any one of SEQ ID NOs: 25-30; The target sequence of the RPL23AP87 gene is shown in any one of SEQ ID NOs: 31-36, or includes the sequence shown in any one of SEQ ID NOs: 31-36.

3. A probe composition, wherein: The probe composition comprises a probe targeting the methylation of the marker according to claim 1 or claim 2.

4. The probe composition according to claim 3, wherein The probe composition comprises a first hypermethylated probe composition and a second hypomethylated probe composition, wherein the first probe composition is used for hybridizing with a CG hypermethylated region converted by bisulfite, and the second probe composition is used for hybridizing with a CG hypomethylated region converted by bisulfite.

5. The probe composition according to claim 4, wherein The first probe composition comprises n probes, and the n probes hybridize with each nucleotide of the sense chain and / or antisense chain of the CG high methylation region converted by bisulfite. Preferably, the second probe composition comprises m probes, and the m probes hybridize with each nucleotide of the sense chain and / or antisense chain of the CG low methylation region converted by bisulfite. Further preferably, n and m are any integers between 1 and 10.

6. The probe composition according to claim 5, wherein There are x1 nucleotide overlaps between the n-1th probe and the nth probe, preferably, x1 is any integer between 0 and 100; Preferably, there are x2 nucleotides overlapping between the m-1th probe and the mth probe, and preferably, x2 is any integer between 0 and 100; Further preferably, the first probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 37-48; and the second probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 49-60.

7. Use of a nucleic acid for detecting a marker in the preparation of a kit for assessing biological age, wherein: The markers are MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene and / or RPL23AP87 gene.

8. A composition for assessing biological age, wherein: The composition comprises nucleic acids for detecting methylation of MYOM3 gene, SCTR gene, LINC01122 gene, MOGAT2 gene, TRPM1 gene and / or RPL23AP87 gene.

9. A kit comprising a reagent for detecting the marker according to claim 1 or 2, the probe composition according to any one of claims 3 to 6, or the composition according to claim 8. 10 . A chip comprising a reagent for detecting the marker according to claim 1 or 2, the probe composition according to any one of claims 3 to 6, or the composition according to claim 8.

Images