Primer, kit and method for jointly detecting food-borne norovirus based on CRISPR / Cas12b and RT-LAMP

Abstract

The invention relates to a primer, a kit and a method for jointly detecting a food-borne norovirus based on CRISPR / Cas12b and RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification). The specific RT-LAMP amplification primer is designed, and the reaction system is optimized, so that the specificity and high efficiency of the amplification process are realized. According to the method, the CRISPR detection and the RT-LAMP technology are integrated in a one-tube method, so that the aerosol pollution caused by uncapping and sampling is avoided while efficient amplification and detection are realized; the method has the advantages of rapidness, sensitivity, simplicity in operation, pollution prevention, capability of completing detection without complex operation and instruments, and low requirements on cost of operators, environment and instruments.

Description

Technical Field

[0001] The present invention relates to the fields of agriculture and food safety, and particularly to a primer, a kit and a method for jointly detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP. Background Art

[0002] Norovirus belongs to the family Caliciviridae. Its genomic morphology is a single-stranded positive-sense RNA virus with a diameter of 27-40 nm, spherical, and icosahedral symmetry. The norovirus genome is about 7.5 kb in length. The 5' end of the genome is covalently linked to a viral protein (VPg), and the 3' end is polyadenylated. The norovirus genome contains three open reading frames (ORFs). Among them, ORF1 is responsible for encoding six non-structural proteins, while ORF2 and ORF3 encode two structural proteins, VP1 and VP2, respectively. Specifically, ORF1 is located near the 5' end of the genome and is responsible for encoding a polyprotein, which can be cleaved by the viral protease NS6 to finally form six non-structural proteins. ORF2 and ORF3 are translated from subgenomic RNA and encode capsid proteins that can form the virus nucleocapsid. Norovirus is divided into six genotypes according to genetic characteristics, namely GI to GVI. Among them, the GI, GII, and GIV genotypes can cause human diseases. Among the noroviruses that cause human diseases, GI and GII genotypes are the main ones, and these two genotypes are further subdivided into multiple genetic clusters. Norovirus can prevail throughout the year and is mainly distributed in specific environments such as hospitals, schools, and cruise ships. It can infect people of all ages, and the infection risk increases in the cold season. Norovirus can survive for a long time at room temperature. The sanitary conditions in the above-mentioned places are often limited and the population is dense. Once a norovirus infection occurs, it is easy to trigger an epidemic outbreak.

[0003] At the current stage, virus detection technologies are mainly divided into identification methods based on traditional virus culture and immunology, and molecular biology identification methods based on target gene sequences. Traditional identification methods, including virus culture and immunology techniques, have problems such as complex operation, long time consumption, and insufficient sensitivity, and are difficult to meet the needs of rapid customs clearance detection. Molecular biology detection technologies, such as conventional PCR and fluorescence quantitative PCR, although having high sensitivity and specificity, their operations rely on a variety of precision instruments, such as PCR instruments, electrophoresis instruments, and gel imaging systems. These technologies require high professional skills of operators, and the equipment cost is high and it is not easy to carry, so it is difficult to conduct on-site instant detection.

[0004] Chinese Patent CN116254368A discloses a primer, probe, kit and method for detecting Norovirus GI genome. The detection primers and probes provided by this patent can specifically detect the Norovirus GI genome. The detection primers and probes provided by this patent can specifically detect the Norovirus GI genome. The detection method of this patent combines isothermal amplification and lateral flow test strip. Although it has the advantages of rapidity and simplicity, its sensitivity is relatively low. Especially in low-concentration samples, it may lead to false negative or false positive results. Summary of the Invention

[0005] The purpose of the present invention is to provide a primer, kit and method for jointly detecting foodborne Norovirus based on CRISPR / Cas12b and RT-LAMP. By combining RT-LAMP with CRISPR / Cas12b and reacting in a one-tube method, while achieving efficient amplification and detection, it avoids aerosol contamination caused by opening the lid for sampling; the present invention is rapid, sensitive, simple to operate, anti-pollution, and can complete the detection without complex operations and instruments, with low requirements for operators, environment and instrument costs.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] The first purpose of the present invention is to provide a primer for jointly detecting foodborne Norovirus based on CRISPR / Cas12b and RT-LAMP. The primer combination for detecting foodborne Norovirus includes group A primers and group B primers packaged independently;

[0008] The nucleotide sequences of the group A primers are shown as SEQ ID NO.1 to SEQ ID NO.6;

[0009] The nucleotide sequences of the group B primers are shown as SEQ ID NO.7 to SEQ ID NO.12.

[0010] Furthermore, the foodborne Norovirus includes Norovirus GI type and Norovirus GII type. The group A primers are used to detect Norovirus GI type, and the group B primers are used to detect Norovirus GII type.

[0011] The second purpose of the present invention is to provide a kit for jointly detecting foodborne Norovirus based on CRISPR / Cas12b and RT-LAMP. The kit includes the above-mentioned group A primers, group B primers for detecting foodborne Norovirus and an amplification reaction system.

[0012] Further, taking the amplification reaction system as 25 μL, it includes: 12.5 μL of 2×RT-LAMP amplification buffer, 0.2 μL of 15 U / μL RTX reverse transcriptase, 1 μL of 15 U / μL BST polymerase, 2.5 μL of 10×RT-LAMP primer premix, 1 μL of RNA template, 1 μL of 10 μM AapCas12b, 1 μL of 10 μM sgRNA, 0.8 μL of 10 μM probe, 5 μL of ddH 2 O.

[0013] Still further, when the primer premix includes group A primers shown in SEQ ID NO.1 to SEQ ID NO.6, the sequence of the sgRNA is as shown in SEQ ID NO.13.

[0014] Still further, when the primer premix includes group B primers shown in SEQ ID NO.7 to SEQ ID NO.12, the sequence of the sgRNA is as shown in SEQ ID NO.14.

[0015] The third object of the present invention is to provide a method for jointly detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP, and the specific steps are as follows:

[0016] Simultaneously configure the reaction systems based on RT-LAMP and CRISPR / Cas12b in a reaction tube, add the sample to be tested, place it in a QPCR instrument for reaction, and observe the fluorescence results.

[0017] Further, the reaction temperature is 50°C to 60°C, preferably 55°C, and the reaction time is 30 to 50 min, preferably 40 min.

[0018] Further, when no increase in the fluorescence signal intensity is observed in the reaction system, the sample to be tested does not contain foodborne norovirus.

[0019] The fourth object of the present invention is to provide an application of a primer or a kit in the preparation of drugs for preventing / treating / diagnosing foodborne norovirus-related diseases.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] The present invention provides a rapid detection method for foodborne norovirus by combining CRISPR / Cas12b technology with reverse transcription loop-mediated isothermal amplification (RT-LAMP) technology. By designing specific RT-LAMP amplification primers and optimizing the reaction system, the specificity and efficiency of the amplification process are achieved. This method integrates CRISPR detection and RT-LAMP technology in a one-tube method, effectively avoiding the problem of aerosol contamination and simplifying the detection process.

[0022] The present invention discloses a one-step rapid detection method for foodborne norovirus GI and GII types based on the combination of CRISPR / Cas12b and RT-LAMP technologies. The steps of this method include: First, the RT-LAMP reaction system and the CRISPR / Cas12b reaction system are co-placed in the same reaction tube to achieve synchronous amplification and cleavage. During this process, the specific guide RNA (sgRNA) is complementary paired with the amplification product and binds to the Cas12b protein, thereby achieving specific cleavage of the amplification product. At the same time, the fluorescently labeled single-stranded DNA probe (ssDNA probe) contained in the cleavage reaction is cleaved and released, resulting in the generation of a fluorescent signal. Second, the interpretation of the detection results can be carried out by an instrument equipped with a fluorescence detection system and completed by analyzing the fluorescence signal intensity.

[0023] The detection method proposed by the present invention has the advantages of rapidity, high sensitivity, simple operation, anti-pollution, and can complete the detection without complex equipment and operations. It has low requirements for operators, the environment, and instrument costs, and shows application potential in point-of-care rapid detection. Brief Description of the Drawings

[0024] Figure 1 Schematic diagram of the process of a one-tube rapid detection method for foodborne norovirus combining CRISPR / Cas12b and RT-LAMP;

[0025] Figure 2 Schematic diagram of the specific analysis results of norovirus GI type;

[0026] Figure 3 Schematic diagram of the detection limit analysis results of norovirus GI type;

[0027] Figure 4 Schematic diagram of the specific analysis results of norovirus GII type;

[0028] Figure 5 Schematic diagram of the detection limit analysis results of norovirus GII type. Detailed Description of the Invention

[0029] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation manners and specific operation procedures are given. However, the protection scope of the present invention is not limited to the following embodiments.

[0030] The sources of materials in the following examples are as follows:

[0031] Primers F3, FIP, BIP, B3, LF, LB and the fluorescent probe were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.; the sgRNA was synthesized in the laboratory. Among them, the fluorescent probe sequence is 5’-CCCCCCCC-3’;

[0032] Cas12b was purchased from Anhui Tulugang Biotechnology Co., Ltd.

[0033] Hot start DNA polymerase Bst 2.0 DNA Polymerase and hot start reverse transcriptase RTx Reverse Transcriptase are all commercially available products from New England Biolabs (NEB).

[0034] The specific reaction system in the following examples is as follows:

[0035] Calculated by 25 μL, it includes 12.5 μL of 2×RT-LAMP amplification buffer, 0.2 μL of 15 U / μL RTX reverse transcriptase, 1 μL of 15 U / μL BST polymerase, 2.5 μL of 10×RT-LAMP primer premix (16 μM FIP, 16 μM BIP, 2 μM F3, 2 μM B3, 4 μM LF, 4 μM LB), 1 μL of RNA template, 1 μL of 10 μM AapCas12b, 1 μL of 10 μM sgRNA, 0.8 μL of 10 μM probe, 5 μL of ddH 2 O.

[0036] The sequences in the following examples are shown as follows:

[0037] The F3 nucleic acid sequence of norovirus genotype GI (M87661) is shown in SEQ ID NO.1:

[0038] 5’-GATGGCAGGCCATGTTCC-3’;

[0039] The FIP nucleic acid sequence of norovirus genotype GI (M87661) is shown in SEQ ID NO.2:

[0040] 5’-ACGAATTCGGGCAGAAGATCGCCTGGATGCGCTTCCATGA-3’;

[0041] The BIP nucleic acid sequence of norovirus GI type (M87661) is shown in SEQ ID NO.3:

[0042] 5’-TGATGATGGCGTCTAAGGACGCTCCGGTACCAACTGACCA-3’;

[0043] The B3 nucleic acid sequence of norovirus GI type (M87661) is shown in SEQ ID NO.4:

[0044] 5’-ACAGGATCCATTGCAAGAGG-3’;

[0045] The LF nucleic acid sequence of norovirus GI type (M87661) is shown in SEQ ID NO.5:

[0046] 5’-TCTCCTGTCCACAATCCGAGG-3’;

[0047] The LB nucleic acid sequence of norovirus GI type (M87661) is shown in SEQ ID NO.6:

[0048] 5’-CAAGCGTGGATGGCGCTAG-3’;

[0049] The F3 nucleic acid sequence of norovirus GII type (X86557) is shown in SEQ ID NO.7:

[0050] 5’-CGTCGAATGACGCCAACC-3’;

[0051] The FIP nucleic acid sequence of norovirus GII type (X86557) is shown in SEQ ID NO.8:

[0052] 5’-CGGGCTCCAGAGCCATAACCTCATCTGATGGGTCCGCAG-3’;

[0053] The BIP nucleic acid sequence of norovirus GII type (X86557) is shown in SEQ ID NO.9:

[0054] 5’-GGCGGGCCAACAAAACGTAATTGGGACACTGTGAACTCTCCA-3’;

[0055] The B3 nucleic acid sequence of norovirus GII type (X86557) is shown in SEQ ID NO.10:

[0056] 5’-CGCTCCACAGTATCTCACCT-3’;

[0057] The LF nucleic acid sequence of norovirus GII type (X86557) is shown in SEQ ID NO.11:

[0058] 5’-CATTATTGACCTCTGGGACGAGG-3’;

[0059] The LB nucleic acid sequence of norovirus GII type (X86557) is shown in SEQ ID NO.12:

[0060] 5’-AGAAACAATTTTGTACAAGCCCCTG-3’;

[0061] The RNA sequence corresponding to the sgRNA nucleic acid sequence of norovirus GI type is shown in SEQ ID NO.13:

[0062] 5’-GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUGGACAGGAGAUCGCGAUCU-3’;

[0063] The RNA sequence corresponding to the sgRNA nucleic acid sequence of norovirus GII type is shown in SEQ ID NO.14:

[0064] 5’-GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUAAUCCAGGGGUCAAUUACG-3’.

[0065] The following will describe in detail some embodiments of the present invention with reference to the accompanying drawings. Without conflict, the following embodiments and the features in the embodiments can be combined with each other.

[0066] Example 1

[0067] This embodiment provides a primer combination for norovirus RT-LAMP amplification. The primer combination for detecting foodborne norovirus includes group A primers and group B primers independently packaged;

[0068] The nucleotide sequences of the group A primers are shown in SEQ ID NO.1 to SEQ ID NO.6, and the group A primers are used to detect norovirus GI type;

[0069] The nucleotide sequences of the primer set B are shown in SEQ ID NO.7 to SEQ ID NO.12, and the primer set B is used for detecting norovirus genogroup II.

[0070] Example 2

[0071] See Figure 1 , this example provides a method for the combined detection of foodborne norovirus based on CRISPR / Cas12b and RT-LAMP. The specific steps are as follows:

[0072] (1) Extract the genomic RNA of the sample to be tested:

[0073] Take artificially contaminated food clams, use a sterile knife to peel off the gills and digestive glands in the visceral mass, weigh 2 g and put it into a 50 ml centrifuge tube, add 1 mL of PBS, mix well, add 10 μL of proteinase K, add norovirus nucleic acid at different concentrations, vortex and mix well, then incubate at 37 °C in a shaker at 320 r / min for 1 h, and then incubate in a water bath at 60 °C for 15 min. Centrifuge at 3000 g for 5 min at room temperature, and take the supernatant for RNA extraction. RNA extraction is carried out using Zymo's RNA extraction kit and operated according to the instructions. Finally, 50 μL of the virus template RNA extraction solution is obtained and stored at -80 °C.

[0074] (2) The specific detection steps are as follows:

[0075] S1. Configure a reaction system based on RT-LAMP and CRISPR / Cas12b in the same reaction tube, add the sample to be tested, and place it in a QPCR instrument for reaction at 55 °C for 40 minutes;

[0076] S2. Judge the result of the reaction: When no increase in the fluorescence signal intensity is observed in the reaction system, the sample to be tested does not contain norovirus.

[0077] The detection of some pathogenic microorganisms in the norovirus one-step detection system was tested. The pathogenic microorganisms include E.Ca (Enterococcus casseliflavus), E.C (Escherichia coli), P.a (Pseudomonas aeruginosa), S.a (Staphylococcus aureus), S.e (Staphylococcus epidermidis), S.Pn (Streptococcus pneumoniae) and S.s (Staphylococcus saprophyticus). At the same time, the detection results of genogroup II in the genogroup I detection system were also tested. The test results of the specific analysis of norovirus genogroup I are as Figure 2 shown. The genogroup I detection system can specifically detect genogroup I samples and has no non-specificity for genogroup II and several other common strains

[0078] The detection limit analysis of norovirus genogroup I was carried out. The X-axis represents the total target copy number used in the one-step detection of genogroup I, and the Y-axis represents the relative fluorescence intensity of each detection result in the one-step detection of genogroup I. The detection limit analysis results of norovirus genogroup I are as Figure 3 shown. The detection limit of this test system for norovirus genogroup I is 25 Copies / μL.

[0079] The detection of some pathogenic microorganisms in the norovirus one-step detection system was tested. The pathogenic microorganisms include E.Ca (Enterococcus casseliflavus), E.C (Escherichia coli), P.a (Pseudomonas aeruginosa), S.a (Staphylococcus aureus), S.e (Staphylococcus epidermidis), S.Pn (Streptococcus pneumoniae), and S.s (Staphylococcus saprophyticus). At the same time, the detection results of genogroup I in the genogroup II detection system were also tested. The test results of the specific analysis of norovirus genogroup II are as Figure 4 shown. The genogroup II detection system can specifically detect genogroup II samples and has no non-specific reaction to genogroup I and several other common strains.

[0080] The detection limit analysis of norovirus genogroup II was carried out. The X-axis represents the total target copy number used in the one-step detection of genogroup II, and the Y-axis represents the relative fluorescence intensity of each detection result in the one-step detection of genogroup II. The detection limit analysis results of norovirus genogroup II are as Figure 5 shown. The detection limit of this test system for norovirus genogroup II is 25 Copies / μL.

[0081] Therefore, the present invention combines the isothermal amplification technology and the CRISPR Cas technology, utilizes the target recognition of the Cas protein, optimizes the reaction system, and improves the problems and deficiencies such as non-specific amplification and high false positive results in the RT-LAMP amplification detection technology used alone. It realizes the rapid, simple, and anti-pollution (one-tube method) detection of norovirus, a foodborne virus, in food. Through this method, it aims to enrich the rapid detection methods of foodborne viruses and provide a new idea and solution for the specific amplification and detection based on nucleic acids.

[0082] The above description of the embodiments is for the convenience of those of ordinary skill in the art to understand and use the invention. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative labor. Therefore, the present invention is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

1. A primer for detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP, characterized in that: The primer combination for detecting foodborne norovirus includes independently packaged primer group A and primer group B; The nucleotide sequences of the primers in group A are shown in SEQ ID NO.1 to SEQ ID NO.6; The nucleotide sequences of the primers in group B are shown in SEQ ID NO.7 to SEQ ID NO.

12.

2. A primer for combined detection of foodborne norovirus based on CRISPR / Cas12b and RT-LAMP according to claim 1, characterized in that: The foodborne norovirus includes norovirus GI type and norovirus GII type. The group A primers are used to detect GI type norovirus, and the group B primers are used to detect GII type norovirus.

3. A kit for detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP, characterized in that: The kit comprises a group A primer, a group B primer and an amplification reaction system for detecting foodborne norovirus as described in claim 1 or claim 2.

4. A kit for detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP according to claim 3, characterized in that: The amplification reaction system is 25 μL, including: 12.5 μL 2×RT-LAMP amplification buffer, 0.2 μL 15U / μL RTX reverse transcriptase, 1 μL 15U / μL BST polymerase, 2.5 μL 10×RT-LAMP primer premix, 1 μL RNA template, 1 μL 10μM AapCas12b, 1 μL 10μM sgRNA, 0.8ul 10μM probe, and 5 μL ddH2O.

5. A kit for detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP according to claim 4, characterized in that: When the primer premix includes a group A primer as shown in SEQ ID NO.1 to SEQ ID NO.6, the sequence of the sgRNA is shown in SEQ ID NO.

13.

6. A kit for detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP according to claim 4, characterized in that: When the primer premix includes group B primers as shown in SEQ ID NO.7 to SEQ ID NO.12, the sequence of the sgRNA is shown in SEQ ID NO.

14.

7. A method for detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP, characterized in that: The specific steps are as follows: The reaction tube is simultaneously configured with a reaction system based on RT-LAMP and CRISPR / Cas12b, and the sample to be tested is added and placed in a QPCR instrument for reaction, and the fluorescence results are observed.

8. The method for detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP according to claim 7, characterized in that: The reaction temperature is 50° C. to 60° C., and the reaction time is 30 to 50 minutes.

9. The method for detecting foodborne norovirus based on CRISPR / Cas12b and RT-LAMP according to claim 7, characterized in that: When no increase in the fluorescence signal intensity is observed in the reaction system, the sample to be tested does not contain foodborne norovirus.

10. Use of the primer according to claim 1 or claim 2 or the kit according to any one of claims 3 to 6 in the preparation of drugs for preventing / treating / diagnosing foodborne norovirus-related diseases.

Images