T-type voltage-gated calcium channel enhancer

Abstract

Described herein are T-type voltage-gated calcium channel enhancers capable of enhancing thalamic function, e.g., reducing thalamic cortex hyperactivity in a patient in need thereof. These enhancers may be useful for many diseases or conditions associated therewith, such as schizophrenia and neurodevelopmental disorders. The CaV enhancers typically have a structure of formula (I) or formula (V). # imgabs0 #

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims the priority and benefit of U.S. Application No. 63 / 402,031, filed on August 29, 2023, which is hereby incorporated by reference in its entirety.

[0003] Statement of Rights to Inventions Made Under Federally Sponsored Research

[0004] This invention was made with government support under Grant No. MH115045 awarded by the National Institutes of Health. The U.S. government has certain rights in this invention.

[0005] Background

[0006] Voltage - gated calcium channels (VGCCs) provide the major pathway for calcium (Ca 2+ ) ions to enter excitable cells by allowing rapid and selective Ca 2+ entry following membrane depolarization. By converting natural voltage transients such as action potentials into intracellular Ca 2+ transients, voltage - gated Ca 2+ channels not only contribute to active membrane properties such as Ca 2+ spiking and dendritic information integration, but also underlie many cellular functions, including neurotransmitter release, neurite growth cone, cell survival, hormone release, and gene expression.

[0007] The functional core of VGCCs is composed of a Ca V α 1 subunit containing an ion pore, a gating mechanism, and a toxin - binding domain, and consists of four homologous transmembrane domains (I - IV), cytoplasmic amino - and carboxy - termini, and intracellular loops connecting each transmembrane domain. Ten genes encode the Ca V α 1 subunits in humans and are divided into three major subgroups (Ca V 1, Ca V 2, and Ca V 3 families) based on structural, functional, and pharmacological similarities.

[0008] Ca V 3 channels are also known as T - type calcium channels (T stands for transient) because they inactivate rapidly. Ca V 3 T - type channels do not interact with auxiliary β subunits, and their biophysical properties can be fully reconstituted in heterologous expression systems with only the α 1 subunit, while Ca V 1 or Ca V 2 Ca 2+ channel α 1 subunits (CaV 1 / 2) Co-expression of the auxiliary β subunit is required to facilitate trafficking of the channel to the plasma membrane for expression. Compared with the Ca V 1 / 2 channel, Ca V 3 T-type currents inactivate and activate at more negative potentials and have a smaller single-channel conductance of 8-12 pS in 100 mM Ba 2+ . In addition, Ca V 3 T-type Ca 2+ channels have overlapping voltage-dependent activation and inactivation curves, thereby displaying a "window current" where most channels are inactivated, but a small fraction of channels remain constitutively open at the physiological resting membrane potential. Compared with the Ca V 1 / 2 family, Ca V 3 T-type channels also close more slowly from the open state, allowing a large amount of Ca 2+ to flow in after repolarization to trigger membrane depolarization. These unique biophysical properties of T-type Ca 2+ channels generate Ca 2+ influx during repolarization, which is the basis for the rhythmic rebound firing of thalamic neurons in the brain.

[0009] Three genes (CACNA1G, CACNA1H, and CACNA1I) encode the three (subtypes) α V subunits of the Ca 1 3 T-type calcium channels (Ca V 3.1, Ca V 3.2, and Ca V 3.3), respectively). Human genetics has shown that these genes are associated with neurological and neuropsychiatric disorders. Rare mutations in CACNA1G (the gene encoding the Ca V 3.1 α 1 subunit) are associated with severe developmental defects, which are associated with, for example, spinocerebellar ataxia, idiopathic generalized epilepsy, and cerebellar atrophy. Patients with loss-of-function mutations in CACNA1H have been found to be resistant to pain perception, providing a biological basis for blocking Ca V 3.2 for the treatment of pain.

[0010] A variety of clinical drugs have been found to block T-type Ca 2+Channels include the anti - hypertensive mibefradil (which was withdrawn from the market due to potential off - target drug - drug interactions), certain neuroleptics, and anticonvulsants. However, existing T - type inhibitor drugs do not have subtype selectivity within the Cav3 family. In addition, only one chemical series represented by the compound SAK3 (ethyl 8'-methyl - 2',4 - dioxo - 2-(piperidin - 1 - yl)-2'H - spiro[cyclopentane - 1,3'-imidazo[1,2 - a]pyridine]-2 - ene - 3 - carboxylate) has been reported as a so - called Ca V 3.3 enhancer. However, activation of Ca V 3.3 by SAK3 was not measured in electrophysiological assays in a fluorescence imaging plate reader (FLIPR) and HEK cells.

[0011] The urgent need to identify enhancers has not been resolved, and there is also no association between Ca V (particularly Ca V 3.3 enhancement caused by drug administration) and the therapeutic benefits of treating diseases, disorders, or conditions associated with these mutations.

[0012] Overview

[0013] For the foregoing and other purposes, the present disclosure provides compounds that enhance T - type voltage - gated calcium channels and particularly Ca V 3.3 T - type voltage - gated calcium channels. The evidence provided by the present disclosure demonstrates that administration of a Ca V 3.3 enhancer (e.g., a Ca V 3.3 enhancer of the present disclosure) has an impact on disease states and can be used to provide therapeutic treatment to subjects in need thereof. In certain embodiments, the compounds of the present disclosure selectively enhance the Ca V 3.3 T - type voltage - gated calcium channel, e.g., the α.1.I subunit and / or accessory subunits. In certain embodiments, the compounds of the present disclosure enhance the T - type voltage - gated calcium channels Ca V 3.1 and Ca V 3.3. In various embodiments, the compounds of the present disclosure do not affect the Ca V 3.2 channel (e.g., with an EC V for Ca 50 3.2 greater than 20 μM, and do not increase the current amplitude of Ca V 3.2), but provide alterations to Ca V 3.1 and Ca V 3.3.

[0014] The Ca V 3.3 enhancers of the present disclosure comprise compounds having a structure of formula (I) or a pharmaceutically acceptable salt thereof:

[0015]

[0016] wherein the dashed circle represents an optionally unsaturated (e.g., aromatic) ring;

[0017] p is 0 or 1;

[0018] m is 0, 1, 2, 3 or 4;

[0019] n is 0, 1, 2, 3 or 4;

[0020] X A1 is N, O or C;

[0021] X A2 is N or C;

[0022] X A3 is N or CR A3 ;

[0023] R A1 is, independently at each occurrence, absent, hydrogen, alkyl (e.g., optionally unsaturated C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), -C(O)OR, -C(O)R, haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl), hydroxy or amino (e.g., -NRR); and two R A1 can together form =O or a 3- to 6-membered spiro ring; wherein R A1 can, independently at each occurrence, have one or more (e.g., two, three, four) optional substitution points;

[0024] R A2 is, independently at each occurrence, hydrogen and alkyl (e.g., optionally unsaturated C 1 -C 8Alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ); where any two geminal R A2 groups can together form =O or a 3- to 6-membered spiro ring; where R A2 can independently have one or more (e.g., two, three, four) optional substitution points at each occurrence;

[0025] R A3 is independently at each occurrence hydrogen, alkyl (e.g., optionally unsaturated C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), alkoxy (e.g., C 1 -C 8 alkoxy, lower alkoxy such as C 1 -C 4 alkoxy, methoxy, alkoxy substituted by, for example, aryl, such as benzyloxy), cyano, -C(O)OR, -C(O)R or halogen (e.g., F, Cl, Br); where R A3 can independently have one or more (e.g., two, three, four) optional substitution points at each occurrence;

[0026] R L is -S(=O) 2 -, -S(=O)-, -S(=NR)(=O)- or -C(R)(R)-;

[0027] X B1 is N, S or CR B1 , and one X B1 can be absent (e.g., two adjacent groups are connected by a bond such as a single bond or a double bond to optionally retain aromaticity);

[0028] X B2 is independently N or CR B2 ;

[0029] R B1 is independently selected from hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), haloalkyl (e.g., C 1 -C8 Halogenated alkyl, lower halogenated alkyl such as C 1 -C 4 Halogenated alkyl, halogenated methyl, C 1 -C 8 Fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 Fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 Perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 Perfluoroalkyl, perfluoromethyl), halogen (e.g., F, Cl, Br) and -R C ; wherein R B1 may independently have one or more (e.g., two, three, four) optional substitution points at each occurrence;

[0030] R B2 is independently selected from hydrogen, alkyl (e.g., optionally unsaturated and optionally substituted C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), halogenated alkyl (e.g., C 1 -C 8 halogenated alkyl, lower halogenated alkyl such as C 1 -C 4 halogenated alkyl, halogenated methyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl), halogen (e.g., F, Cl, Br) and -R C ; wherein R B2 may independently have one or more (e.g., two, three, four) optional substitution points at each occurrence; and

[0031] R B1 or R B2 at least one of which is a group -R having the following structure C :

[0032]

[0033] wherein Indicates the point of attachment to the compound, and the dashed circle indicates an optional aromaticity;

[0034] X C6 is C, CH, CR or N;

[0035] X C1 , X C2 , X C3 , X C4 and X C5 are independently CH, CR, N, NH, NR, O or S; and when the group is a 5-membered ring, X C5 is absent; and

[0036] R C1 , R C2 , R C3 , R C4 and R C5 are independently hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), -C(O)R, -C(O)NRR, halogen (e.g., F, Cl, Br), haloalkyl haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl) or cycloalkyl (e.g., C 3 -C 8 cycloalkyl, C 3 -C 6 cycloalkyl); or may form oxo (=O) together with the R group; where R C1 , R C2 , R C3 , R C4 and R C5 may independently have one or more (e.g., two, three, four) optional substitution points; and

[0037] R is independently hydrogen or alkyl (e.g., C1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ).

[0038] In certain embodiments, R (such as when R L is -S(=NR)(=O)-) can be hydrogen or lower alkyl (e.g., C 1 -C 4 alkyl) such as methyl.

[0039] The present disclosure also includes compounds in which the bicyclic ring system of formula (I) has been opened to form a sulfonamide, where the N geminal amino groups do not together form a ring. These sulfonamides have also been shown to be Ca V 3.3 enhancers. For example, the compounds of the present disclosure include those having the structure of formula (V) or a pharmaceutically acceptable salt thereof:

[0040]

[0041] wherein R D1 is hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 )), haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl), monocyclic or bicyclic heterocyclic group, monocyclic or bicyclic heteroaryl or aryl, and R D1 can have one or more (e.g., two, three, four) optional substitution sites (and R D1 can be optionally substituted and any two geminal or vicinal substituents can optionally form a 5- or 6-membered ring);

[0042] R D2 is hydrogen or alkyl (e.g., C 1-C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ) and R D2 may have one or more (e.g., two, three, four) optional substitution points;

[0043] X B1 is independently N or CR B1 ;

[0044] R B1 is independently selected from hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), and -R C and R B1 may have one or more (e.g., two, three, four) optional substitution points;

[0045] R B2 is independently selected from hydrogen, optionally unsaturated alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), and -R C and R B2 may have one or more (e.g., two, three, four) optional substitution points; and

[0046] R B1 or R B2 at least one of which is a group -R C :

[0047]

[0048] wherein indicates the point of attachment to the compound, and the dashed circle indicates optional aromaticity;

[0049] XC 6 is C, CH, CR or N;

[0050] X C1 、X C2 、X C3 、X C4 and X C5is independently CH, CR, N, NH, NR, O or S; and when the group is a 5-membered ring, X C5 is absent; and

[0051] R C1 、R C2 、R C3 、R C4 and R C5 are independently hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), -C(O)R, -C(O)NRR, halogen (e.g., F, Cl, O), haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl) or cycloalkyl (e.g., C 3 -C 8 cycloalkyl, C 3 -C 6 cycloalkyl); or may together with the vicinal R groups form oxo (=O), where R C1 、R C2 、R C3 、R C4 and R C5 may independently have one or more (e.g., two, three, four) optional substitution sites; and

[0052] R is independently hydrogen or alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ).

[0053] The present disclosure also provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and a compound disclosed herein (e.g., Ca V3.3 enhancer, a compound having the structure of formula (I), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (IIi), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa), (IVb), (V), (Va), (Vb), (Vc), (Vd), (Ve), (Vf), (Vg), (Vh), (Vi), (Vj), compound 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, one or more of compound 1-69, 71-172, 174-176 and 179-255) or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

[0054] Also provided are methods of using these compounds. For example, methods of increasing sleep spindles or rescuing sleep spindle defects in a subject in need thereof are provided, which may include administering Ca to the subject V 3.3 enhancer (e.g., various Ca V3.3 Enhancer, a compound having a structure of formula (I), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (IIi), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa), (IVb), (V), (Va), (Vb), (Vc), (Vd), (Ve), (Vf), (Vg), (Vh), (Vi), (Vj), one or more of compounds 1 - 69, 71 - 172, 174 - 176, 179 - 265, 269 - 285, 287 - 288, 290 - 291, 293 - 295, 297 - 298, 300 - 301, 305, 307, 312, 314 - 321, 324 - 325, 327 - 340, 342 - 343, 345, 348 - 357, 360 - 362, 364 - 375, 377 - 378, 380 - 392, 395 - 396, 398 - 423, 425 - 435, 438 - 439, 441 - 446, 448, 450, 452 - 456, 458, 460, 462 - 463, 465 - 466, 468 - 469, 473 - 481, 483 - 492, 494, 496 - 497, 499 - 505, 508 - 509, 512 - 515, 518 - 520, 522 - 523, 525 - 529, 532 - 541, 543 - 551, 553 - 558, 560 - 570, 573 - 575, 577 - 583, 585 and 587 - 596, one or more of compounds 1 - 69, 71 - 172, 174 - 176 and 179 - 255). In certain embodiments, the subject is a human. In certain embodiments, the subject has schizophrenia.

[0055] A method for reducing hyperthalamocortical activity and / or increasing hypothalamocortical activity in a subject in need thereof comprises administering Ca to the subject V 3.3 Enhancer (e.g., a variety of Ca V3.3 Enhancer, a compound having a structure of formula (I), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (IIi), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa), (IVb), (V), (Va), (Vb), (Vc), (Vd), (Ve), (Vf), (Vg), (Vh), (Vi), (Vj), one or more of compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, one or more of compounds 1-69, 71-172, 174-176 and 179-255). In certain embodiments, the subject is a human. In certain embodiments, the subject has schizophrenia. Without wishing to be bound by theory, excessive and / or hypoactive thalamocortical activity in different regions of the subject's brain may be related to altered rebound bursts in the thalamic reticular nucleus (TRN). Normalizing TRN function can independently enhance such excessive and / or hypoactive activity (depending on location) in the subject and slow the progression of the disease, disorder or condition. For example, a method of increasing rebound bursts in the thalamic reticular nucleus (TRN) of a subject in need thereof includes administering Ca V3.3 Enhancer. In embodiments, such administration results in a reduction of thalamocortical hyperactivity in brain regions with such hyperactivity. In certain embodiments, the subject is a human. In certain embodiments, the subject has schizophrenia. In certain embodiments, the subject has a neurodevelopmental disorder or a condition associated therewith. In certain embodiments, the subject has a reticular thalamus (TRN) hypofunction or a condition associated therewith related to aging or neurodegeneration in a subject in need thereof, including administering Ca to the subject V 3.3 Enhancer. In certain embodiments, administering the compound can rescue cognitive and / or motor deficits (e.g., associated with a neurodevelopmental disorder).

[0056] A method of improving cognitive function in a subject in need thereof can include administering Ca to the subject V 3.3 Enhancer (e.g., one or more of various Ca V 3.3 Enhancer, compounds having the structures of formula (I), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (IIi), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa), (IVb), (V), (Va), (Vb), (Vc), (Vd), (Ve), (Vf), (Vg), (Vh), (Vi), (Vj), compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, one or more of compounds 1-69, 71-172, 174-176 and 179-255), wherein the Ca VThe 3.3 enhancer is a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing. In certain embodiments, the subject has a brain dysfunction such as that caused by cerebrovascular disease, brain injury, brain tumor, viral encephalitis, hypoxic encephalopathy, or alcoholism. In various embodiments, the subject has a cognitive dysfunction. In certain aspects, the cognitive dysfunction is selected from memory impairment, attention deficit, executive function deficit, social behavior disorder, neurodegenerative disease, mental illness, or pervasive developmental disorder.

[0057] In various embodiments, the subject has a Ca V 3.3 mutation. For example, the subject can be human and the Ca V 3.3 mutation is the R1346H mutation. In certain embodiments, the subject is a mouse and the CaV3.3 mutation is the R1305H mutation. In certain embodiments, the Ca V 3.3 mutation is homozygous or heterozygous in the subject.

[0058] The present disclosure also provides methods of treating or preventing schizophrenia, neurodevelopmental disorders, reticular thalamic (TRN) hypofunction (e.g., associated with aging or neurodegeneration) or a related condition (e.g., cognitive deficits) in a subject in need thereof, comprising administering to the subject a Ca V 3.3 enhancer (e.g., a plurality of Ca V3.3 Potentiators, compounds having the structure of formula (I), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (IIi), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa), (IVb), (V), (Va), (Vb), (Vc), (Vd), (Ve), (Vf), (Vg), (Vh), (Vi), (Vj), compound 1 - 69, 71 - 172, 174 - 176, 179 - 265, 269 - 285, 287 - 288, 290 - 291, 293 - 295, 297 - 298, 300 - 301, 305, 307, 312, 314 - 321, 324 - 325, 327 - 340, 342 - 343, 345, 348 - 357, 360 - 362, 364 - 375, 377 - 378, 380 - 392, 395 - 396, 398 - 423, 425 - 435, 438 - 439, 441 - 446, 448, 450, 452 - 456, 458, 460, 462 - 463, 465 - 466, 468 - 469, 473 - 481, 483 - 492, 494, 496 - 497, 499 - 505, 508 - 509, 512 - 515, 518 - 520, 522 - 523, 525 - 529, 532 - 541, 543 - 551, 553 - 558, 560 - 570, 573 - 575, 577 - 583, 585 and 587 - 596, one or more of compound 1 - 69, 71 - 172, 174 - 176 and 179 - 255). Examples of diseases include schizophrenia or related conditions or disorders such as cognitive deficits, reduced sleep spindles, reduced TRN function or thalamocortical hyperactivity and combinations thereof. In certain embodiments, the disorder can be a neurodevelopmental disorder such as autism spectrum disorder (ASD), schizophrenia, attention deficit hyperactivity disorder (ADHD), schizoaffective disorder and bipolar disorder. In certain embodiments, the disease can be a neurodegenerative disease such as Alzheimer's disease. For example, Alzheimer's disease has been shown to have reduced sleep spindles, and the compounds of the present disclosure can provide specific benefits to patients with Alzheimer's disease (or related disorders or conditions).

[0059] Also provided are methods for monitoring target engagement and / or therapeutic efficacy in a subject, comprising:

[0060] a) Measuring the spindle wave density and / or amplitude in the subject to establish a baseline;

[0061] b) Administer a compound to the subject;

[0062] c) Measure the spindle wave density and / or amplitude after the administration step;

[0063] wherein the comparison of the spindle wave density and / or amplitude with the baseline after the administration step is used to monitor target engagement and / or therapeutic efficacy. In various embodiments, the compound is Ca V3.3 Enhancers (e.g., compounds having the structures of formula (I), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (IIi), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa), (IVb), (V), (Va), (Vb), (Vc), (Vd), (Ve), (Vf), (Vg), (Vh), (Vi), (Vj), compounds 1 - 69, 71 - 172, 174 - 176, 179 - 265, 269 - 285, 287 - 288, 290 - 291, 293 - 295, 297 - 298, 300 - 301, 305, 307, 312, 314 - 321, 324 - 325, 327 - 340, 342 - 343, 345, 348 - 357, 360 - 362, 364 - 375, 377 - 378, 380 - 392, 395 - 396, 398 - 423, 425 - 435, 438 - 439, 441 - 446, 448, 450, 452 - 456, 458, 460, 462 - 463, 465 - 466, 468 - 469, 473 - 481, 483 - 492, 494, 496 - 497, 499 - 505, 508 - 509, 512 - 515, 518 - 520, 522 - 523, 525 - 529, 532 - 541, 543 - 551, 553 - 558, 560 - 570, 573 - 575, 577 - 583, 585 and 587 - 596, one or more of compounds 1 - 69, 71 - 172, 174 - 176 and 179 - 255). In certain embodiments, the sleep spindle density is the density of slow sleep spindles (e.g., 9 - 12 Hz). In various embodiments, the sleep spindle density is the density of fast sleep spindles (e.g., 13 - 15 Hz). In certain embodiments, the subject has a brain dysfunction such as a brain dysfunction caused by cerebrovascular disease, brain injury, brain tumor, viral encephalitis, hypoxic encephalopathy or alcoholism. In various embodiments, the subject has a cognitive dysfunction. In certain aspects, the cognitive dysfunction is selected from memory disorder, attention deficit, executive function deficit, social behavior disorder, neurodegenerative disease, mental illness or pervasive developmental disorder. In certain embodiments, the subject has an autism spectrum disorder (ASD), schizophrenia, attention deficit hyperactivity disorder (ADHD), schizoaffective disorder, bipolar disorder or Alzheimer's disease.

[0064] Definition

[0065] Unless otherwise provided, all terms used herein are intended to have their ordinary meaning in the art. Unless otherwise defined, all concentrations are weight percentages of the specific component relative to the total weight of the local composition.

[0066] As used herein, "a" or "an" shall mean one or more. As used herein, when used in conjunction with the word "comprising", the word "a" or "an" means one or more than one. As used herein, "another" means at least a second or more. Unless specifically stated or obvious from the context, the term "or" used herein is understood to be inclusive.

[0067] All numerical ranges used herein include the endpoints and all possible values disclosed between the disclosed values. The exact values of all semi-integer numerical values are also considered to be specifically disclosed and as the limits of all subsets of the disclosed ranges. For example, the range of 0.1% to 3% specifically discloses the percentages of 0.1%, 1%, 1.5%, 2.0%, 2.5% and 3%. In addition, the range of 0.1 to 3% includes subsets of the original range, including 0.5% to 2.5%, 1% to 3%, or 0.1% to 2.5%. It should be understood that the sum of all weight % of each component will not exceed 100%.

[0068] Throughout this specification, various components may be identified as having specific values or parameters, however, these items are provided as exemplary embodiments. In fact, the exemplary embodiments do not limit the various aspects and concepts of the present disclosure, because many comparable parameters, sizes, ranges and / or values can be achieved. Unless otherwise indicated, the terms "first", "second", etc., "primary", "secondary", etc. do not denote any order, quantity or importance, but are used to distinguish one element from another.

[0069] "Agent" means a small compound, polypeptide or polynucleotide.

[0070] "Improve" means to reduce, inhibit, attenuate, decrease, prevent or stabilize the development or progression of a disease.

[0071] "Consisting essentially of" means that the composition only includes the listed components and the normal impurities present in the commercial material and any other additives, and the other additives are present at a level that does not affect the operation of the present disclosure, for example, at a level of less than 5 wt% or less than 1 wt% or even 0.5 wt%.

[0072] "Disease" refers to any condition or disorder that impairs or interferes with the normal function of cells, tissues, or organs. Examples of diseases include schizophrenia or related conditions or disorders such as cognitive deficits, reduced sleep spindles, decreased TRN function, or thalamocortical hyperactivity and combinations thereof. In certain embodiments, the disorder can be a neurodevelopmental disorder such as an autism spectrum disorder (ASD), schizophrenia, attention deficit hyperactivity disorder (ADHD), schizoaffective disorder, and bipolar disorder. In certain embodiments, the disease can be a neurodegenerative disease such as Alzheimer's disease. For example, Alzheimer's disease has been shown to have reduced sleep spindles, and the compounds of the present disclosure can provide specific benefits to patients with Alzheimer's disease (or related disorders or conditions).

[0073] The term "effective amount" or "therapeutically effective amount" of a pharmaceutical agent refers to the amount of the pharmaceutical agent (e.g., the compounds described herein) required to ameliorate the symptoms of a disease relative to an untreated patient. The effective amount of the active compound used to practice the invention for the therapeutic treatment of a disease varies according to the mode of administration, the age, weight and general health of the subject. Ultimately, the attending physician or veterinarian will determine the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount. The pharmaceutical agents described herein include compounds having the structures of formula (I), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (IIi), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa), (IVb), (V), (Va), (Vb), (Vc), (Vd), (Ve), (Vf), (Vg), (Vh), (Vi), (Vj), compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, one or more of compounds 1-69, 71-172, 174-176 and 179-255). In certain embodiments, the compounds are administered in an effective amount to treat a disease, disorder or condition.

[0074] As used herein, the term "pharmaceutical composition" refers to a composition containing a compound described herein formulated together with a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition is manufactured or sold under the approval of a government regulatory agency as part of a treatment regimen for treating a mammalian disease. The pharmaceutical composition can be formulated, for example, for oral administration in unit dosage forms (e.g., tablets, capsules, caplets, gel caps); for topical administration (e.g., as a cream, gel, lotion or ointment); for intravenous administration (e.g., as a sterile solution free of particulate embolisms and in a solvent system suitable for intravenous use); or any other formulation described herein (see below).

[0075] The phrase "pharmaceutically acceptable" as used herein indicates that, at the levels employed, the components are generally safe for ingestion or for contact with biological tissues. Pharmaceutically acceptable is used interchangeably with physiologically compatible. It should be understood that the pharmaceutical compositions of the present disclosure include nutritional compositions (e.g., dietary supplements), unless otherwise indicated.

[0076] "Reference" refers to a standard or control condition. In one embodiment, the reference is an untreated control cell or animal. In another embodiment, the effect of an agent on a cell or animal is compared to the same animal at an earlier time point or prior to treatment. This earlier time point or the time prior to treatment is considered the reference.

[0077] The ranges provided herein are to be understood as shorthand for all values within the range (including the endpoints of the range). For example, a range of 1 to 50 is to be understood as including any number, combination of numbers, or sub-range from the set consisting of: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

[0078] The term "treat" and the like as used herein means to alleviate or ameliorate a disorder and / or its associated symptoms. It should be understood that, although not excluded, treating a disorder or condition does not require complete elimination of the disorder, condition, or its associated symptoms.

[0079] "Subject" refers to a mammal, including, but not limited to, a human or non-human mammal such as a bovine, equine, canine, ovine, or feline. Typical subjects include any animal (e.g., a mammal such as a mouse, rat, rabbit, non-human primate, and human). A subject in need is typically a subject in need of treatment for a disease, disorder, or condition described herein. For example, a subject in need may be seeking or in need of treatment, undergoing treatment, may receive treatment in the future, or is a human or animal receiving care from a trained professional for a particular disease, disorder, or condition.

[0080] The term "substituent" refers to a group that is "substituted" on a hydrocarbon, e.g., an alkyl group that replaces one or more atoms (e.g., a substitution point), including a hydrogen atom, at any atom of the group. In some aspects, substituents on a group are independently any one atom or group of atoms, or any combination of two or more groups of atoms, that are permissible as described for the substituent. In another aspect, a substituent itself may be substituted by any one of the substituents described herein. Substituents may be located on the side of a hydrocarbon chain.

[0081] In addition, the phrase "substituted with" as used herein means that a specified group may be substituted with one or more substituents in any combination described in this application. For example, in the case of a group (such as an alkyl or heteroaryl group) "substituted with an unsubstituted C 1 -C 20 alkyl or an unsubstituted C2-20 heteroalkyl", the group may contain one or more unsubstituted C 1 -C 20 alkyls and / or one or more unsubstituted C2-20 heteroalkyls. In addition, in the case of a moiety substituted with an R substituent, the group may be referred to as "R-substituted". In the case of a moiety being R-substituted, the moiety is substituted with at least one R substituent, and each R substituent is optionally different (e.g., R may independently be selected from C 1 -C 10 alkyl or C 1 -C 10 heteroalkyl, where each may optionally contain one or more substitution points).

[0082] Unless specifically stated or obvious from context, the term "about" as used herein is understood to be within the range typically tolerated in the art, e.g., within 2 standard deviations of the mean. About can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term "about".

[0083] “Ca V 3.3 polypeptide” refers to a protein or a fragment thereof that has at least about 85% amino acid sequence identity with NCBI reference sequence NP_066919.2 and has voltage-dependent T-type calcium channel subunit α-1 activity. Ca V 3.3 polypeptide is a member of the calcium channel subfamily, known as the low-voltage activated T-type calcium channel. Compared with other T-type calcium channels, Ca V 3.3 protein is typically characterized by slower activation and inactivation. Exemplary Ca V 3.3 amino acid sequence is as follows:

[0084] 1 maesasppss saaapaaepg vtteqpgprs ppssppglee pldgadphvp hpdlapiaff

[0085] 61 clrqttsprn wcikmvcnpw fecvsmlvil lncvtlgmyq pcddmdclsd rckilqvfdd

[0086] 121 fififfamem vlkmvalgif gkkcylgdtw nrldffivma gmveysldlq ninlsairtv

[0087] 181 rvlrplkain rvpsmrilvn llldtlpmlg nvlllcffvf fifgiigvql wagllrnrcf

[0088] 241 leenftiqgd valppyyqpe eddempfics lsgdngimgc heipplkeqg recclskddv

[0089] 301 ydfgagrqdl nasglcvnwn ryynvcrtgs anphkgainf dnigyawivi fqvitlegwv

[0090] 361 eimyyvmdah sfynfiyfil liivgsffminlclvviatq fsetkqrehr lmleqrqryl

[0091] 421 ssstvasyae pgdcyeeifq yvchilrkak rralglyqal qsrrqalgpe apapakpgph

[0092] 481 akeprhyhgk tkgqgdegrh lgsrhcqtlh gpaspgndhs grelcpqhsp ldatphtlvq

[0093] 541 pipatlasdp ascpccqhed grrpsglgst dsgqegsgsg ssaggedead gdgarssedg

[0094] 601 asselgkeee eeeqadgavw lcgdvwretr aklrgivdsk yfnrgimmai lvntvsmgie

[0095] 661 hheqpeeltn ileicnvvft smfalemilk laafglfdyl rnpynifdsiiviisiweiv

[0096] 721 gqadgglsvl rtfrllrvlk lvrfmpalrr qlvvlmktmd nvatfcmllm lfififsilg

[0097] 781 mhifgckfsl rtdtgdtvpd rknfdsllwa ivtvfqiltq edwnvvlyng mastspwasl

[0098] 841 yfvalmtfgn yvlfnllvai lvegfqaegd anrsysdedq sssnieefdk lqegldssgd

[0099] 901 pklcpipmtp nghldpslpl gghlgpagaa gpaprlslqp dpmlvalgsr kssvmslgrm

[0100] 961 sydqrslsss rssyygpwgr saawasrrss wnslkhkpps aehesllsae rgggarvcev

[0101] 1021 aadegppraa plhtphahhi hhgphlahrh rhhrrtlsld nrdsvdlaelvpavgahpra

[0102] 1081 awraagpapg hedcngrmps iakdvftkmg drgdrgedee eidytlcfrvrkmidvykpd

[0103] 1141 wcevredwsv ylfspenrfr vlcqtiiahk lfdyvvlafi flncitialerpqieagste

[0104] 1201 rifltvsnyi ftaifvgemt lkvvslglyf geqaylrssw nvldgflvfvsiidivvsla

[0105] 1261 saggakilgv lrvlrllrtl rplrvisrap glklvvetli sslkpignivliccaffiif

[0106] 1321 gilgvqlfkg kfyhclgvdt rnitnrsdcm aanyrwvhhk ynfdnlgqalmslfvlaskd

[0107] 1381 gwvnimyngl davavdqqpv tnhnpwmlly fisfllivsf fvlnmfvgvvvenfhkcrqh

[0108] 1441 qeaeearrre ekrlrrlekk rrkaqrlpyy atychtrlli hsmctshyldifitfiicln

[0109] 1501 vvtmslehyn qptsletalk ycnymfttvf vleavlklva fglrrffkdrwnqldlaivl

[0110] 1561 lsvmgitlee ieinaalpin ptiirimrvl riarvlkllk matgmralldtvvqalpqvg

[0111] 1621 nlgllfmllf fiyaalgvel fgklvcnden pcegmsrhat fenfgmafltlfqvstgdnw

[0112] 1681 ngimkdtlrd cthderscls slqfvsplyf vsfvltaqfv linvvvavlmkhlddsnkea

[0113] 1741 qedaemdael elemahglgp gprlptgspg apgrgpggag gggdtegglcrrcyspaqen

[0114] 1801 lwldsvslii kdslegeltiidnlsgsifh hysspagckk chhdkqevql aeteafslns

[0115] 1861 drsssillgd dlsledptac ppgrkdskge ldppepmrvg dlgecffplsstavspdpen

[0116] 1921 flcemeeipf npvrswlkhd ssqappspfs pdasspllpm paeffhpavsasqkgpekgt

[0117] 1981 gtgtlpkial qgswaslrsp rvnctllrqa tgsdtsldas psssagslqttledsltlsd

[0118] 2041 sprralgppa papgpragls paarrrlslr grglfslrgl rahqrshssggstspgcthh

[0119] 2101 dsmdpsdeeg rggaggggag sehsetlssl sltslfcppp pppapgltparkfsstssla

[0120] 2161 apgrphaaal ahglarspsw aadrskdppg raplpmglgp lapppqplpgelepgdaask

[0121] 2221 rkr

[0122] Ca V3.3 The polypeptide can be a protein having at least about 85% amino acid sequence identity with NCBI reference sequence NP_001037773.2 or a fragment thereof, which is the voltage-dependent T-type calcium channel subunit α-1 of Mus musculus. Another exemplary Ca V 3.3 The protein sequence is:

[0123] 1 madsnlppss saapdpepgi teqpgprspp psppgleepl dgtnpdvphp dlapvaffcl

[0124] 61 rqttsprnwc ikmvcnpwfe cvsmlvilln cvtlgmyqpc ddmeclsdrc kilqvfddfi

[0125] 121 fiffamemvl kmvalgifgk kcylgdtwnr ldffivmagm veysldlqni nlsairtvrv

[0126] 181 lrplkainrv psmrilvnll ldtlpmlgnv lllcffvffi fgiigvqlwa gllrnrcfle

[0127] 241 enftiqgdva lppyyqpeed dempficsls gdngimgche ipplkeqgre cclskddmyd

[0128] 301 fgagrqdlna sglcvnwnry ynvcrtgnan phkgainfdn igyawivifq vitlegwvei

[0129] 361myyvmdahsf ynfiyfilliivgsffminl clvviatqfs etkqrehrlm leqrqrylss

[0130] 421 stvasyaepg dcyeeifqyv chilrkakrr alglyqalqn rrqatgpgtp apakpgphak

[0131] 481 epshcklcpr hspldttpht lvqpisaila sdpsscprcq heagrrpsgl gstdsgqegs

[0132] 541 gsggsaeaea ngdgpqssed gvssglgkee eqedgaarlc gdvwretrak lrgivdskyf

[0133] 601 nrgimmailv ntvsmgiehh eqpeeltnil eicnvvftsm falemilkla afglfdylrn

[0134] 661 pynifdsiiv iisiweivgq adgglsvlrt frllrvlklv rfmpalrrql vvlmktmdnv

[0135] 721 atfcmllmlf ififsilgmh ifgckfslrt dtgdtvpdrk nfdsllwaiv tvfqiltqed

[0136] 781 wnvvlyngma sttpwaslyf valmtfgnyv lfnllvailv egfqaegdan rsysdedqss

[0137] 841 snleeldklp egldssrdlk lcpipmtpng hldpslplgg hlgpagamga aprlslqpdp

[0138] 901 vlvalesrks svmslgrmsy dqrslsssrs syygpwgrsg twasrrsswn slkhkppsae

[0139] 961 hesllsgerg gscvracega redappraap lhaphthhah hgphlahrhr hhrrtlsldt

[0140] 1021 rdsvdlaelv pvvgahsraa wraagqapgh edcngrmpni akdvftkmddrrdrgedeee

[0141] 1081 idytlcfrvr kmidvykpdw cevredwsvy lfspenkfri lcqtiiahklfdyvvlafif

[0142] 1141 Initial register ifltvsnyif taifvgemtl kvvslglyfgeqaylrsswn

[0143] 1201 vldgflvfvs iidivvsvas aggakilgvl rvlrllrtlr plrvisrapglklvvetlis

[0144] 1261 slkpignivl iccaffiifg ilgvqlfkgk fyhclgvdtr nitnrsdcvaanyrwvhhky

[0145] 1321 nfdnlgqalm slfvlaskdg wvnimyngld avavdqqpvt nhnpwmllyfisfllivsff

[0146] 1381 vlnmfvgvvv enfhkcrqhq eaeearrree krlrrlekkr rkaqrlpyyatycptrllih

[0147] 1441 smctshyldi fitfiiclnv vtmslehynq ptsletalky cnymfttvfvleavlklvaf

[0148] 1501 glrrffkdrw nqldlaivll svmgitleei einaalpinp tiirimrvlriarvlkllkm

[0149] 1561 atgmralldt vvqalpqvgn lgllfmllff iyaalgvelf gklvcndenpcegmsrhatf

[0150] 1621 enfgmafltl fqvstgdnwn gimkdtlrdc thdersclss lqfvsplyfvsfvltaqfvl

[0151] 1681 invvvavlmk hlddsnkeaq edaemdaeie lemahglgpg pgpcpcpcpcpcpcpcpgpr

[0152] 1741 mptsspgapg rgsggagvgg dteshlcrhc yspaqetlwl dsvsliikdslegeltiidn

[0153] 1801 lsgsifhhys spagcdkchh dkqevqlaet eafslnsdrs ssvllgddlsledptacpqg

[0154] 1861 pkeskgelep pepmqagdld ecffpfagep vsagpesllc emgaipfnpvqswlkhesnq

[0155] 1921 appspfspdg sspllqmpae ffhpavsasq kgqepgmssg tlpkialqgswaslrspsvn

[0156] 1981 ctllrqatvs dtsldaspss sagslqttledsltlsdspr ralgppvqvp gpraslspat

[0157] 2041 rrrlslrgrg lfslrglrah qrshssggst spgctyhdsm dpsdeegrggaggggagseh

[0158] 2101 setlsslslt slfclpptlp ppgltparkf sstsslaagp grpgatvsvrglarspswaa

[0159] 2161 drskdppgqa qlasgfgssa pepqpppges tdaaskrkr

[0160] "CACNA1I polynucleotide" refers to a polynucleotide encoding Ca V 3.3 polypeptide. The NCBI accession number NM_021096 provides an exemplary CACNA1I polynucleotide sequence, namely the mRNA sequence of the calcium voltage-gated channel subunit alpha1I of Homo sapiens, which is reproduced as follows:

[0161] 1 atggctgaga gcgcctcccc gccctcctca tctgcagcag ccccagccgc tgagccagga

[0162] 61 gtcaccacgg agcagcccgg accccggagc cccccatcct ccccgccagg cctggaggag

[0163] 121 cctctggatg gagctgatcc tcatgtccca cacccagacc tggcgcctat tgccttcttc

[0164] 181 tgcctgcgac agaccaccag cccccggaac tggtgcatca agatggtgtg caacccgtgg

[0165] 241 tttgaatgtg tcagcatgct ggtgatcctg ctgaactgcg tgacacttgg catgtaccag

[0166] 301 ccgtgcgacg acatggactg cctgtccgac cgctgcaaga tcctgcaggt ctttgatgac

[0167] 361 ttcatcttta tcttctttgc catggagatg gtgctcaaga tggtggccct ggggattttt

[0168] 421 ggcaagaagt gctacctcgg ggacacatgg aaccgcctgg atttcttcat cgtcatggca

[0169] 481 gggatggtcg agtactccct ggaccttcag aacatcaacc tgtcagccat ccgcaccgtg

[0170] 541 cgcgtcctga ggcccctcaa agccatcaac cgcgtgccca gtatgcggat cctggtgaac

[0171] 601 ctgctcctgg acacactgcc catgctgggg aatgtcctgc tgctctgctt ctttgtcttc

[0172] 661 ttcatctttg gcatcatagg tgtgcagctc tgggcgggcc tgctgcgtaa ccgctgcttc

[0173] 721 ctggaggaga acttcaccat acaaggggat gtggccttgc ccccatacta ccagccggag

[0174] 781 gaggatgatg agatgccctt catctgctcc ctgtcgggcg acaatgggat aatgggctgc

[0175] 841 catgagatcc ccccgctcaa ggagcagggc cgtgagtgct gcctgtccaa ggacgacgtc

[0176] 901 tacgactttg gggcggggcg ccaggacctc aatgccagcg gcctctgtgt caactggaac

[0177] 961 cgttactaca atgtgtgccg cacgggcagc gccaaccccc acaagggtgc catcaacttt

[0178] 1021 gacaacatcg gttatgcttg gattgtcatc ttccaggtga tcactctggaaggctgggtg

[0179] 1081 gagatcatgt actacgtgat ggatgctcac tccttctaca acttcatctacttcatcctg

[0180] 1141 cttatcatag tgggctcctt cttcatgatc aacctgtgcc tcgttgtcatagcgacccag

[0181] 1201 ttctcggaga ccaagcaacg ggagcaccgg ctgatgctgg agcagcggcagcgctacctg

[0182] 1261 tcctccagca cggtggccag ctacgccgag cctggcgact gctacgaggagatcttccag

[0183] 1321 tatgtctgcc acatcctgcg caaggccaag cgccgcgccc tgggcctctaccaggccctg

[0184] 1381 cagagccggc gccaggccct gggcccggag gccccggccc ccgccaaacctgggccccac

[0185] 1441 gccaaggagc cccggcacta ccatgggaag actaagggtc agggagatgaagggagacat

[0186] 1501 ctcggaagcc ggcattgcca gactttgcat gggcctgcct cccctggaaatgatcactcg

[0187] 1561 ggaagagagc tgtgcccgca acatagcccc ctggatgcga cgccccacaccctggtgcag

[0188] 1621 cccatccccg ccacgctggc ttccgatccc gccagctgcc cttgctgccagcatgaggac

[0189] 1681 ggccggcggc cctcgggcct gggcagcacc gactcgggcc aggagggctcgggctccggg

[0190] 1741 agctccgctg gtggcgagga cgaggcggat ggggacgggg cccggagcagcgaggacgga

[0191] 1801 gcctcctcag aactggggaa ggaggaggag gaggaggagc aggcggatggggcggtctgg

[0192] 1861 ctgtgcgggg atgtgtggcg ggagacgcga gccaagctgc gcggcatcgtggacagcaag

[0193] 1921 tacttcaacc ggggcatcat gatggccatc ctggtcaaca ccgtcagcatgggcatcgag

[0194] 1981 caccacgagc agccggagga gctgaccaac atcctggaga tctgcaatgtggtcttcacc

[0195] 2041 agcatgtttg ccctggagat gatcctgaag ctggctgcat ttgggctcttcgactacctg

[0196] 2101 cgtaacccct acaacatctt cgacagcatc attgtcatca tcagcatctgggagattgtg

[0197] 2161 gggcaggcgg acggtgggct gtcggtgctg cggaccttcc ggctgctgcgcgtgctgaaa

[0198] 2221 ctggtgcgct tcatgcctgc cctgcggcgc cagctcgtgg tgctcatgaagaccatggac

[0199] 2281 aacgtggcca ccttctgcat gctgctcatg ctcttcatct tcatcttcagcatccttggg

[0200] 2341 atgcatattt ttggctgcaa gttcagcctc cgcacggaca ctggagacacggtgcccgac

[0201] 2401 aggaagaact tcgactccct gctgtgggcc atcgtcactg tgttccagatcctcacccag

[0202] 2461 gaggactgga acgtcgttct ctacaatggc atggcctcca cttctccctgggcctccctc

[0203] 2521 tactttgtcg ccctcatgac cttcggcaac tatgtgctct tcaacctgctggtggccatc

[0204] 2581 ctggtggagg gcttccaggc ggagggtgac gccaatcgct cctactcggacgaggaccag

[0205] 2641 agctcatcca acatagaaga gtttgataag ctccaggaag gcctggacagcagcggagat

[0206] 2701 cccaagctct gcccaatccc catgaccccc aatgggcacc tggaccccagtctcccactg

[0207] 2761 ggtgggcacc taggtcctgc tggggctgcg ggacctgccc cccgactctcactgcagccg

[0208] 2821 gaccccatgc tggtggccct gggctcccga aagagcagtg tcatgtctctagggaggatg

[0209] 2881 agctatgacc agcgctccct gtccagctcc cggagctcct actacgggccatggggccgc

[0210] 2941 agcgcggcct gggccagccg tcgctccagc tggaacagcc tcaagcacaagccgccgtcg

[0211] 3001 gcggagcatg agtccctgct ctctgcggag cgcggcggcg gcgcccgggtctgcgaggtt

[0212] 3061 gccgcggacg aggggccgcc gcgggccgca cccctgcaca ccccacacgcccaccacatt

[0213] 3121 catcacgggc cccatctggc gcaccgccac cgccaccacc gccggacgctgtccctcgac

[0214] 3181 aacagggact cggtggacct ggccgagctg gtgcccgcgg tgggcgcccacccccgggcc

[0215] 3241 gcctggaggg cggcaggccc ggcccccggg catgaggact gcaatggcaggatgcccagc

[0216] 3301 atcgccaaag acgtcttcac caagatgggc gaccgcgggg atcgcggggaggatgaggag

[0217] 3361 gaaatcgact acaccctgtg cttccgcgtc cgcaagatga tcgacgtctataagcccgac

[0218] 3421 tggtgcgagg tccgcgaaga ctggtctgtc tacctcttct ctcccgagaacaggttccgg

[0219] 3481 gtcctgtgtc agaccattat tgcccacaaa ctcttcgact acgtcgtcctggccttcatc

[0220] 3541 tttctcaact gcatcaccat cgccctggag cggcctcaga tcgaggccggcagcaccgaa

[0221] 3601 cgcatctttc tcaccgtgtc caactacatc ttcacggcca tcttcgtgggcgagatgaca

[0222] 3661 ttgaaggtag tctcgctggg cctgtacttc ggcgagcagg cgtacctacgcagcagctgg

[0223] 3721 aacgtgctgg atggctttct tgtcttcgtg tccatcatcg acatcgtggtgtccctggcc

[0224] 3781 tcagccgggg gagccaagat cttgggggtc ctccgagtct tgcggctcctgcgcacccta

[0225] 3841 cgccccctgc gtgtcatcag ccgggcgccg ggcctgaagc tggtggtggagacactcatc

[0226] 3901 tcctccctca agcccatcgg caacatcgtg ctcatctgct gtgccttcttcatcatcttt

[0227] 3961 ggcatcctgg gagtgcagct cttcaagggc aagttctacc actgtctgggcgtggacacc

[0228] 4021 cgcaacatca ccaaccgctc ggactgcatg gccgccaact accgctgggtccatcacaaa

[0229] 4081 tacaacttcg acaacctggg ccaggctctg atgtccctct ttgtcctggcatccaaggat

[0230] 4141 ggttgggtga acatcatgta caatggactg gatgctgttg ctgtggaccagcagcctgtg

[0231] 4201 accaaccaca acccctggat gctgctgtac ttcatctcct tcctgctcatcgtcagcttc

[0232] 4261 tttgtgctca acatgtttgt gggtgtcgtg gtggagaact tccacaagtgccggcagcac

[0233] 4321 caggaggctg aagaggcacg gcggcgtgag gagaagcggc tgcggcgcctggagaagaag

[0234] 4381 cgccggaagg cccagcggct gccctactat gccacctatt gtcacacccggctgctcatc

[0235] 4441 cactccatgt gcaccagcca ctacctggac atcttcatca ccttcatcatctgcctcaac

[0236] 4501 gtggtcacca tgtccctgga gcactacaat cagcccacgt ccctggagacagccctcaag

[0237] 4561 tactgcaact atatgttcac cactgtcttt gtgctggagg ctgtgctgaagctggtggca

[0238] 4621 tttggtctga ggcgcttctt caaggaccga tggaaccagc tggacctggccattgtgcta

[0239] 4681 ctgtcagtca tgggcatcac cctggaggag atcgagatca atgcggccctgcccatcaat

[0240] 4741 cccaccatca tccgcatcat gagggttctg cgcattgccc gagtgctgaagctgttgaag

[0241] 4801 atggccacag gaatgcgggc cctgctggac acggtggtgc aagctttgccccaggtgggc

[0242] 4861 aacctgggcc tcctcttcat gctgctcttc ttcatctatg ctgctctcggggtggagctc

[0243] 4921 tttgggaagc tggtctgcaa cgacgagaac ccgtgcgagg gcatgagccggcatgccacc

[0244] 4981 ttcgagaact tcggcatggc cttcctcaca ctcttccagg tctccacgggtgacaactgg

[0245] 5041 aacgggatca tgaaggacac gctgcgggac tgcacccacg acgagcgcagctgcctgagc

[0246] 5101 agcctgcagt ttgtgtcgcc gctgtacttc gtgagcttcg tgctcaccgcgcagttcgtg

[0247] 5161 ctcatcaacg tggtggtggc tgtgctcatg aagcacctgg acgacagcaacaaggaggcg

[0248] 5221 caggaggacg ccgagatgga tgccgagctc gagctggaga tggcccatggcctgggccct

[0249] 5281 ggcccgaggc tgcctaccgg ctccccgggc gcccctggcc gagggccgggaggggcgggc

[0250] 5341 ggcgggggcg acaccgaggg cggcttgtgc cggcgctgct actcgcctgcccaggagaac

[0251] 5401 ctgtggctgg acagcgtctc tttaatcatc aaggactcct tggagggggagctgaccatc

[0252] 5461 atcgacaacc tgtcgggctc catcttccac cactactcct cgcctgccggctgcaagaag

[0253] 5521 tgtcaccacg acaagcaaga ggtgcagctg gctgagacgg aggccttctccctgaactca

[0254] 5581 gacaggtcct cgtccatcct gctgggtgac gacctgagtc tcgaggaccccacagcctgc

[0255] 5641 ccacctggcc gcaaagacag caagggtgag ctggacccac ctgagcccatgcgtgtggga

[0256] 5701 gacctgggcg aatgcttctt ccccttgtcc tctacggccg tctcgccggatccagagaac

[0257] 5761 ttcctgtgtg agatggagga gatcccattc aaccctgtcc ggtcctggctgaaacatgac

[0258] 5821 agcagtcaag cacccccaag tcccttctcc ccggatgcct ccagccctctcctgcccatg

[0259] 5881 ccagccgagt tcttccaccc tgcagtgtct gccagccaga aaggcccagaaaagggcact

[0260] 5941 ggcactggaa ccctccccaa gattgcgctg cagggctcct gggcatctctgcggtcacca

[0261] 6001 agggtcaact gtaccctcct ccggcaggcc accgggagcg acacgtcgctggacgccagc

[0262] 6061 cccagcagct ccgcgggcag cctgcagacc acgctcgagg acagcctgaccctgagcgac

[0263] 6121 agcccccggc gtgccctggg gccgcccgcg cctgctccag gaccccgggccggcctgtcc

[0264] 6181 cccgccgctc gccgccgcct gagcctgcgc ggccggggcc tcttcagcctgcgggggctg

[0265] 6241 cgggcgcatc agcgcagcca cagcagcggg ggctccacca gcccgggctgcacccaccac

[0266] 6301 gactccatgg acccctcgga cgaggagggc cgcggtggcg cgggcggcgggggcgcgggc

[0267] 6361 agcgagcact cggagaccct cagcagcctc tcgctcacct ccctcttctgcccgccgccc

[0268] 6421 ccgccgccag cccccggcct cacgcccgcc aggaagttca gcagcaccagcagcctggcc

[0269] 6481 gcccccggcc gcccccacgc cgccgccctg gcccacggcc tggcccggagcccctcgtgg

[0270] 6541 gccgcggacc gcagcaagga cccccccggc cgggcaccgc tgcccatgggcctgggcccc

[0271] 6601 ttggcgcccc cgccgcaacc gctccccgga gagctggagc cgggagacgccgccagcaag

[0272] 6661 aggaagagat gagggtcgca ggggcccccg gccgcccacc gcccgccccgtctcaccttc

[0273] 6721 tttacctcag gagccaggag cagacagcaa tacttcgtcc acacctgggatcgcgcaggg

[0274] 6781 cccgcagggc acaggcgccc gacagccggg ctgagcggag tctgggttagccaggcctgc

[0275] 6841 gtggcccatg gtggcccttc cagtgcatat acatacatat atatatatatatgcatatat

[0276] 6901 atatatatat atatatatat gtgtatacac acacacatag acagacatatatatatatat

[0277] 6961 ttattttttt tactgagagc ttatgacttc cagaaagtgc taaaggtgggaggtgggcca

[0278] 7021 gggcctggac ggggcttttg tctgatgctc tgggattctg gccagacccaccccagggca

[0279] 7081 catgtcctgc gggggcgtcc cagctgtgtt ttttgatgtc tcctccctggttaagagtag

[0280] 7141 cttggagagg accctcaggc ctctgagggc accaggccct ggagaagaggtgcaattcag

[0281] 7201 ggtgtgtgtg tgtttttttt cctttaaaga agaaacgctg ctaagatcccacgtggctcc

[0282] 7261 cacgtgtcgg ggtgtctgtc ctgtcatcct gactgtctcg ttattgtgaagtctttcgta

[0283] 7321 gacaccccag agcacacaca tccccttagt ccaccggtta gatgtctctctttagaaaaa

[0284] 7381 tcaggggtga gtagctgtgt ttccttaggc ctggggtagg ggatggagagcagctccaag

[0285] 7441 gctgagctgg ggctctggcc ccaggtgagg tccccagctc ctgagcacttctgagggggt

[0286] 7501 gggttccacc cccaggaggg cgggggtggg tggagcagga gtggaggcagcctgcagagg

[0287] 7561 aagggtgcgg gagactgagc cggcagtggc ttgcttggag gggctagggtacccgcctgg

[0288] 7621 tctcggctgg ctccagctgc cctgcaggtg cccctgggct caggtagttagttgttcagc

[0289] 7681 cactaatgcc ttttatcccc catatgggcg ctgagctgtg gctgttcctggacactgtgc

[0290] 7741 tgtccccgtc ctgagcaact atgcccccgc cccagtaggt tcaaggcaaagcagctctga

[0291] 7801 ccgaattcta ggcaggggtg ggggcacctg cctgggccct gggtccagccgcatccccat

[0292] 7861 gcccagcctt tcgcgtcacc tggaggccac atcttcccac cccacctgccagcccctgtc

[0293] 7921 tctcctcccc gctgccccta actgcagctc agctttcact atagcagtgcttcccaaacg

[0294] 7981 ggttctagac ttgggtgttt gatttgaaga gttacgcatt tatttcactatttattggga

[0295] 8041 aaaaaatgca ttgaacccgt gatttcacag acattttgct taggtcaaggctacttttta

[0296] 8101 aaaagggagt gactttcatg aagtcagttt gaagaaggag gttgggagcatgttggtggc

[0297] 8161 agtgatctgg agaggctgca ggggccacga gtttgcagat gctgtacttcagcaataacc

[0298] 8221 ttgcctttgc taagaccccc tccgagggct tcaggggggc ctgccaagggggggccttgt

[0299] 8281 tcttgttccc aaactctgac ttggaagaac tcagcttgtg gccgggctggtgagggtgtg

[0300] 8341 gggtgcgccc ttcccttttg ggctgaggga gagggggccg ggaggggttgtcaagcccac

[0301] 8401 ccgggaaact gagccctgga gaggggaagc agccagccca ggatgcttcagggccctggc

[0302] 8461 agcaaagaag ctggggtggt gtggagggcc ctactccaca ccctagagctgtgatgctga

[0303] 8521 gcaaggtgcc tgtggcggaa ggaactgccc agtcctccct gggggcaggtagacctgtgg

[0304] 8581 ggatggctcg gtccaagccc aacactgccc gctccagaga gcctcagccctgcctccctt

[0305] 8641 tccacagagg tggttttatg tggaacgagg taccttgtct ggggaagaagtggagctggg

[0306] 8701 caggcttgac tgctcctggc tgaccctgag ctctcgcagt tggagggaagcagacagact

[0307] 8761 tgactttttg caagtccgcg tgttgctgga gggacacgtg tattggagcccagaagaggg

[0308] 8821 gctgtgtggc ctgggaatac catgtggaag gttgggcttc aagttaacaggatcagacac

[0309] 8881 cagtcaagca gcctcaggtc atcttgcgac tccactgagc agcctttcctgttgtcacat

[0310] 8941 gggttcagag cagctgagca gggaacacgt cctaggcagg tctgacgtgaaacctcccct

[0311] 9001 taccctgaac cgtgtgactc tgcaagcaga cacctcgagg caggtgttctaggcaaaggg

[0312] 9061 atgggcatga gcgaaggctc cagggtccac agagcaggga gtgtggagaaggtggaagag

[0313] 9121 ctgagctcag aggcagagaa gctccttgca gggagcactg ggagatggcctggcccgtcc

[0314] 9181 caggctcctg gaggccccac ctgccgatcc caggcacttg accttgttcctgtgggtgac

[0315] 9241 agagatgaga accagggaag ctgtgatcca ctggccagga caagtcaacatgggtgaggg

[0316] 9301 ttgggcaaag ggcccttcct tcctccccaa ccctgtggtc tggggccatggcctcaggct

[0317] 9361 tgtgtctatc acaaaagcac aaacttgccc taacccacat gggcctggctgtggggaaag

[0318] 9421 tggggaccca ggtccctgag ctgtctgctg ggctccgtag agcggtggtgggcaggcacc

[0319] 9481 ttggcatctg tgcagagacg gcccagtctg gccaaatcct cttcctctcccctgctctac

[0320] 9541 cttctccggc accaggcagc cccttaaagg aggacaaagt gtgtaaagcccgtctgctgt

[0321] 9601 cttcccccaa atcctcagct cagagccttc cgcttccagg gccaaccccagccccgtttg

[0322] 9661 ctgcgttgtg taagggcttg gggtcttaga agctgctctt tagcccagatacacatactc

[0323] 9721 ttttttgtct ttgtgcaata atcagtgttc ctggcagagc ctgggccaagctgcagccta

[0324] 9781 ctgaggaggc agaggccacc tcctccagaa agccctcggc ctgggccgccgccgtgactc

[0325] 9841 tagcactctc agtcgctgta cagtttctat ggtgtgaatg aacttccctcctagttgctg

[0326] 9901 atggcgctgg tacctgctgg cccatggccc gggtgtagag aaaccaagcggcagccacca

[0327] 9961 ccagtgttgt tttgaataaa agcccagaag cctatttaag aa

[0328] In this text, the list of chemical groups listed in any definition of a variable includes the definition of that variable as any single group or combination of the listed groups. The recitation of an embodiment of a variable or aspect in this text includes that embodiment as any single embodiment or in combination with any other embodiment or portion thereof.

[0329] Any compound, composition, or method provided herein can be combined with one or more of any other compositions and methods provided herein. Brief Description of the Drawings

[0331] Figure 1A A schematic diagram of a fluorescence imaging plate reader (FLIPR) high-throughput assay is provided for potentiation measurement of T-type calcium channel subunits, similar to the assay disclosed in Zhang, Y-L., et al., ACS Pharmacol Transl Sci 5.3 (2022): 156 - 168, which is hereby incorporated by reference in its entirety, particularly the content related to the FLIPR assay and its protocol. Figure 1B Exemplary EC10 and EC90 responses to KCl are provided.

[0332] Figure 2 It is a schematic diagram of automated patch-clamp electrophysiology measurements, which can be used for specific mechanism of action measurements and to identify differential responses in each subunit.

[0333] Figures 3A - 3D Electrophysiological measurements related to the administration of compound 131 are provided.

[0334] Figures 4A - 4D Electrophysiological measurements related to the administration of compound 7 are provided.

[0335] Figure 5A Ex vivo measurements of rebound bursts in thalamic reticular nucleus (TRN) neurons after the administration of compound 7 are shown. Figure 5B Ex vivo measurements showing a decrease in the voltage threshold of rebound bursts after the administration of compound 7 are shown.

[0336] Figure 6A Ex vivo measurements of rebound bursts in thalamic reticular nucleus (TRN) neurons after the administration of compound 131 are shown. Figure 6B Ex vivo measurements showing a decrease in the voltage threshold of rebound bursts after the administration of compound 131 are shown.

[0337] Figure 7 In vivo pharmacokinetic measurements of the relevant concentrations of plasma (Cp), blood (Cb), unbound plasma (Cb,u), unbound blood (Cb,u), and cerebrospinal fluid (CSF) are provided after the intraperitoneal administration of compound 57 to mice at 10 mg / kg or 30 mg / kg.

[0338] Figure 8A It is a schematic diagram of a mouse social interaction assay. Figure 8B It is confirmed that Cav3.3 heterozygous and homozygous knockout mice show reduced social interaction (measured by the social index) compared to littermate control mice. Figure 8C Similar effects are shown, where Cav3.3 R1305H / WT and R1305H / R1305H homozygous mice have reduced social interaction compared to littermate controls. Figure 8D It is a schematic diagram of a mouse novel object recognition assay. Figure 8E It is shown that homozygous knockout mice of Cav3.3 have decreased object recognition (measured by the object discrimination ratio) compared to littermate controls. Figure 8F It is shown that Cav3.3 R1305H / WT and R1305H / R1305H homozygous mice have decreased object recognition compared to littermate controls. For each data set, one-way ANOVA was performed with a post hoc test for multiple comparisons. *p < 0.05; **p < 0.01; ***p < 0.001. N = number of mice.

[0339] Figure 9A It is a schematic diagram of the mouse social interaction assay. Figure 9B It was confirmed that compound 57 administered intraperitoneally 60 minutes before the social interaction assay could rescue the reduced social interaction in heterozygous Cav3.3 knockout mice, and the most effective dose was 10 mgs / kg. Figure 9C It was confirmed that compound 57 administered intraperitoneally 60 minutes before the social interaction assay could rescue the reduced social interaction in homozygous Cav3.3R1305H / R1305H mice, and the most effective dose was 10 mgs / kg. Figure 9D It was confirmed that compound 57 administered intraperitoneally 60 minutes before the social interaction assay had no effect on homozygous Cav3.3 knockout mice. For each data set, one-way ANOVA was performed using a post hoc test for multiple comparisons. *p < 0.05; **p < 0.01; ***p < 0.001. N = number of mice.

[0340] Figure 10A It is a schematic diagram of the mouse novel object recognition assay. Figure 10B It was confirmed that compound 57 administered intraperitoneally 60 minutes before the novel object recognition assay could rescue the decreased object recognition in heterozygous Cav3.3R1305H / WT mice, and the most effective dose was 30 mgs / kg. Figure 10C It was confirmed that compound 57 administered intraperitoneally 60 minutes before the object recognition assay had no effect on homozygous Cav3.3 knockout mice. For each data set, one-way ANOVA was performed using a post hoc test for multiple comparisons. *p < 0.05; **p < 0.01. Figure 10D It was confirmed that compound 57 administered intraperitoneally to wild-type male mice had no effect on basal locomotion. N = number of mice.

[0341] Figure 11A It is a schematic diagram of the mouse novel object recognition assay. Figure 11B It was confirmed that compound 57 administered intraperitoneally 60 minutes before the novel object recognition assay could rescue the decreased object recognition in 5xFAD heterozygous mice, and the most effective dose was 30 mgs / kg. One-way ANOVA was performed using a post hoc test for multiple comparisons. *p < 0.05; N = number of mice.

[0342] Figure 12A It is a schematic diagram of the electroencephalogram (EEG) electrode placement in mice, with one electrode in the frontal cortex, one electrode in the parietal cortex, one reference electrode, one ground electrode, and electromyography (EMG) electrodes. Figure 12B It is a schematic diagram of the soundproof EEG recording device. Figure 12CThis is an administration example in which 12 hours of a mouse during its light cycle (its sleep cycle) were recorded. First, the mouse was acclimated to the chamber and recording equipment for one day. Then a one-day baseline recording was performed, followed by recording the mouse for one day after intraperitoneal administration of vehicle, then for one day after intraperitoneal administration of 3 mg / kg of Compound 57, then for one day after intraperitoneal administration of 10 mg / kg of Compound 57, and then finally for one day after intraperitoneal administration of 30 mg / kg of Compound 57. Figure 12D It was confirmed that 30 mg / kg of Compound 57 increased the 11 Hz sleep spindle density in WT male mice. Figure 12E Similar findings were confirmed, where 10 mg / kg and 30 mg / kg doses of Compound 57 increased the 11 Hz sleep spindle density in male Cav3.3R1305H / R1305H homozygous mice. Figure 12F It was confirmed that Compound 57 had no effect on male Cav3.3 homozygous mice (these mice do not express any functional Cav3.3 channels). Using Holm- One-way ANOVA with Holm multiple comparison test (*p < 0.05 and ***p < 0.001); each circle is a mouse.

[0343] Detailed description

[0344] The compounds of the present disclosure enhance the Ca of the T-type channel V subtype 3.3, and their administration improves diseases, disorders or conditions as described herein (e.g., schizophrenia, cognitive deficits, reduced sleep spindles, decreased reticular thalamic function, thalamocortical hyperactivity, neurodevelopmental disorders such as autism spectrum disorder (ASD), schizophrenia, attention deficit hyperactivity disorder (ADHD), schizoaffective disorder and bipolar disorder, neurodegenerative diseases such as Alzheimer's disease).

[0345] In recent years, genome-wide association studies have found that CACNA1I is associated with the risk of schizophrenia (Pantelis, Christos, et al. Nature 511.7510 (2014): 421-427, which is hereby incorporated by reference in its entirety). In addition, rare loss-of-function mutations have been identified in schizophrenia patients by exome sequencing (Gulsuner, Suleyman, et al. Cell 154.3 (2013): 518-529, which is hereby incorporated by reference in its entirety). Although the precise mechanism of CACNA1I in schizophrenia risk is unclear, de novo variants of CACNA1I from schizophrenia patients have been found to impair channel trafficking, as described in Ghoshal, A. et al. Transl. Psychiatry 10 (2020): 29 and Andrade, A. et al. Sci. Rep. 6 (2016): 34233, which are hereby incorporated by reference in their respective entireties. These studies suggest a loss of function in disease risk or pathophysiology, but do not address whether any selective T-type Ca 2+ channel enhancers provide therapeutic benefits in certain disorders. Only one chemical series represented by the compound SAK3 (ethyl 8'-methyl-2',4-dioxo-2-(piperidin-1-yl)-2'H-spiro[cyclopentane-1,3'-imidazo[1,2-a]pyridine]-2-ene-3-carboxylate) has been identified as a potential Ca V v3.3 enhancer, as described in Fukunaga et al. Journal of Pharmacological Sciences 139 (2019): 51-58 and WO2013111799, which are hereby incorporated by reference. However, its binding or direct action on the Ca V v3 channel has not been determined, and compounds in this chemical series have enhancer activity, as shown in Zhang, Yan-Ling, et al. ACS Pharmacology & Translational Science 5.3 (2022): 156-168, which is hereby incorporated by reference, particularly the content related to the SAK3, ST-101, and Ca V enhancement assays. This disclosure is based in part on the identification and characterization of Ca V enhancers, as demonstrated herein, which provide therapeutic benefits. Without wishing to be bound by theory, Ca V enhancers (such as those described herein or those identified by the Ca V enhancement assay) may be able to directly bind to Ca V to provide therapeutic benefits. V ​

[0346] Ca V 3.3 Reinforcement Bracket

[0347] The Ca of the present disclosure V 3.3 enhancer may be a compound having the structure of formula (I) or a pharmaceutically acceptable salt thereof:

[0348]

[0349] wherein the dashed circle represents an optionally unsaturated (e.g., aromatic) ring;

[0350] p is 0 or 1;

[0351] m is 0 (and each carbon is bonded to 1 or 2 hydrogens), 1, 2, 3, or 4;

[0352] n is 0, 1, 2, 3, or 4;

[0353] X A1 is N, O, or C;

[0354] X A2 is N or C;

[0355] X A3 is N or CR A3 ;

[0356] R A1 is independently, each time it appears, hydrogen, alkyl (e.g., optionally unsaturated C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), -C(O)OR, -C(O)R, haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl), hydroxy or amino (e.g., -NRR); and two R A1 can together form =O or a 3- to 6-membered spiro ring; wherein R A1may independently have one or more (e.g., two, three, four) optional substitution points at each occurrence;

[0357] R A2 is independently hydrogen and alkyl (e.g., optionally unsaturated C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ); where any two geminal R A2 groups may together form =O or a 3- to 6-membered spiro ring; where R A2 may independently have one or more (e.g., two, three, four) optional substitution points at each occurrence;

[0358] R A3 is independently hydrogen, alkyl (e.g., optionally unsaturated C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), alkoxy (e.g., C 1 -C 8 alkoxy, lower alkoxy such as C 1 -C 4 alkoxy, methoxy, alkoxy substituted by, for example, aryl, such as benzyloxy), cyano, -C(O)OR, -C(O)R or halogen (e.g., F, Cl, Br); where R A3 may independently have one or more (e.g., two, three, four) optional substitution points at each occurrence;

[0359] R L is -S(=O) 2 -, -S(=O)-, -S(=N) 2 -, -S(=N)(=O)- or -C(R)(R)-;

[0360] X B1 is independently N, S or CR B1 , and one X B1 may be absent;

[0361] X B2 is independently N or CR B2 ;

[0362] R B1 is independently selected from hydrogen, alkyl (e.g., C1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl), halogen (e.g., F, Cl, Br) and -R C ; wherein R B1 may independently have one or more (e.g., two, three, four) optional substitution points at each occurrence;

[0363] R B2 is independently selected from hydrogen, alkyl (e.g., optionally unsaturated and optionally substituted C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl), halogen (e.g., F, Cl, Br) and -R C ; wherein R B2 may independently have one or more (e.g., two, three, four) optional substitution points at each occurrence; and

[0364] RB1 or R B2 at least one of which is a group - R having the following structure C :

[0365]

[0366] wherein indicates the point of attachment to the compound, and the dashed circle indicates optional aromaticity;

[0367] X C6 is C, CH, CR or N;

[0368] X C1 、X C2 、X C3 、X C4 and X C5 are independently CH, CR, N, NH, NR, O or S; and when the group is a 5 - membered ring, X C5 is absent; and

[0369] R C1 、R C2 、R C3 、R C4 and R C5 are independently hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as - CD 3 ), -C(O)R, -C(O)NRR, halogen (e.g., F, Cl, Br), haloalkyl haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl) or cycloalkyl (e.g., C 3 -C 8 cycloalkyl, C 3 -C 6 cycloalkyl); or may form oxo (=O) together with the R group; where R C1 、R C2, R C3 , R C4 and R C5 may independently have one or more (e.g., two, three, four) optional substitution points; and

[0370] R is independently hydrogen or alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ).

[0371] In certain embodiments, -R C has a structure such as

[0372] Generally, the alkyl or alkylene groups described herein represent branched or straight-chain monovalent saturated aliphatic hydrocarbon groups having 1 to 30 carbon atoms (e.g., 1 to 16 carbon atoms, 6 to 20 carbon atoms, 8 to 16 carbon atoms, or 4 to 18 carbon atoms, 4 to 12 carbon atoms). In certain embodiments, the alkyl or alkylene group can be unsaturated such as to form an alkenyl or alkynyl group. In certain embodiments, the alkyl group can be substituted with 1, 2, 3, or 4 substituents as defined herein. The alkyl or alkylene group can have 1 to 26 carbon atoms. In other embodiments, the alkyl group will have 6 to 18 or 1 to 8 or 1 to 6 or 1 to 4 or 1 to 3 carbon atoms, including for example, embodiments having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms. Any alkyl group can be substituted or unsubstituted. Examples of alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, and dodecyl groups. A heteroalkyl or heteroalkylene group can represent a branched or straight-chain monovalent saturated aliphatic hydrocarbon group having one or more heteroatoms (e.g., N, O, S) in the carbon chain. The heteroalkyl group can have 1 to 30 carbon atoms (e.g., 1 to 16 carbon atoms, 6 to 20 carbon atoms, 8 to 16 carbon atoms, or 4 to 18 carbon atoms, 4 to 12 carbon atoms). In certain embodiments, the heteroalkyl or heteroalkylene group can be substituted with 1, 2, 3, or 4 substituents as defined herein. The heteroalkyl or heteroalkylene group can have 1 to 26 carbon atoms (e.g., and one or more heteroatoms). In other embodiments, the heteroalkyl or heteroalkylene group will have 6 to 18 or 1 to 8 or 1 to 6 or 1 to 4 or 1 to 3 carbon atoms, including for example, embodiments having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms. In certain embodiments, the heteroalkyl group or heteroalkylene group can be further substituted with 1, 2, 3, or 4 substituents as described herein for alkyl groups. An example of a heteroalkyl group is an alkoxy group. An alkoxy substituent or a substituent containing an alkoxy group can be substituted with, for example, one or more alkyl groups.

[0373] The cycloalkyl or cycloalkylene groups described can represent cyclic aliphatic hydrocarbon groups having 3 to 15 carbon atoms (e.g., 3 to 12 carbon atoms, 3 to 8 carbon atoms, 3 to 6 carbon atoms or 3 to 5 carbon atoms, 3 to 4 carbon atoms). In certain embodiments, the cycloalkyl group can be substituted with 1, 2, 3 or 4 substituents as defined herein. The cycloalkyl group can have 3 to 12 carbon atoms in the carbocycle. The cycloalkyl group includes monocyclic and polycyclic ring systems such as bicyclic and tricyclic groups. In other embodiments, the cycloalkyl group will have 3 to 8 or 3 to 6 or 3 to 4 or 3 carbon atoms, including for example, embodiments having 3, 4, 5, 6, 7, 8, 9 or 10 carbon atoms. Any cycloalkyl or cycloalkylene group can be substituted or unsubstituted. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, cycloundecyl and cyclododecyl groups. The heterocycloalkyl or heterocycloalkylene can represent a ring saturated aliphatic hydrocarbon group having one or more heteroatoms (e.g., N, O, S) in the ring. The heterocycloalkyl or heterocycloalkylene group can have 3 to 15 atoms (e.g., 3 to 12 atoms, 3 to 8 atoms, 3 to 6 atoms or 3 to 5 atoms, 3 to 4 atoms) in the ring. In certain embodiments, the heterocycloalkyl or heterocycloalkylene group can be substituted with 1, 2, 3 or 4 substituents as defined herein.

[0374] The aryl or arylene group can be an aromatic monocyclic or polycyclic residue of 6 to 12 carbon atoms having at least one aromatic ring. Examples of such groups include, but are not limited to, phenyl, naphthyl, 1,2,3,4-tetrahydronaphthylidene, 1,2-dihydronaphthylidene, indanyl and 1H-indenyl. Generally, the heteroaryl or heteroarylene includes a monocyclic or polycyclic residue of 5 to 12 atoms having at least one aromatic ring, the aromatic ring containing 1, 2 or 3 ring heteroatoms selected from N, O and S, and the remaining ring atoms being C. One or two ring carbon atoms of the heteroaryl group can be replaced by a carbonyl group. Examples of heteroaryl groups are pyridyl, benzoxazolyl, benzimidazolyl and benzothiazolyl.

[0375] Exemplary heterocycloalkyl or heteroaryl groups (e.g., R C groups) include:

[0376]

[0377] These groups (e.g., R C ) can include one or more substituents as described herein (e.g., alkyl-substituted).

[0378] The substituted hydrocarbyl can have one or more hydrocarbyl groups, substituted hydrocarbyl groups as substituents, or contain one or more heteroatoms. Examples of the substituted hydrocarbyl include, but are not limited to, heterocycles such as heteroaryl. Unless otherwise indicated, a hydrocarbyl substituted with one or more heteroatoms will contain 1 - 20 heteroatoms. In other embodiments, a hydrocarbyl substituted with one or more heteroatoms will contain 1 - 12 or 1 - 8 or 1 - 6 or 1 - 4 or 1 - 3 or 1 - 2 heteroatoms. Examples of heteroatoms include, but are not limited to, oxygen, nitrogen, sulfur, phosphorus, halogen (e.g., F, Cl, Br, I), boron, or silicon. In certain embodiments, the heteroatoms will be selected from oxygen, nitrogen, sulfur, phosphorus, and halogen (e.g., F, Cl, Br, I). In certain embodiments, a heteroatom or group can substitute for carbon (e.g., a substituted alkyl can include a heteroalkyl). In certain embodiments, a heteroatom or group can substitute for hydrogen. In certain embodiments, the substituted hydrocarbyl can contain one or more heteroatoms in the main chain or chain of the molecule (e.g., between two carbon atoms, as in "oxa"). In certain embodiments, the substituted hydrocarbyl can contain one or more heteroatoms lateral to the main chain or chain of the molecule (e.g., covalently bonded to a carbon atom in the chain or main chain, as in "oxo").

[0379] Unless otherwise indicated, all groups described herein (e.g., alkyl, cycloalkyl, heteroalkyl, heterocycloalkyl, aryl, heteroaryl, alkylene, heteroalkylene, cycloalkylene, heterocycloalkylene, R A 、R B 、R C 、R A 、R B 、R C 、R A1 、R A2 、R A3 、R B1 、R B2 、R B3 、R C1 、R C2 、R C3 、R C4 、R C5 、R 1 -R 10 ) can optionally contain one or more substituents, provided that the valence permits. Substituents include halogen (e.g., F, Cl), C 1-12 straight-chain or branched alkyl, C 2-12 alkenyl, C 2-12 alkynyl, C 3-12 cycloalkyl, C 6-12 aryl, C 3-12 heteroaryl, C 3-12 heterocyclic group, C 1-12Alkylsulfonyl, nitro, cyano, -COOR, -C(O)NRR’, -OR, -SR, -NRR’ and oxo, such as being mono- or di- or tri-substituted by moieties such as halogen, fluoroalkyl, perfluoroalkyl, perfluoroalkoxy, trifluoromethoxy, chlorine, bromine, fluorine, methyl, methoxy, pyridyl, furyl, triazyl, piperazinyl, pyrazoyl, imidazolyl, etc., each optionally containing one or more heteroatoms such as halogen, N, O, S and P. R and R’ are independently hydrogen, C 1-12 alkyl, C 1-12 haloalkyl, C 2-12 alkenyl, C 2-12 alkynyl, C 3-12 cycloalkyl, C 4-24 cycloalkylalkyl, C 6-12 aryl, C 7-24 arylalkyl, C 3-12 heterocyclic group, C 3-24 heterocyclic group alkyl, C 3-12 heteroaryl or C 4-24 heteroarylalkyl. In addition, the phrase “optionally substituted” as used herein indicates that the specified hydrocarbon group may be unsubstituted (e.g., substituted by H) or substituted. Generally, a substituted hydrocarbon is a hydrocarbon from which a hydrogen atom is removed and replaced by a substituent (e.g., a common substituent). Any hydrocarbon in the present disclosure may be considered to be substituted or “optionally substituted” by the following groups: for example, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), heteroalkyl (e.g., C 1 -C 8 heteroalkyl, lower heteroalkyl such as C 1 -C 4 heteroalkyl), alkoxy-substituted alkyl (e.g., C 1 -C 6 alkoxy such as methoxy-substituted C 1 -C 6 alkyl), cycloalkyl (e.g., C 3 -C 9 cycloalkyl, C 3 -C 5 cycloalkyl, cyclopropyl), alkoxy (e.g., C 1 -C 8 alkoxy, lower alkoxy such as C 1 -C 4 alkoxy, methoxy), alkoxy substituted by, for example, aryl (e.g., benzyloxy), spirocycloalkyl (C 3-C 9 cycloalkyl, C 3 -C 5 cycloalkyl, cyclopropyl), haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl), halogen (e.g., F, Cl, Br), oxo (=O), amino (e.g., NH 2 , NR’R”, where R’ and R” are each independently selected from H and lower alkyl), amide (e.g., -NHC(O)R, -C(O)NR’R”, where R’ and R” are each independently selected from H and lower alkyl), hydroxy, cyano, nitroso, carboxylic acid (-COOH), ester (e.g., -COOR’, where R’ is each independently selected from C 1 -C 8 alkyl, lower alkyl), -C(O)NR’R”, where R’ and R” are each independently selected from H and lower alkyl).

[0380] One of ordinary skill in the art will understand that substitution at a given atom is limited by valence. Generally, the use of substituent (residue) prefix names such as alkyl or alkylene without the modifier “optionally substituted or substituted” should be understood to refer to a particular substituent that is unsubstituted, unless otherwise indicated. However, the use of haloalkyl without the modifier “optionally substituted or substituted” is still understood to refer to an alkyl group in which at least one hydrogen atom has been replaced by a halogen. In cases where a group can be substituted by one or more of a number of substituents, such substitution is chosen to conform to the valence-related principles of chemical bonding and to produce compounds that are not inherently unstable. For example, any carbon atom will bond to two, three, or four other atoms, consistent with the four valence electrons of carbon. In addition, when the number of specified functional groups in a structure is less than the required number, those carbon atoms without a specified functional group will bond to the required number of hydrogen atoms to satisfy the valence of that carbon, unless otherwise indicated.

[0381] The compounds provided herein may have one or more asymmetric carbon atoms and may exist in the form of optically pure enantiomers, mixtures of enantiomers (such as racemates), optically pure diastereomers, mixtures of diastereomers, diastereomeric racemates or mixtures of diastereomeric racemates. The optically active forms can be obtained, for example, by resolution of racemates, by asymmetric synthesis or by asymmetric chromatography (chromatography using chiral adsorbents or eluents). That is, certain disclosed compounds may exist in various stereoisomeric forms, including stereoisomers, enantiomers, diastereomers or racemates (i.e., the compound exists as a mixture containing two enantiomers and does not rotate plane-polarized light). Enantiomers of the compounds can be prepared, for example, by separating the enantiomers from the racemate using one or more well-known techniques and methods (such as chiral chromatography and separation methods based thereon). Those skilled in the art can readily determine the appropriate techniques and / or methods for separating the enantiomers of the compounds described herein from the racemic mixture.

[0382] The compounds provided herein may also exist in the form of geometric isomers, which differ in the orientation of the substituted atoms (e.g., carbon-carbon double bonds, cycloalkyl rings, bridged bicyclic systems). The atoms (except H) on each side of the carbon-carbon double bond can be in the E (substituents on opposite sides of the carbon-carbon double bond) or Z (substituents towards the same side) configuration. "R", "S", "S*", "R*", "E", "Z", "cis" and "trans" indicate the configuration relative to the core molecule and can be used to indicate the geometric configuration of the currently disclosed compounds. Certain disclosed compounds may exist in atropisomeric forms. Atropisomers are stereoisomers resulting from hindered rotation around a single bond, where the steric energy barrier to rotation is high enough to allow separation of the conformational isomers.

[0383] The compounds disclosed herein can be prepared as individual isomers by isomer-specific synthesis or resolution from mixtures of isomers. Conventional resolution techniques include forming salts of the free bases of each isomer of an isomeric pair with an optically active acid (followed by fractional crystallization and regeneration of the free base), forming salts of the acid form of each isomer of an isomeric pair with an optically active amine (followed by fractional crystallization and regeneration of the free acid), forming esters or amides of each isomer of an isomeric pair with an optically pure acid, amine, or alcohol (followed by chromatographic separation and removal of the chiral auxiliary), or resolving mixtures of isomers of the starting material or end product using various well-known chromatographic methods. When the stereochemistry of the disclosed compounds is named or depicted by structure, the named or depicted stereoisomer can be present in an amount greater than 50% by weight (or mole fraction) relative to other stereoisomers (e.g., at least 55%, 60%, 70%, 80%, 90%, 99%, or 99.9%). When a single enantiomer is named or depicted by structure, the depicted or named enantiomer is greater than 50% by weight (or mole fraction) optically pure (e.g., at least 55%, 60%, 70%, 80%, 90%, 99%, or 99.9%). When a single diastereomer is named or depicted by structure, the depicted or named diastereomer is greater than 50% by weight (or mole fraction) pure (e.g., at least 55%, 60%, 70%, 80%, 90%, 99%, or 99.9%). The percentage of optical purity is the ratio of the weight of the enantiomer to the weight of the enantiomer plus the weight of its optical isomer. The diastereomeric purity by weight is the ratio of the weight of one diastereomer to the weight of all diastereomers. The percentage of purity by mole fraction is the ratio of the number of moles of the enantiomer to the number of moles of the enantiomer plus the number of moles of its optical isomer. Similarly, the percentage of purity by mole fraction is the ratio of the number of moles of the diastereomer to the number of moles of the diastereomer plus the number of moles of its isomer. When the disclosed compounds are named or depicted by structure without indicating stereochemistry and the compound has at least one chiral center, it is understood that the name or structure encompasses either enantiomer of the compound without the corresponding optical isomer, a racemic mixture of the compound, or a mixture enriched in one enantiomer relative to its corresponding optical isomer. When the disclosed compounds are named or depicted by structure without indicating stereochemistry and have two or more chiral centers, it is understood that the name or structure encompasses diastereomers without other diastereomers, many diastereomers without other diastereomer pairs, mixtures of diastereomers, mixtures of diastereomer pairs, mixtures of diastereomers enriched in one diastereomer relative to other diastereomers, or mixtures of diastereomers enriched in one or more diastereomers relative to other diastereomers. This disclosure includes all such forms.

[0384] Solvates of the compounds described herein can form aggregates of the compound or ions of the compound with one or more solvents. Such solvents may not interfere with the biological activity of the solute. Examples of suitable solvents include, but are not limited to, water, MeOH, EtOH, and AcOH. Solvates in which the solvent molecule is water are commonly referred to as hydrates. Hydrates include compositions containing a stoichiometric amount of water, as well as compositions containing a variable amount of water.

[0385] The compounds described herein can exist as pharmaceutically acceptable salts. Generally, salts consist of a relevant number of cations and anions (wherein at least one is formed from a compound described herein), the cations and anions being coupled together (e.g., the pair may be ionically bonded) such that the salt is electrically neutral. Pharmaceutically acceptable salts can retain or have an activity similar to that of the parent compound (e.g., within 10% of the ED 50) and has toxicity characteristics within ranges that are useful for pharmaceutical compositions. For example, pharmaceutically acceptable salts may be suitable for contact with human and animal tissues without undue toxicity, irritation, allergic response, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are described in: Berge et al., J. Pharmaceutical Sciences 66:1-19, 1977, and Pharmaceutically acceptable salts: Properties, Selection, and Use (P.H. Stahl and C.G. Wermuth eds.), Wiley-VCH, 2008. Salts can be prepared from pharmaceutically acceptable non-toxic acids and bases, including inorganic and organic acids and bases. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, dichloroacetate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glutamate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hippurate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxyethanesulfonate, hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, mandelate, mesylate, mucate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pantothenate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, and valerate. Representative basic salts include alkali metal or alkaline earth metal salts, including sodium, lithium, potassium, calcium, and magnesium, aluminum salts, and non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, caffeine, and ethylamine.

[0386] The pharmaceutically acceptable acid addition salts of the present disclosure can be formed by reacting the compounds of the present disclosure with an equimolar or excess amount of acid. Alternatively, a hemisalt can be formed by reacting the compounds of the present disclosure with the desired acid in a 2:1 ratio (compound:acid). The reactants are typically mixed in a mutual solvent such as ether, tetrahydrofuran, methanol, ethanol, isopropanol, benzene, etc. The salt typically precipitates from the solution within, for example, one hour to ten days and can be separated by filtration or other conventional methods.

[0387] The compounds of the present invention include the compounds themselves, as well as their salts and their prodrugs (if applicable). For example, salts can be formed from anions (e.g., halide ions such as chloride, fluoride, bromide, optionally substituted phosphate, optionally substituted sulfonate, optionally substituted acetate) and positively charged substituents on the compounds described herein (e.g., optionally substituted ammonium). Suitable anions include chloride, bromide, iodide, sulfate, nitrate, phosphate, citrate, mesylate, trifluoroacetate, and acetate. Similarly, salts can also be formed between cations and negatively charged substituents on the compounds described herein (e.g., carboxylate). Suitable cations include sodium, potassium, magnesium, calcium, and ammonium cations such as tetramethylammonium ion. Prodrugs are generally converted to the active compound after administration to a subject, for example, by in vivo hydrolysis. Examples of prodrugs include C 1-6 alkyl esters of carboxylic acid groups, which are capable of providing the active compound after administration to a subject.

[0388] The compounds of the present disclosure generally contain the group R C , which can be, for example, an optionally substituted 5- or 6-membered nitrogen-containing heteroaryl. In certain embodiments, R C has the structure:

[0389]

[0390] where indicates the point of attachment to R L (or R B , when R L is absent); and the dashed circle indicates optional unsaturation (e.g., aromaticity);

[0391] XC 6 is C, CR, or N;

[0392] X C1 , X C2 , X C3 , X C4 and X C5 are independently CH, CR, N, NH, NR, O, or S each time they appear; and when the group is a 5-membered ring, X C5 is absent (i.e., it is a bond); and

[0393] R C1 , R C2 , R C3 , R C4 and R C5 are independently hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1-C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), halogen (e.g., F, Cl, Br), haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl), cycloalkyl (e.g., C 3 -C 9 cycloalkyl, C 3 -C 5 cycloalkyl, cyclopropyl), carboxylic acid (-COOH), ester (e.g., -COOR’, where R’ is independently selected from C 1 -C 8 alkyl, lower alkyl), -C(O)NR’R”, where R’ and R” are independently selected from H and lower alkyl); and

[0394] R is independently hydrogen or lower alkyl (e.g., C 1 -C 4 alkyl) in each occurrence. In various embodiments,

[0395] R C has the structure:

[0396]

[0397]

[0398] wherein R C1 is hydrogen, alkyl, halogen, haloalkyl, cycloalkyl or -C(O)NRR’, where R and R’ are independently hydrogen or lower alkyl. In certain embodiments, R C has the structure:

[0399]

[0400] For example, R C may have the structure:

[0401]

[0402] RC1 It may be, for example, hydrogen or a lower alkyl group (e.g., C 1 -C 4 alkyl, methyl), a cycloalkyl group (e.g., C 3 -C 5 cycloalkyl), a haloalkyl group (e.g., C 1 -C 4 haloalkyl, C 1 -C 4 fluoralkyl, fluoromethyl, difluoromethyl).

[0403] In certain embodiments, the R C group is conjugated to the central 6-membered ring in a para configuration relative to the R L group. The compounds of the present disclosure may have the structure of formula (II) or a pharmaceutically acceptable salt thereof:

[0404]

[0405] For example, the compound may have the structure of formula (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIg), (IIi) or (IIj):

[0406]

[0407]

[0408]

[0409] For example, the compound may be:

[0410]

[0411]

[0412]

[0413]

[0414]

[0415]

[0416]

[0417]

[0418] In certain embodiments, the compound may be:

[0419]

[0420]

[0421]

[0422]

[0423]

[0424] The compound may be selected from:

[0425]

[0426]

[0427] In certain embodiments, the compound is

[0428]

[0429] In certain embodiments, the compound is

[0430]

[0431] In a particular embodiment, the compound is

[0432]

[0433] R C The group may also be conjugated to the R L group in the meta configuration of the central 6-membered ring. For example, the compound may have the structure of formula (III):

[0434]

[0435] For example, the compound may have the structure of formula (IIIa), (IIIb), (IIIc), (IIId), or (IIIe):

[0436]

[0437] In certain aspects, the compound may be:

[0438]

[0439]

[0440]

[0441]

[0442]

[0443] For example, the compound may be:

[0444]

[0445] R L is typically -S(=O) 2 - group. In certain embodiments, R in Formulas (I), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (IIi), (III), (IIIa), (IIIb), (IIIc), (IIId), or (IIIe) L group is -S(=O) 2 -. For example, the compound may have the structure of Formula (IV) or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing:

[0446]

[0447] where each dashed circle independently indicates optionally unsaturated;

[0448] X is N, C, or CR 3 ;

[0449] Y is =N-, -N=, -N(R 9 ), -(C(R 7 )(R 8 )) p -, =C(R 7 ), -C(R 7 )=, -N(R 9 )C(R 7 )(R 8 )-, -C(R 7 )(R 8 )N(R 9 ), -N(R 9 )C(R 7 )=, =(R 7 )N(R 9 ), -C(R 7 )=C(R 8 ), -N=C(R 8 ), or -C(R 7 )=N-; p is 1, 2, or 3;

[0450] Z is N, C, or CR 6 ; and R 4 and R 6 may together form =O;

[0451] A1 , A 2 and A 3 are independently N, C or CH;

[0452] G is C, CH or N;

[0453] J is N, C or CH;

[0454] E is O or CH;

[0455] R 1 is absent, hydrogen or an alkyl group (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 );

[0456] R 2 -R 6 are independently hydrogen or an alkyl group (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ); where R 2 -R 6 can independently have one or more optional substitution sites;

[0457] R 7 -R 9 is independently hydrogen or an alkyl group (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ); where R 7 -R 9 can independently have one or more optional substitution sites. In certain embodiments, the compound has the structure of formula (IVa) or (IVb):

[0458]

[0459] where n is 1 or 2;

[0460] Y is N, CH or CR 10 ; and

[0461] R 10 is hydrogen or an alkyl group (e.g., C 1 -C 8 alkyl, lower alkyl such as C1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), and R 10 may have one or more optional substitution sites.

[0462] The compound may be:

[0463]

[0464]

[0465]

[0466]

[0467]

[0468] In certain embodiments, the compound is:

[0469]

[0470] The compound may have alterations on the bicyclic ring systems of formula (I), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (IIi), (III), (IIIa), (IIIb), (IIIc), (IIId) or (IIIe) to produce, for example, sulfonamides. Generally, these systems may retain the characteristics of the central ring (R B ) and R c . For example, the Ca V 3.3 enhancers of the present disclosure include those having the structure of formula (V) or a pharmaceutically acceptable salt thereof:

[0471]

[0472] wherein R D1 is hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl), monocyclic or bicyclic heterocyclic group, monocyclic or bicyclic heteroaryl or aryl, and R D1 may have one or more (e.g., two, three, four) optional substitution points (and R D1 may be optionally substituted and any two geminal or vicinal substituents may optionally form a 5- or 6-membered ring);

[0473] R D2 is hydrogen or alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ) and R D2 may have one or more (e.g., two, three, four) optional substitution points;

[0474] X B1 is independently N or CR B1 ;

[0475] R B1 is independently selected from hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), and -R C and R B1 may have one or more (e.g., two, three, four) optional substitution points;

[0476] R B2 is independently selected from hydrogen, optionally unsaturated alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), and -R C and R B2 may have one or more (e.g., two, three, four) optional substitution points; and

[0477] R B1or R B2 at least one of which is a group - R having the following structure C :

[0478]

[0479] wherein indicates the point of attachment to the compound, and the dashed circle indicates optional aromaticity;

[0480] XC 6 is C, CH, CR or N;

[0481] X C1 、X C2 、X C3 、X C4 and X C5 are independently CH, CR, N, NH, NR, O or S; and when the group is a 5 - membered ring, X C5 is absent; and

[0482] R C1 、R C2 、R C3 、R C4 and R C5 are independently hydrogen, alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ), -C(O)R, -C(O)NRR, halogen (e.g., F, Cl, Br), haloalkyl (e.g., C 1 -C 8 haloalkyl, lower haloalkyl such as C 1 -C 4 haloalkyl, halomethyl, C 1 -C 8 fluoroalkyl, lower fluoroalkyl such as C 1 -C 4 fluoroalkyl, fluoromethyl, difluoromethyl, perfluoroalkyl, C 1 -C 8 perfluoroalkyl, lower perfluoroalkyl such as C 1 -C 4 perfluoroalkyl, perfluoromethyl) or cycloalkyl (e.g., C 3 -C 8 cycloalkyl, C 3 -C 6 cycloalkyl); or may form oxo (=O) together with the vicinal R groups, where R C1 、R C2 、RC3 , R C4 and R C5 can each independently have one or more (e.g., two, three, four) optional substitution points; and

[0483] R is independently hydrogen or alkyl (e.g., C 1 -C 8 alkyl, lower alkyl such as C 1 -C 4 alkyl, methyl, deuterated alkyl or deuterated lower alkyl such as -CD 3 ). In various embodiments, the compound can have a structure of formula (Va), (Vb), (Vc), (Vd) or (Ve):

[0484]

[0485]

[0486] In various embodiments, the compound can be:

[0487]

[0488]

[0489]

[0490] The hydrocarbon groups (e.g., R A1 , R A2 , R A3 , R B1 , R B2 , R C1 , R C2 , R C3 , R C4 , R C5 , R D1 and R D2 ) identified in the compounds of the present disclosure can optionally be substituted one or more times by substituents as described herein. For example, in certain embodiments, R D1 is an aryl or alkyl optionally substituted one or more times by substituents selected from alkyl, alkoxy, halogen, -NRR, -C(O)R, -NRC(O)R and -C(O)NRR; and any two vicinal substituents can together form a 5- or 6-membered ring (e.g., dihydrobenzodioxinyl such as dihydrobenz[b][1,4]dioxin-5-yl). In various embodiments, R D1is a phenyl group optionally substituted one or more times with alkyl, alkoxy, halogen, -NRR, -C(O)R, -NRC(O)R, and -C(O)NRR, or a 1,4-benzodioxan-5-yl group optionally substituted one or more times with alkyl. In certain embodiments, R D2 is hydrogen or lower alkyl optionally substituted with alkoxy or -NRR (e.g., C 1 -C 4 alkyl such as methyl). Additionally, when the identified group is alkyl, the alkyl group may be optionally unsaturated (e.g., alkenyl). For example, in certain embodiments, R B2 is selected from hydrogen or optionally unsaturated alkyl (e.g., C 2 -C 8 alkenyl, C 2 -C 8 alkynyl, C 2 -C 4 alkenyl, C 2 -C 4 alkynyl, vinyl).

[0491] The Ca V 3.3 enhancer (or activator) can have the activity described in the assays presented herein (e.g., in Example 1). For example, the compound enhancer can have an EC V for Ca 50 3.3 activation that is less than (or from 0.1 nM to) 100 μM (e.g., less than 10 μM, less than 1 μM, less than 100 nM) (e.g., measured by 1-hour incubation). In various embodiments, the compound can be selective for Ca V 3.3 activation (e.g., having an EC V for Ca 50 3.3 activation that is less than (or from 0.1 nM to) 20 μM), and can be characterized as, for example, inactive for Ca V 3.2 activation, such as having an EC V for Ca 50 3.2 activation of 20 μM or more. The EC 50 can be measured by, for example, the assays described in the Examples (including the fluorescence imaging plate reader (FLIPR) assay). In certain embodiments, the compound can be characterized by the assays described in: Pan, J, et al., Methods MolBiol 1787 (2018): 235 - 252, and Baez-Nieto, D, et al., Brain (2017): awab443, Hansen, K.B. and - Osborne, H. Methods Mol. Biol. 552 (2009): 269 - 278, Zhu, T. et al. Acta Pharmacol Sin 29 (2008): 507 - 516, or Yu, H. et al. Acta Pharmacol Sin 37 (2016): 34 - 43, each of which is incorporated herein by reference in its entirety, particularly the content related to high - throughput assay protocols.

[0492] The compound can be any one of Compounds 1 - 69, 71 - 172, 174 - 176, 179 - 265, 269 - 285, 287 - 288, 290 - 291, 293 - 295, 297 - 298, 300 - 301, 305, 307, 312, 314 - 321, 324 - 325, 327 - 340, 342 - 343, 345, 348 - 357, 360 - 362, 364 - 375, 377 - 378, 380 - 392, 395 - 396, 398 - 423, 425 - 435, 438 - 439, 441 - 446, 448, 450, 452 - 456, 458, 460, 462 - 463, 465 - 466, 468 - 469, 473 - 481, 483 - 492, 494, 496 - 497, 499 - 505, 508 - 509, 512 - 515, 518 - 520, 522 - 523, 525 - 529, 532 - 541, 543 - 551, 553 - 558, 560 - 570, 573 - 575, 577 - 583, 585, and 587 - 596 disclosed in Table 1, its stereoisomers, tautomers, diastereoisomers, enantiomers, mixtures, or racemic mixtures of any of the foregoing. In certain embodiments, the compound is any one of Compounds 1 - 69, 71 - 172, 174 - 176, and 179 - 255. In certain embodiments, the compound can have the structure of Formula (I) or (V) and is not one or more of Compounds 1 - 69, 71 - 172, 174 - 176, 179 - 265, 269 - 285, 287 - 288, 290 - 291, 293 - 295, 297 - 298, 300 - 301, 305, 307, 312, 314 - 321, 324 - 325, 327 - 340, 342 - 343, 345, 348 - 357, 360 - 362, 364 - 375, 377 - 378, 380 - 392, 395 - 396, 398 - 423, 425 - 435, 438 - 439, 441 - 446, 448, 450, 452 - 456, 458, 460, 462 - 463, 465 - 466, 468 - 469, 473 - 481, 483 - 492, 494, 496 - 497, 499 - 505, 508 - 509, 512 - 515, 518 - 520, 522 - 523, 525 - 529, 532 - 541, 543 - 551, 553 - 558, 560 - 570, 573 - 575, 577 - 583, 585, and 587 - 596.

[0493] Table 1

[0494]

[0495]

[0496]

[0497]

[0498]

[0499]

[0500]

[0501]

[0502]

[0503]

[0504]

[0505]

[0506]

[0507]

[0508]

[0509]

[0510]

[0511]

[0512]

[0513]

[0514]

[0515]

[0516]

[0517]

[0518]

[0519]

[0520]

[0521]

[0522]

[0523]

[0524]

[0525]

[0526]

[0527]

[0528]

[0529]

[0530]

[0531]

[0532]

[0533]

[0534]

[0535]

[0536]

[0537]

[0538]

[0539]

[0540]

[0541]

[0542]

[0543]

[0544]

[0545]

[0546]

[0547]

[0548]

[0549]

[0550]

[0551]

[0552]

[0553]

[0554]

[0555]

[0556]

[0557]

[0558]

[0559]

[0560]

[0561]

[0562]

[0563]

[0564]

[0565]

[0566]

[0567]

[0568]

[0569]

[0570]

[0571]

[0572]

[0573]

[0574]

[0575]

[0576]

[0577]

[0578]

[0579]

[0580]

[0581]

[0582]

[0583]

[0584]

[0585]

[0586]

[0587]

[0588]

[0589]

[0590]

[0591]

[0592]

[0593]

[0594]

[0595]

[0596]

[0597]

[0598] In certain embodiments, the compound is any compound in Table 1, including compounds selected from compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, or a pharmaceutically acceptable salt or prodrug thereof, including stereoisomers, tautomers, diastereoisomers, enantiomers, mixtures, or racemic mixtures of any of the foregoing.

[0599] Generally, each stereochemical name provided for the compounds of the present disclosure in Table 1 and the synthetic examples should be considered to have an "or 1" label. However, the present disclosure contemplates compounds in which the indicated stereochemistry is the absolute ("abs") stereochemistry of the compound (and all enantiomers and mixtures thereof may be encompassed by the indicated structure). Compounds can be characterized by their elution order in a chiral separation process, such as those described in the synthetic examples. For example, the compound can be chiral separated from a mixture of enantiomers and characterized by its elution order and properties (e.g., increased activity, pharmacokinetic parameters). The compound (e.g., compounds 2, 10, 15, 36, 39, 46, 67, 90, 114, 126, 154, 156, 176, 182, 184, 193, 198, 207, 272, 522, 523, 561, 562) can have the structure:

[0600]

[0601] is a mixture thereof, including a racemic mixture. In certain embodiments, the compound (e.g., compound 21, 24, 27, 55, 59, 68, 83, 88, 91, 116, 120, 138, 153, 186, 262, 263, 264, 307, 389, 433, 555, 557) may have the structure:

[0602]

[0603] is a mixture thereof, including a racemic mixture. The compound (e.g., compound 29, 81, 88, 100, 118, 165, 201, 261, 262, 265, 269, 307, 390, 391, 392, 434, 483, 518) may have the structure:

[0604]

[0605]

[0606] is a mixture thereof, including a racemic mixture. In certain aspects, the compound (e.g., compound 135, 435) may have the structure:

[0607]

[0608] is a mixture thereof, including a racemic mixture. In various embodiments, the compound (e.g., compound 63, 357) may have the structure

[0609]

[0610] is a mixture thereof, including a racemic mixture. In certain embodiments, the compound may have the structure:

[0611]

[0612] is a mixture thereof, including a racemic mixture. In certain embodiments, the compound (e.g., compound 210, 230) may have the structure:

[0613]

[0614] is a mixture thereof, including a racemic mixture. In certain embodiments, the compound (e.g., compound 404) may have the structure:

[0615]

[0616] is a mixture thereof, including a racemic mixture.

[0617] In certain embodiments, the compound is compound 22, 34, 40, 48, 57, 71, 74, 77, 79, 82, 84, 92, 99, 101, 104, 122, 130, 132, 133, 142, 144, 145, 149, 152, 155, 161, 166, 169, 172, 174, 195, 208, 220, 223, 230, 235, 238, 244, 246, 247, 249, 255 or 317. In various embodiments, the compound is

[0618]

[0619]

[0620] In various embodiments, the compound is:

[0621]

[0622] In certain embodiments, the compound is compound 1, 3 - 9, 11 - 17, 19, 23 - 24, 26 - 33, 38, 41 - 46, 49, 50 - 56, 58 - 66, 68, 72, 75, 78, 80 - 81, 85 - 86, 88 - 89, 91, 93 - 95, 100, 102 - 103, 105 - 106, 109, 116 - 121, 126 - 127, 129, 134 - 136, 138 - 141, 153 - 154, 168, 170 - 171, 176, 182, 184, 187, 191, 193, 198 or 201. In certain embodiments, the compound is compound 32, 35, 56, 68, 70, 73, 76, 85, 87, 93, 97, 105, 110, 112, 114 - 115, 119, 124, 128, 131, 137, 147, 157, 163 - 164, 171, 175, 177, 181, 183, 185, 186, 188 - 190, 192, 196 - 197, 199, 203, 205, 213, 214, 216, 221 - 222, 225, 229, 231 - 232, 234, 236 - 237, 241 - 243, 245, 248, 250 - 253, 256 or 259. For example, the compound can be

[0623]

[0624] In certain embodiments, the compound is:

[0625]

[0626] In certain embodiments, the compound is:

[0627]

[0628]

[0629] In certain embodiments, the compound is:

[0630]

[0631]

[0632] Pharmaceutical composition

[0633] The compounds described herein (e.g., Ca V 3.3 enhancers, compounds having the structure of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb, (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (Iii), (IIj), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa) or (IVb), one or more of compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, one or more of compounds 1-69, 71-172, 174-176 and 179-255) can be used to treat a subject in need thereof. The compounds described herein can also be compounds for preparing a medicament for treating a subject in need thereof (e.g., a disease caused thereby).

[0634] Also provided are pharmaceutical dosage forms, which may comprise a compound of the present disclosure (e.g., Ca V 3.3 enhancer, a compound having a structure of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb, (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (Iii), (IIj), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa) or (IVb), one or more of Compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, one or more of Compounds 1-69, 71-172, 174-176 and 179-255) and one or more pharmaceutically acceptable carriers, diluents or excipients.

[0635] A unit dosage form, also known as a unitary dosage form, generally refers to those pharmaceutical forms supplied in a manner that provides a dose without further weighing or measuring (e.g., tablets, capsules, cachets). The compositions of the present disclosure may exist as unit dosage forms. For example, a unit dosage form may represent a physically discrete unit suitable as a unit dose for human subjects and other species, each unit containing a predetermined amount of the active substance calculated to produce the desired therapeutic effect, and any suitable one or more excipients. Exemplary, non-limiting unit dosage forms include tablets (e.g., chewable tablets), cachets, capsules (e.g., hard capsules or soft capsules), lozenges, films, strips and gel caps. In certain embodiments, the compounds described herein (including their crystalline forms, polymorphs and solvates) may be present in unit dosage forms.

[0636] Useful pharmaceutical carriers, excipients, and diluents for preparing the compositions herein can be solid, liquid, or gaseous. These include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. A pharmaceutically acceptable carrier or excipient does not destroy the pharmacological activity of the disclosed compounds and is non-toxic when administered in a dose sufficient to deliver a therapeutically effective amount of the compound. Thus, the compositions can take the form of tablets, pills, capsules, suppositories, powders, enteric coatings or other protected formulations (e.g., bound to ion exchange resins or encapsulated in lipid-protein vesicles), sustained release formulations, solutions, suspensions, elixirs, and aerosols. The carrier can be selected from a variety of oils, including those of petroleum, animal, vegetable, or synthetic origin, such as, for example, peanut oil, soybean oil, mineral oil, and sesame oil. Water, saline, dextrose solutions, and glycols are examples of liquid carriers, especially (when isotonic with blood) for injection solutions. For example, a formulation for intravenous administration comprises a sterile aqueous solution of the active ingredient, which is prepared by dissolving the solid active ingredient in water to produce an aqueous solution and rendering the solution sterile. Suitable pharmaceutical excipients include starch, cellulose, chitosan, talc, glucose, lactose, gelatin, malt, rice, flour, chalk, silica, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, skim milk powder, glycerol, propylene glycol, water, and ethanol. The compositions can be admixed with conventional pharmaceutical additives, such as preservatives, stabilizers, wetting or emulsifying agents, salts for adjusting osmotic pressure, and buffers. Suitable pharmaceutical carriers and their formulations are described in Remington’s Pharmaceutical Sciences by E.W. Martin. In any case, such compositions will contain an effective amount of the active compound together with a suitable carrier so as to prepare a proper dosage form for administration to the recipient.

[0637] Non-limiting examples of pharmaceutically acceptable carriers and excipients include sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethyl cellulose and cellulose acetate; acacia powder; malt; gelatin; talc; cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as polyethylene glycol and propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; isotonic saline; Ringer's solution; ethanol; phosphate buffer solutions; non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate; coloring agents; release agents; coating agents; sweetening, flavoring and aromatic agents; preservatives; antioxidants; ion exchange agents; alumina; aluminum stearate; lecithin; self-emulsifying drug delivery systems (SEDDS) such as d-alpha tocopheryl polyethylene glycol 1000 succinate; surfactants for pharmaceutical dosage forms such as Tween or other similar polymeric delivery matrices; serum proteins such as human serum albumin; glycine; sorbic acid; potassium sorbate; mixtures of partial glycerides of saturated vegetable fatty acids; water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride and zinc salts; colloidal silica; magnesium trisilicate; polyvinylpyrrolidone; cellulose-based substances; polyacrylates; waxes; and polyethylene-polypropylene-block polymers. Cyclodextrins such as alpha-, beta- and gamma-cyclodextrins, or chemically modified derivatives such as hydroxyalkyl cyclodextrins (including 2- and 3-hydroxypropyl-cyclodextrin), or other solubilizing derivatives, can also be used to enhance the delivery of the compounds described herein.

[0638] In various embodiments, the compositions of the present invention are formulated as pills or tablets for oral administration. According to such formulations, they contain lactose monohydrate, microcrystalline cellulose, crospovidone / povidone, flavoring agents, compressible sugar, and magnesium stearate as excipients. When the compositions are in the form of pills or tablets, they are, for example, 1 mg, 2 mg, or 4 mg pills or tablets. Such pills or tablets are divisible, so that they can be cut into doses suitable according to the present invention and administered one or two times a day. In a further embodiment, the compositions of the present disclosure are formulated as injectable solutions or suspensions for parenteral administration. The injectable compositions are produced as follows: A therapeutically effective amount of torasemide is mixed with a pH regulator, a buffer, a suspending agent, a solubilizer, a stabilizer, an isotonic agent, and / or a preservative, and the mixture is converted into an intravenous, subcutaneous, intramuscular injection, or perfusion agent according to conventional methods. Where possible, the injectable compositions can be lyophilized under low pressure according to conventional methods. Examples of suspending agents include methylcellulose, polysorbate 80, hydroxyethyl cellulose, xanthan gum, sodium carboxymethyl cellulose, and polyethoxylated sorbitan monolaurate. Examples of solubilizers include polyoxyethylene-solidified castor oil, polysorbate 80, nicotinamide, polyethoxylated sorbitan monolaurate, polyethylene glycol, and ethyl esters of castor oil fatty acids. In addition, stabilizers include sodium sulfite, sodium metabisulfite, and ether, while preservatives include methyl paraben, ethyl paraben, sorbic acid, phenol, cresol, and chlorocresol. An example of an isotonic agent is mannitol. When preparing injectable suspensions or solutions, it is necessary to ensure that they are isotonic with blood.

[0639] In certain embodiments, the pharmaceutical composition further comprises a viscosity enhancer. In certain embodiments, the viscosity enhancer includes methylcellulose, hydroxyethyl cellulose, hydroxypropylmethylcellulose, and smart hydrogels. In certain embodiments, the viscosity enhancer is hydroxyethyl cellulose. In certain embodiments, the pharmaceutical composition contains 0.01-1.0% (w / v) viscosity enhancer. In other embodiments, the intranasal pharmaceutical composition contains 0.05% (w / v) hydroxyethyl cellulose.

[0640] In certain embodiments, the pH of the pharmaceutical composition is from 4.0 to 7.5. In other embodiments, the pH of the pharmaceutical composition is from 4.0 to 6.5. In another embodiment, the pharmaceutical composition has a pH of 5.5 to 6.5. In other embodiments, the pharmaceutical composition has a pH of 6.0 to 6.5. In various embodiments, the pH of the aqueous solution or liquid preparation is pH 3 to pH 7, pH 3 to pH 6, pH 4 to pH 6, or pH 5 to pH 6. These pH ranges can be achieved by incorporating one or more pH regulators, buffers, etc. In certain embodiments, a pH regulator such as acetic acid is present at a final concentration of at least 0.001%, preferably at least 0.01%, more preferably 0.01% - 0.2% by weight of the composition.

[0641] In terms of its form, the composition of the present invention can include solutions, emulsions (including microemulsions), suspensions, creams, lotions, gels, powders or other typical solid or liquid compositions for administration to the skin and other tissues (where the composition can be used). Such compositions can contain: additional antimicrobial agents, humectants and hydrating agents, penetrants, preservatives, emulsifiers, natural or synthetic oils, solvents, surfactants, detergents, gelling agents, emollients, antioxidants, fragrances, fillers, thickeners, waxes, odor absorbers, dyes, colorants, powders, viscosity control agents and water, and optionally include anesthetics, antipruritic actives, plant extracts, conditioning agents, darkening or brightening agents, flashing agents, humectants, mica, minerals, polyphenols, silicones or their derivatives, sunscreens, vitamins and botanicals. In certain embodiments, the composition of the present invention is formulated from the above ingredients for long-term stability, which may be beneficial in cases where continuous or long-term treatment is desired.

[0642] Treatment method

[0643] As demonstrated herein, Ca V 3.3 enhancers are capable of inducing significant therapeutic effects in patients in need thereof, including increasing sleep spindles, rescuing sleep spindle defects, increasing rebound bursts in the thalamic reticular nucleus (TRN) and / or reducing thalamocortical hyperactivity. In addition, it is demonstrated herein that Ca V 3.3 enhancers will rescue social interaction and novel object recognition when administered to a subject. In certain embodiments, activation of the Ca V channels (e.g., by administering a Ca V 3.3 enhancer to a subject) can effectively treat and / or prevent diseases, disorders or conditions associated with declarative memory defects and / or social deficits.

[0644] Typically, the treatment of a disease, disorder or condition (e.g., schizophrenia, cognitive deficits, reduced sleep spindles, decreased reticular thalamic function, excessive thalamocortical activity, neurodevelopmental disorders such as autism spectrum disorder (ASD), schizophrenia, attention deficit hyperactivity disorder (ADHD), schizoaffective disorder and bipolar disorder, neurodegenerative diseases such as Alzheimer's disease) is a regimen for achieving a beneficial or desired outcome (such as a clinical outcome). The compounds (e.g., Ca V3.3 Enhancers, compounds having the structure of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa) or (IVb), one or more of compounds 1 - 69, 71 - 172, 174 - 176, 179 - 265, 269 - 285, 287 - 288, 290 - 291, 293 - 295, 297 - 298, 300 - 301, 305, 307, 312, 314 - 321, 324 - 325, 327 - 340, 342 - 343, 345, 348 - 357, 360 - 362, 364 - 375, 377 - 378, 380 - 392, 395 - 396, 398 - 423, 425 - 435, 438 - 439, 441 - 446, 448, 450, 452 - 456, 458, 460, 462 - 463, 465 - 466, 468 - 469, 473 - 481, 483 - 492, 494, 496 - 497, 499 - 505, 508 - 509, 512 - 515, 518 - 520, 522 - 523, 525 - 529, 532 - 541, 543 - 551, 553 - 558, 560 - 570, 573 - 575, 577 - 583, 585 and 587 - 596 can be used to treat any disease, disorder, condition or method described herein. In certain embodiments, the compounds can be used to prepare a medicament for treating any disease, disorder, condition or method described herein. Beneficial or desired results can include, but are not limited to: reduction or improvement of one or more symptoms or conditions; reduction in the degree of a disease, disorder or condition; stabilization (i.e., no worsening) of a disease, disorder or condition; prevention of the spread of a disease, disorder or condition; delay or slowing of the progression of a disease, disorder or condition; improvement or alleviation of a disease, disorder or condition; and remission (whether partial or complete), whether detectable or not. A disease, disorder or condition can be alleviated, which includes a reduction in the degree and / or undesired clinical manifestations and / or a slowing or prolongation of the progression time course of a disease, disorder or condition compared to the degree or time course in the absence of treatment.

[0645] Methods for treating and / or preventing neurodegenerative diseases, mental diseases, cognitive dysfunction and pervasive developmental disorders are provided, the methods comprising administering a compound (e.g., Ca V3.3 Enhancer, a compound having a structure of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb, (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (Iii), (IIj), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa) or (IVb), one or more of compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596). In various embodiments, the cognitive impairment is a disease selected from Alzheimer's disease, Parkinson's disease, Pick's disease and Huntington's disease, schizophrenia, bipolar disorder, depression, phobia, sleep disorder, drug dependence, autism, Asperger's syndrome, mental retardation, polyfunctional disorder and tic disorder. A method for improving the brain function of a subject is provided, the method comprising administering a compound (e.g., Ca V3.3 Enhancers, compounds having the structure of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb, (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (Iii), (IIj), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa) or (IVb), one or more of compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596. The improvement of brain function in the present invention includes improving brain dysfunction, for example, brain dysfunction caused by cerebrovascular diseases, brain injuries, brain tumors, viral encephalitis, hypoxic encephalopathy and alcoholism. The present disclosure can be particularly applicable to cognitive dysfunction, such as memory impairment, attention deficit, executive function deficit, social behavior disorder. Cognitive dysfunction includes, for example, neurodegenerative diseases (e.g., Alzheimer's disease, Parkinson's disease, Pick's disease and Huntington's disease), mental diseases (e.g., schizophrenia, bipolar disorder, depression, phobia, sleep disorder, drug dependence, etc.) and pervasive developmental disorders (e.g., autism, Asperger's syndrome, mental retardation, polyfunction disorder, tic disorder).

[0646] Methods of treating a subject in need thereof (e.g., a subject having schizophrenia, cognitive deficits, reduced sleep spindles, decreased reticular thalamic function, hyperactive thalamocortical activity, a neurodevelopmental disorder such as an autism spectrum disorder (ASD), schizophrenia, attention deficit hyperactivity disorder (ADHD), schizoaffective disorder, and bipolar disorder, a neurodegenerative disease such as Alzheimer's disease or a subject having a predisposition thereto) include administering to the subject a compound (e.g., a Ca V 3.3 enhancer, a compound having a structure of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb, (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (Iii), (IIj), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa) or (IVb), one or more of compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, one or more of compounds 1-69, 71-172, 174-176, 176-255) or a composition of the present disclosure.

[0647] The compounds of the present disclosure selectively modulate T-type calcium channels associated with schizophrenia and other disorders disclosed herein, such as cognitive deficits, reduced sleep spindles, decreased reticular thalamic function, thalamocortical hyperactivity, neurodevelopmental disorders such as autism spectrum disorder (ASD), schizophrenia, attention deficit hyperactivity disorder (ADHD), schizoaffective disorder, and bipolar disorder, and neurodegenerative diseases such as Alzheimer's disease. These small molecules rescue the sleep spindle deficits observed in schizophrenia patients. Sleep spindles are brain oscillations that are particularly important for memory consolidation during sleep, and Ca V 3.3 function is crucial for sleep spindle formation. Methods for reducing sleep spindle formation are also provided. Sleep spindles can be classified as slow sleep spindles and fast sleep spindles. The difference in power distribution between the mood disorder state and the normal state can be clearly seen in a specific type of sleep spindle, such as slow sleep spindles. Therefore, it may be possible to diagnose whether a test subject is in a mood disorder state by setting the frequency band of slow sleep spindles to a specific frequency band. Based on the sleep spindle state or dominant sleep spindle state of a subject in need thereof, the compounds of the present disclosure can be selected (e.g., Ca V3.3 Potentiator, a compound having a structure of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa) or (IVb), one or more of compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, one or more of compounds 1-69, 71-172, 174-176, 179-255).

[0648] The present disclosure is at least in part based on the discovery that T-type calcium channel modulators act as therapeutic agents for schizophrenia, particularly rescuing sleep spindle defects and alleviating cognitive symptoms (e.g., working memory impairment, attention and learning disorders).

[0649] A method of reducing thalamocortical hyperactivity in a subject in need thereof may include administering Ca to the subject V3.3 Enhancers (e.g., compounds having the structure of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa) or (IVb), one or more of compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596, one or more of compounds 1-69, 71-172, 174-176, 179-255). In certain embodiments, the subject is a human. In certain embodiments, the subject has schizophrenia. For example, a method of increasing rebound bursts in the thalamic reticular nucleus (TRN) of a subject in need thereof may include administering Ca V 3.3 Enhancer. In certain embodiments, the subject is a human. In certain embodiments, the subject has schizophrenia.

[0650] The present disclosure also provides a method of treating or preventing schizophrenia or a disease, disorder or condition associated therewith (e.g., cognitive deficit) in a subject in need thereof, the method comprising administering Ca V 3.3 Enhancer.

[0651] To treat, prevent or prevent recurrence of the diseases, disorders or conditions discussed herein (e.g., schizophrenia or related disorders or conditions such as cognitive deficits, reduced sleep spindles, reduced thalamocortical hyperactivity), the compounds or compositions of the present disclosure can be administered at least once a day for at least one week. In various embodiments, the composition is administered at least twice a day for at least two days. In certain embodiments, the composition is administered approximately once a day, at least once a day, twice a week, once a week or once a month. In certain embodiments, the composition of the invention is administered for several months, such as at least two months, six months or one year or longer. The present invention is also suitable for long-term use, which may be particularly beneficial for preventing recurrent infections, or preventing infections or conditions in high-risk or susceptible patients, including immunocompromised patients. Such long-term use may involve treatment for at least two, three, four or even five or more years.

[0652] Examples of other drugs in combination with the compounds described herein include drugs for treating schizophrenia or related conditions or disorders. The combination method can include using two (or more) agents formulated together or separately, as appropriate. In one embodiment, two or more drugs are formulated together to administer the agents simultaneously or near-simultaneously.

[0653] Kit

[0654] In another aspect, the composition of the invention is a kit that contains the composition of the present disclosure, which is packaged to facilitate the dispensing and / or administration of the composition disclosed herein (e.g., containing one or more Ca V3.3 Composition of enhancers, comprising a composition of one or more compounds having the structure of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb, (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (Iii), (IIj), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa) or (IVb), comprising one or more of Compounds 1-69, 71-172, 174-176, 179-265, 269-285, 287-288, 290-291, 293-295, 297-298, 300-301, 305, 307, 312, 314-321, 324-325, 327-340, 342-343, 345, 348-357, 360-362, 364-375, 377-378, 380-392, 395-396, 398-423, 425-435, 438-439, 441-446, 448, 450, 452-456, 458, 460, 462-463, 465-466, 468-469, 473-481, 483-492, 494, 496-497, 499-505, 508-509, 512-515, 518-520, 522-523, 525-529, 532-541, 543-551, 553-558, 560-570, 573-575, 577-583, 585 and 587-596), one or more of Compounds 1-69, 71-172, 174-176, 179-255). The package or dispenser may include a bottle, test tube, spray bottle or other dispenser. In certain embodiments of the present invention, the composition is packaged in concentrated form and diluted to the desired concentration when used by the end user. Generally, in these aspects, the composition may be formulated and packaged in a manner suitable for long-term storage to maintain the potency of the composition.

[0655] Synthesis

[0656] The present disclosure also provides synthetic methods for preparing the active compounds of the present disclosure (e.g., compounds having the structures of formula (I), (Ia), (Ib), (Ic), (II), (IIa), (IIb, (IIc), (IId), (IIe), (IIf), (IIg), (IIh), (Iii), (IIj), (III), (IIIa), (IIIb), (IIIc), (IIId), (IIIe), (IV), (IVa), or (IVb)) and compounds useful as intermediates in those synthetic methods. The method for producing a compound of formula (I) may include reacting (or contacting) a compound having the structure of formula (V)

[0657]

[0658] wherein Z B1 is independently selected from hydrogen, optionally unsaturated alkyl, halogen, and -Z 1 at each occurrence, and at least one Z B1 is a coupling group Z1;

[0659] with a compound having the structure of formula (VI):

[0660]

[0661] wherein Z 2 is a coupling group for coupling with Z 1 . In certain embodiments,

[0662] one of Z 1 or Z 2 is a boron-containing coupling moiety (e.g., dioxaborolane, dioxaborinane, or boric acid or borate ester such as a group selected from:

[0663]

[0664] and the other of Z 1 or Z 2 is a halide (e.g., Cl, Br, I); to produce a compound having the structure of formula (I). For example, the synthetic method may include coupling an intermediate having the structure of formula (Va) or (Vb):

[0665]

[0666] with an intermediate having the structure of formula (VIa)

[0667]

[0668] wherein Z is a halogen (e.g., Cl, Br, I)

[0669] to form a compound having the structure of formula (I):

[0670]

[0671] In certain embodiments, the synthetic method can include reacting a compound having the structure of formula (Vc) or (Vd):

[0672]

[0673] wherein Z is a halogen (e.g., Cl, Br, I);

[0674] with an intermediate having the structure of formula (VIb):

[0675]

[0676] to form a compound having the structure of formula (I):

[0677]

[0678] The coupling can occur under transition metal (transmateal)-catalyzed coupling conditions such as Buchwald-Hartwig coupling (e.g., with tBuXPhos, Pd 2 (dba) 3 , CuO, and combinations thereof), Negishi coupling, Suzuki coupling, Kumada coupling, or Stille coupling. For example, the intermediate can react in the presence of a metal catalyst under basic conditions (e.g., basic conditions generated by an organic base or an inorganic base in a solvent). In certain embodiments, the metal catalyst can be Pd(dppf)Cl 2 CH 2 Cl 2 , Pd(OAc) 2 , Pd(PPh 3 ) 4 , Ni(cod 2 ) or Ni(dppf)Cl 2 . The coupling can occur in a solvent selected from toluene, tetrahydrofuran, N,N-dimethylformamide, dioxane, water, and mixtures thereof. The basic conditions can be established by using a base dissolved in the solvent, where the base can be, for example, sodium carbonate, potassium carbonate, cesium carbonate, potassium carbonate, sodium hydroxide, barium hydroxide, potassium fluoride, cesium fluoride, and sodium tert-butoxide.

[0679] The following examples are provided to give a complete disclosure and description to those of ordinary skill in the art of how to make and use the assay, screening, and treatment methods of the present invention, and are not intended to limit the scope of what the inventors regard as their invention. Example

[0680] Example 1: High-throughput Ca V 3.3 Enhanced measurement

[0681] High-throughput assays capable of identifying inhibitors and enhancers (activators) are used to screen compounds. The assay involves a cell line expressing K ir 2.3 of the T-type Ca 2+ channel, and K ir 2.3 is an inward rectifier potassium channel that hyperpolarizes the cell to -70 mV. This inward rectifier potassium channel generates a physiological membrane potential in which most T-type Ca 2+ channels are available for opening. In addition, the assay involves a membrane-bound version of the stable and ultrasensitive Ca 2+ sensor GCaMP6s (GCaMP6s-CAAX). Similar assays have been described in Pan, J, et al., Methods MolBiol 1787 (2018): 235-252, and Baez-Nieto, D, et al., Brain (2017): awab443, which are hereby incorporated by reference in their entirety, particularly the content related to the high-throughput assay protocol.

[0682] Figure 1A A schematic diagram of the assay is provided, Figure 1B EC 10 KCl measurements for activity analysis and representative stimulus responses of EC90KCl are provided. Measurements are performed in triplicate, and the compounds are incubated with the cells for 1 hour and then the cells are challenged with an EC 10 KCl trigger.

[0683] Table 2 lists the EC ir of various compounds of the present disclosure measured by a fluorescence imaging plate reader (FLIPR) assay using the K 50 2.3 cell line and the GCamP6s-CAAX sensor. The EC 50 and the maximum response (EMax%) are determined by normalizing the response to the maximum response identified for KCl, and are fit to a 4-parameter logistic equation that determines the minimum response, the maximum response (EMax%), the concentration that gives half the maximum response (EC 50 ) and the slope factor of the response curve.

[0684] Table 2

[0685]

[0686]

[0687]

[0688]

[0689]

[0690]

[0691]

[0692]

[0693]

[0694]

[0695]

[0696]

[0697]

[0698]

[0699]

[0700]

[0701]

[0702]

[0703]

[0704]

[0705]

[0706]

[0707]

[0708]

[0709]

[0710]

[0711]

[0712]

[0713]

[0714]

[0715]

[0716]

[0717]

[0718]

[0719] It should be understood that if there are any inconsistencies between the SMILES strings provided in Table 1-2, all stereoisomers and mixtures of stereoisomers of the specified structures will be considered to be included in the present disclosure.

[0720] *The SMILES strings are provided without stereochemical information. Each chiral center provided by the SMILES string should be considered to have "or 1" stereochemistry. Compounds with multiple chiral centers (e.g., enantiomeric pairs of Compound 135 and Compound 435; enantiomeric pairs of Compound 63 and Compound 357) should be considered to have relative stereochemistry of "or 1, or 1" as shown in Table 1.

[0721] Example 2: Electrophysiology

[0722] Using an automated planar patch-clamp instrument (Syncropatch 384PE) that provides GΩ seals and precise voltage control, electrophysiological properties of three T-type Ca 2+ channels (Ca V 3.1, Ca V 3.2, and Ca V 3.3) were measured as described below and in Andrade, A. et al. Sci. Rep. 6 (2016): 34233, which is hereby incorporated by reference in its entirety, particularly the portions related to the patch clamp assay protocol. Figure 2 A schematic diagram of the electrophysiological assay is provided. Electrophysiological parameters such as voltage-current dependence representing the migration of ions across the membrane were measured in association with the administration of Compound 131 and Compound 7.

[0723]

[0724] Figure 3A Shows the measured current-voltage relationship associated with the administration of Compound 131 compared to DMSO, and Figure 3B -D respectively provide the voltage-dependent activation, current amplitude, and inactivation kinetics of Compound 131 split between each calcium channel. It can be seen that Compound 131 induces a left-shift in voltage-dependent activation and increases Ca V 3.3 channel current amplitude (but not the Ca V 3.1 or Ca V 3.2 channel current amplitude).

[0725] Figure 4A Shows the measured current-voltage relationship associated with the administration of Compound 7 compared to DMSO, and Figure 4B -D respectively provide the voltage-dependent activation, current amplitude, and inactivation kinetics of Compound 7 split between each calcium channel. It can be seen that Compound 7 increases Ca V 3.1 and Ca V 3.3 channel current amplitude (but not the Ca V 3.2 channel current amplitude).

[0726] Example 3: Ex vivo measurement: Brain slice electrophysiology

[0727] Ex vivo electrophysiological measurements were performed using mouse brain slice electrophysiology assays and analyzed as described in Ghosal, A., et al., Transl Psychiatry 10.1 (2020):29, which is hereby incorporated by reference in its entirety, particularly the content regarding brain slice electrophysiology assays. Briefly, the experiment measured the number of bursts in thalamic reticular nucleus (TRN) neurons of mouse brain slices exposed to the active compound. For the experiments described herein, Compound 7 having the following structure was measured relative to TRN bursts:

[0728]

[0729] 1 μM of Compound 7 was used in the assay. Figure 5A Provides the measured number of bursts, which was identified as an increase in the quality of the signal observed at all clamped potentials in the assay. Figure 5B Shows the threshold for rebound bursts, as identified by the decrease in the threshold voltage of the ionic current after administration of Compound 7 to TRN neurons. These results confirm that Ca V 3.3 enhancers increase TRN rebound bursts.

[0730] Compound 131 was also measured. As shown in Example 2, compound 131 is a Ca V 3.3 activator, and its mechanism of action is different from that of compound 7 (due to the additional Ca V 3.1 enhancement), and it has the structure:

[0731]

[0732] Figure 6A shows the number of measured bursts, while Figure 6B provides the neuronal rebound burst threshold measured in TRN neurons exposed to 5 μM of compound 131. The concentration of each compound measured in the assay was changed according to the EC 50 value. It can be seen that even with different mechanisms of action on T-type voltage-gated calcium channels, Ca V 3.3 activators can regulate TRN rebound bursts.

[0733] Example 4: In vivo pharmacokinetic measurement

[0734] Regarding the intraperitoneal administration of compound 57, the relationship between dose and pharmacokinetics was measured. Compound 57 was administered at 10 mg / kg or 30 mg / kg, and blood, plasma, unbound blood, unbound plasma, and cerebrospinal fluid concentrations were measured over 8 hours. Figure 7 Provides the concentration of each measured parameter. Table 3 provides the maximum brain concentration (C max ), area under the curve (AUC) after administration, brain half-life (T 1 / 2 ), plasma partition coefficient, and unbound plasma partition coefficient (K puu ) for each dose. By tripling the dose, the maximum concentration was able to increase 5-fold, and the brain AUC increased 7-fold.

[0735] Table 3

[0736]

[0737] Example 5: In mice administered with Ca V 3.3 enhancer behavioral assay

[0738] Ca V 3.3 knockout mice (Cacna1i - / - (KO) and Cacna1i + / - (Het)) and R1305H mutant knock-in mice (Cacna1i RH / RH (RH / RH) and Cacna1i + / RH (RH Het)) were generated. Mouse Ca VThe R1305H mutation in 3.3 corresponds to R1346H in the human channel:

[0739] Hu_CACNA1I 1340TRNITNRSDC 1349

[0740] Ms CACNA1I 1299TRNITNRSDC 1308

[0741] Mice were generated as described in Ghosal et al., Translational Psychiatry 10(2020):29, which is hereby incorporated by reference in its entirety, particularly with regard to Ca V 3.3 knockout mice and Ca V Generation of 3.3 RH knock-in mice.

[0742] Social interaction assays were performed on experimental wild-type (WT), knockout, and knock-in mice. Figure 8A A schematic of the social interaction assay used for mice is provided. Briefly, mice were acclimated in a three-chamber apparatus. After acclimation, cups were placed in the outermost chamber, with an age-, sex-, and strain-matched unfamiliar WT mouse placed under one cup. The social index of each experimental mouse was monitored as the ratio of the time each experimental mouse spent near the cup to the time the mouse spent under the cup (mouse-object / total time). Figure 8B Ca V Social index ratios of 3.3 knockout mice (Het and KO) compared to littermate control mice (WT) are provided. Heterozygous (Het) and homozygous (KO) knockout mice had significantly decreased social index scores compared to the WT control. Figure 8C Ca V Social index scores of 3.3 RH knock-in mice (Het and KO) compared to littermate control mice (WT) are provided. Heterozygous (RH Het) and homozygous (RH / RH) RH knock-in mice had significantly decreased social index scores compared to the WT control. Additionally, homozygous RH knock-in mice had significantly decreased social index scores compared to heterozygous RH knock-in mice.

[0743] Novel object recognition assays were also performed on experimental wild-type (WT), knockout, and knock-in mice. Figure 8D A schematic is provided. Briefly, mice were habituated to two identical objects (labeled as boxes in Figure 8D ) in a chamber. After 10 minutes of acclimation, a novel object (labeled as a star in Figure 8D ) replaced one of the familiar objects. The discrimination ratio was evaluated as the difference in the time the mouse spent between the novel object (star) and the familiar object (box). Figure 8EThe discrimination ratios of knockout mice were provided, where there were statistical differences between homozygous knockout (KO) mice and WT. Figure 8F The discrimination ratios of RH knock-in mice were provided, where there were statistical differences between homozygous (RH / RH) and heterozygous (RH Het) mice compared to WT.

[0744] Social interaction assays were performed on mice that received an intraperitoneal (IP) injection of compound 57 at 3 mg / kg, 10 mg / kg, or 30 mg / kg 60 minutes before the start of habituation. Figure 9A A schematic diagram of the assay protocol was provided. Figure 9B The social index ratios measured for heterozygous knockout mice were compared, indicating a statistically significant rescue of the social index ratio after an intraperitoneal injection of 10 mg / kg of compound 57. Figure 9 compares the social index ratios measured for homozygous RH knock-in mice (RH homo), indicating a statistically significant rescue of the social index ratio in mice administered 10 mg / kg of compound 57. Figure 9D The comparative social index ratios for each homozygous knockout mouse (KO / KO) were shown.

[0745] Novel object assays were also performed on mice that received an intraperitoneal injection of 3 mg / kg, 10 mg / kg, or 30 mg / kg of compound 57 60 minutes before habituation. Figure 10A A schematic diagram of the assay protocol was provided. Figure 10B The discrimination ratios of RH heterozygous knock-in mice (RH het) were compared, indicating a statistically significant rescue of the discrimination ratio at 30 mg / kg. Figure 10C The discrimination ratios of homozygous knockout mice (KO hom) were compared. The basal locomotion of wild-type mice administered at each test concentration was also measured. Administration of compound 57 at each concentration had no effect on basal locomotion for more than 80 minutes after administration ( Figure 10D ).

[0746] Novel object recognition assays were also performed on 5xFAD heterozygous mice. 5xFAD heterozygous mice exhibit amyloid deposition, gliosis, and progressive neuronal loss, along with cognitive and motor deficits, thus recapitulating many features of human Alzheimer's disease (AD). Figure 11A A schematic diagram of the novel visual recognition assay was provided. 5xFAD mice were administered 3 mg / kg, 10 mg / kg, or 30 mg / kg of compound 57 by intraperitoneal injection 60 minutes before habituation. Figure 11B The discrimination ratios of these mice were compared, indicating a rescue of the decreased object recognition in 5xFAD mice at higher doses (the most effective dose being 30 mg / kg).

[0747] Example 6: Effect on spindle wave density

[0748] EEG measurements were performed on wild-type, homozygous RH knock-in (R1305H / R1305H), and homozygous Ca V 3.3 knockout (Ca V 3.3 KO / KO) mice. Figure 12A is a schematic of the electrode positions for these measurements, showing an electrode in the frontal cortex (EEG2), an electrode in the parietal cortex (EEG1), reference electrode placement, ground electrode placement, and electromyography (EMG) electrode placement. The mice were placed in a soundproof EEG chamber and recording apparatus as Figure 12B shown. Figure 12C Demonstrates the administration paradigm. Mice were recorded for 12 hours (sleep cycle) during their light cycle. Initially, the mice were acclimated to the chamber and recording apparatus. After a one-day baseline recording, the mice were recorded as follows: one day after intraperitoneal administration of vehicle, then one day after intraperitoneal administration of 3 mg / kg of Compound 57, then one day after intraperitoneal administration of 10 mg / kg of Compound 57, then one day after intraperitoneal administration of 30 mg / kg of Compound 57. Figure 12D (wild-type), Figure 12E (R1305H homozygous knock-in), and Figure 12F (Ca V 3.3 knockout) mice showed spindle wave density measured for each mouse. It can be seen that 30 mg / kg of Compound 57 increased the 11 Hz sleep spindle wave density in WT male mice. Similar effects were observed in R1305H homozygous knock-in mice at 10 mg / kg and 30 mg / kg, but no effect was observed in Ca V 3.3 knockout mice. These data illustrate a measurement protocol that allows assessment of the treatment of compounds for disorders associated with spindle wave defects.

[0749] Example 7: Compound synthesis

[0750] The compounds of the present disclosure were synthesized as follows.

[0751] 4-[5-Fluoro-2-methyl-4-(1-methyl-1H-pyrazol-4-yl)benzenesulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_303, Compound 1)

[0752]

[0753] To a stirred solution of 4-(4-bromo-5-fluoro-2-methylbenzenesulfonyl)-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (0.95 g, 2.29 mmol) in room temperature was added a solution of 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (570 mg, 2.74 mmol) and potassium carbonate (948 mg, 6.86 mmol) in 1,4-dioxane (6 mL), and the reaction mixture was degassed with argon for 20 min. Subsequently, bis(cyclopent-1,3-dien-1-yl diphenylphosphine)palladium(II) dichloride (187 mg, 0.229 mmol) was added at room temperature and the reaction mixture was heated at 100 °C for 6 h. After completion, the reaction mixture was poured into water (40 mL) and extracted with EtOAc (3 × 30 mL). The organic layer was washed with brine solution (2 × 10 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (50:1 CH 2 Cl 2 / MeOH; 12S column) to afford 4-[5-fluoro-2-methyl-4-(1-methyl-1H-pyrazol-4-yl)benzenesulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (0.85 g, 89.5% yield) as an off-white solid.

[0754] 1H NMR (400 MHz, CDCl3) δ 7.88 (s, 1H), 7.84 (m, 1H), 7.73 (d, J = 10.1 Hz, 1H), 7.34 (d, J = 8.2 Hz, 1H), 7.06 (t, J = 8.2 Hz, 1H), 6.61 (d, J = 8.1 Hz, 1H), 6.40 (d, J = 8.2 Hz, 1H), 4.35 - 4.25 (m, 1H), 3.97 (s, 1H), 3.33 - 3.23 (m, 1H), 3.10 - 2.95 (m, 2H), 2.48 (s, 3H), 2.37 (s, 3H), 2.07 (s, 3H). MS (ESI): 415.3 [M+H]+.

[0755] (3S)-5-Fluoro-3,7-dimethyl-1-[[4-methyl-6-(4-methylimidazol-1-yl)-3-pyridinyl]sulfonyl]indoline and (3R)-5-fluoro-3,7-dimethyl-1-[[4-methyl-6-(4-methylimidazol-1-yl)-3-pyridinyl]sulfonyl]indoline (Broad_P_CaV3.3_673A and B) (Compound 2 and Compound 39)

[0756]

[0757] To a mixture of 1-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-5-fluoro-3,7-dimethyl-indoline (0.20 g, 0.501 mmol, 1.00 equiv), 4-methyl-1H-imidazole (0.16 g, 2.00 mmol, 4.00 equiv) and K 3 PO 4 (0.21 g, 1.00 mmol, 2.00 equiv) in 1,4-dioxane (4 mL) was added tBuXPhos (0.043 g, 0.100 mmol, 0.200 equiv) and Pd 2 (dba) 3 (0.046 g, 0.0501 mmol, 0.100 equiv) and it was degassed with argon for 15 min. Then the reaction mixture was heated at 120 °C for 16 h. After completion, the reaction mixture was diluted with water (100 mL) and extracted in ethyl acetate (100 mL × 3). The organic layer was dried over sodium sulfate and evaporated in vacuo. The resulting residue was purified by silica gel column chromatography using a solution of 60%-80% ethyl acetate in hexane. The product fractions were evaporated in vacuo and purified by preparative HPLC purification, using a Sunfire C8 (250*19) mm, 5 μ column with 30%-45% acetonitrile in water containing 0.1% formic acid as the mobile phase. The product fractions were lyophilized under reduced pressure to afford the racemic mixture (Broad_P_CaV3.3_673). The racemic mixture was further purified by chiral preparative HPLC, using a CHIRALCEL OX-H (250*21.0) mm, 5 μ column with a solution of 25% of 0.1% DEA in IPA:ACN (70:30) / 0.1% DEA in hexane as the mobile phase. The product fractions were evaporated in vacuo to afford the off-white solid of Broad_P_CaV3.3_673B (27 mg, 14% yield) and the off-white solid of Broad_P_CaV3.3_673A (14 mg, 7% yield).

[0758] 1H NMR (400 MHz, DMSO-d6) δ 8.87 (s, 1H), 8.55 - 8.47 (m, 1H), 7.81 (s, 1H), 7.71 (s, 1H), 7.03 (dd, J = 10.1, 2.7 Hz, 1H), 6.94 (dd, J = 8.2, 2.7 Hz, 1H), 4.32 (dd, J = 13.0, 7.3 Hz, 1H), 3.46 (dd, J = 13.0, 10.5 Hz, 1H), 2.60 (q, J = 5.5, 3.5 Hz, 1H), 2.42 (s, 3H), 2.18 (s, 3H), 2.12 (s, 3H), 1.01 (d, J = 6.6 Hz, 3H). MS (ESI): 401.0 [M + H]+.

[0759] 1-[(6-Bromo-4-methyl-3-pyridinyl)sulfonyl]-5-fluoro-3,7-dimethyl-indoline

[0760]

[0761] To a solution of 5-fluoro-3,7-dimethyl-indoline (0.20 g, 1.21 mmol, 1.00 equiv) in dichloromethane (5 mL) was added dropwise 6-bromo-4-methyl-pyridine-3-sulfonyl chloride (491 mg, 1.82 mmol, 1.50 equiv) and pyridine (0.49 mL, 6.05 mmol, 5.00 equiv), and the reaction mixture was stirred at room temperature for 24 h. After completion, the reaction mixture was diluted with water (100 mL) and extracted with dichloromethane (100 mL × 3). The organic layer was dried over sodium sulfate and evaporated in vacuo. The resulting residue was purified by silica gel column chromatography using a 1% - 2% solution of ethyl acetate in hexane. The product fractions were evaporated in vacuo to afford a brown semi-solid of Int-1403 (0.25 g, 0.545 mmol, 45% yield). MS (ESI): 401.4 [M + H]+.

[0762] 5-Fluoro-3,7-dimethyl-indoline

[0763]

[0764] At 0 °C, sodium cyanoborohydride (693 mg, 11.0 mmol, 3.00 equiv) was added portionwise to a solution of 5-fluoro-3,7-dimethyl-1H-indole (600 mg, 3.68 mmol, 1.00 equiv) in acetic acid (6 mL), and the reaction mixture was stirred at room temperature for 16 h. After completion, the reaction mixture was quenched with ice-cold water (150 mL), and the product was extracted with ethyl acetate (100 mL × 3). The organic layer was dried over sodium sulfate and evaporated in vacuo to give a residue. The residue was purified by silica gel column chromatography using a 5% ethyl acetate in hexanes solution. The product fractions were evaporated in vacuo to afford Int-1403 as a yellow oil (500 mg, 2.38 mmol, 65% yield). MS (ESI): 166.0 [M+H]+

[0765] 5-Fluoro-3,7-dimethyl-1H-indole

[0766]

[0767] At 0 °C, a solution of lithium aluminum hydride (1 M in tetrahydrofuran, 11.29 mL, 11.3 mmol, 2.50 equiv) was added to a solution of 5-fluoro-7-methyl-1H-indole-3-carbaldehyde (800 mg, 4.52 mmol, 1.00 equiv) in tetrahydrofuran (25 mL), and the reaction mixture was warmed and stirred to room temperature for 16 h. After completion, the reaction mixture was quenched with 2 mL of water and 5 mL of 2 M aqueous sodium hydroxide. The reaction mixture was filtered through diatomaceous earth and washed with ethyl acetate (50 mL). The organic layer was dried over sodium sulfate and evaporated in vacuo to give a residue. The residue was purified by silica gel column chromatography using a 10%-20% ethyl acetate in hexanes solution. The product fractions were evaporated in vacuo to afford Int-1388 as a brown semi-solid (600 mg, 3.51 mmol, 78% yield). MS (ESI): 162.0 [M-H]-

[0768] 5-Fluoro-7-methyl-1H-indole-3-carbaldehyde

[0769]

[0770] At 0 °C, phosphorus oxychloride (V) (0.75 mL, 8.05 mmol, 1.20 equiv) was added dropwise to a solution of 5-fluoro-7-methyl-1H-indole (1.00 g, 6.70 mmol, 1.00 equiv) in N,N-dimethylformamide (2.58 mL, 33.5 mmol, 5.00 equiv). The reaction mixture was warmed to room temperature and stirred for 2 h. After completion, the reaction mixture was quenched with ice water (30 mL) and basified with 2 M aqueous sodium hydroxide. The resulting brown solid was filtered, washed with water (100 mL) and dried in vacuo to afford Int-1387 (800 mg, 4.30 mmol, 64% yield). MS (ESI): 178.2 [M+H]+

[0771] 5-fluoro-7-methyl-1H-indole

[0772]

[0773] A mixture of 7-bromo-5-fluoro-1H-indole (2.00 g, 9.34 mmol, 1.00 equiv), methylboronic acid (839 mg, 14.0 mmol, 1.50 equiv) and cesium carbonate (9134 mg, 28.0 mmol, 3.00 equiv) in 1,4-dioxane (20 mL) was degassed for 5 minutes, and a complex of [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) with dichloromethane (763 mg, 0.934 mmol, 0.100 equiv) was added to the reaction mixture and heated at 100 °C for 16 h. After completion, the reaction mixture was diluted with water (150 mL) and the product was extracted with ethyl acetate (100 mL × 3). The organic layer was dried over sodium sulfate and evaporated in vacuo to give a residue. The residue was purified by silica gel column chromatography using a 10% solution of ethyl acetate in hexane. The product fractions were evaporated in vacuo to afford a brown semi-solid of Int-1386 (1.00 g, 6.70 mmol, 72% yield).

[0774] 1H NMR (400 MHz, DMSO-d6) δ 11.16 (s, 1H), 7.45 - 7.35 (m, 1H), 7.11 (dd, J = 9.9, 2.5 Hz, 1H), 6.77 (dd, J = 10.2, 2.4 Hz, 1H), 6.48 - 6.36 (m, 1H), 2.48 (s, 3H).

[0775] 7-bromo-5-fluoro-1H-indole

[0776]

[0777] At -70 °C, vinylmagnesium bromide (1 M solution in tetrahydrofuran, 68.18 mL, 68.2 mmol, 5.00 equiv) was added to a solution of 2-bromo-4-fluoro-1-nitro-benzene (3.00 g, 13.6 mmol, 1.00 equiv) in tetrahydrofuran (30 mL), and the reaction mixture was stirred for 1 h. After completion, the reaction mixture was quenched with water (250 mL) and filtered through a pad of diatomaceous earth, and washed with ethyl acetate (100 mL). The organic layer in the filtrate was dried over sodium sulfate and evaporated in vacuo to afford a residue. The residue was purified by silica gel column chromatography using a 10% solution of ethyl acetate in hexane. The product fractions were evaporated in vacuo to afford Int-1385 as a brown oil (1.50 g, 6.93 mmol, 51% yield). MS (ESI): 212.0 [M-H]-

[0778] Synthetic Scheme of Broad_P_CaV3.3_565 (Compound 3)

[0779]

[0780] (2-((4-Bromo-2-methylphenyl)sulfonylamino)-3-methylphenyl)carbamic acid tert-butyl ester: Intermediate-1

[0781]

[0782] At room temperature, 4-bromo-2-methyl-benzenesulfonyl chloride (5.09 g, 18.9 mmol, 1.50 equiv) was added to a stirred solution of N-(2-amino-3-methyl-phenyl)carbamic acid tert-butyl ester (2.80 g, 12.6 mmol, 1.00 equiv) and pyridine (5.09 mL, 63.0 mmol, 5.00 equiv) in dichloromethane (30 mL). The reaction mixture was stirred at the same temperature for 16 h. After completion, the reaction was quenched with water and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by silica gel column chromatography (8% ethyl acetate: hexanes as the mobile phase) to afford N-[2-[(4-bromo-2-methyl-phenyl)sulfonylamino]-3-methyl-phenyl]carbamic acid tert-butyl ester as an off-white solid (5.00 g, 10.6 mmol, 84% yield).

[0783] 1 1H NMR (400 MHz, DMSO-d 6)δ 9.36 (s, 1H), 7.67 (s, 1H), 7.62 (s, 1H), 7.56 (d, J = 13.2 Hz, 3H), 7.15 (t, J = 7.8 Hz, 1H), 6.92 (d, J = 7.7 Hz, 1H), 2.43 (s, 3H), 2.08 (s, 3H), 1.49 - 1.32 (m, 9H). MS(ESI): 455.3 [M + H] +

[0784] tert-Butyl 4-((4-bromo-2-methylphenyl)sulfonyl)-5-methyl-3,4-dihydroquinoxaline-1(2H)-carboxylate: Intermediate-2

[0785]

[0786] At room temperature, K 2 CO 3 (3.64 g, 26.4 mmol, 4.00 equivalents) was added to a stirred solution of tert-butyl N-[2-[(4-bromo-2-methylphenyl)sulfonylamino]-3-methylphenyl]carbamate (3.00 g, 6.59 mmol, 1.00 equivalent) and 1,2-dibromoethane (0.71 mL, 7.91 mmol, 1.20 equivalents) in DMF (20 mL). The reaction mixture was heated at 80 °C. After completion, the reaction mixture was poured into ice-cold water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL), dried over Na 2 SO 4 and evaporated in vacuo to afford tert-butyl 4-(4-bromo-2-methylphenyl)sulfonyl-5-methyl-2,3-dihydroquinoxaline-1-carboxylate (3.10 g, 6.18 mmol, 94% yield) as a yellow solid. MS(ESI): 427.2 [M - 56]+

[0787] 1H NMR (400 MHz, DMSO-d6) δ 7.90 (d, J = 8.6 Hz, 1H), 7.67 - 7.53 (m, 2H), 7.39 (s, 1H), 7.20 (t, J = 7.9 Hz, 1H), 7.04 (d, J = 7.6 Hz, 1H), 4.29 (d, J = 13.6 Hz, 1H), 3.30 (d, J = 10.7 Hz, 2H), 2.89 (s, 1H), 2.73 (s, 1H), 2.37 (s, 3H), 2.00 (s, 3H), 1.37 (s, 9H).

[0788] 1-((4-Bromo-2-methylphenyl)sulfonyl)-8-methyl-1,2,3,4-tetrahydroquinoxaline: Intermediate-3

[0789]

[0790] At 0 °C, a solution of HCl in 1,4-dioxane (4 M solution in dioxane, 20 mL, 80.0 mmol, 12.4 equivalents) was added to a stirred solution of tert-butyl 4-(4-bromo-2-methylphenyl)sulfonyl-5-methyl-2,3-dihydroquinoxaline-1-carboxylate (3.10 g, 6.44 mmol, 1.00 equivalent) in dichloromethane (30 mL). The reaction mixture was stirred at room temperature. After completion, the reaction mixture was concentrated in vacuo. The residue was washed with n-hexane (stripping) 3 - 4 times and the solid was dried in vacuo to afford 4-(4-bromo-2-methylphenyl)sulfonyl-5-methyl-2,3-dihydro-1H-quinoxaline; hydrochloride (2.60 g, 5.85 mmol, 91% yield) as a light brown solid.

[0791] 1H NMR (400 MHz, DMSO-d6) δ 7.84 (d, J = 8.5 Hz, 1H), 7.69 - 7.56 (m, 2H), 6.87 (t, J = 7.7 Hz, 1H), 6.37 (t, J = 8.9 Hz, 2H), 5.86 (s, 4H), 4.00 (s, 1H), 3.57 (s, 1H), 3.11 (s, 2H), 2.20 (s, 3H), 2.12 (s, 3H).

[0792] 1H NMR D2O (400 MHz, DMSO-d6) δ 7.84 (d, J = 8.6 Hz, 1H), 7.69 - 7.53 (m, 2H), 6.87 (t, J = 7.9 Hz, 1H), 6.37 (t, J = 9.7 Hz, 2H), 3.99 (s, 1H), 3.10 (s, 2H), 2.18 (d, J = 5.4 Hz, 3H), 2.11 (s, 3H), 1.24 (s, 1H). MS (ESI): 381.2 [M+H]+.

[0793] 4-((4-Bromo-2-methylphenyl)sulfonyl)-5-methyl-1-(methyl-d3)-1,2,3,4-tetrahydroquinoxaline: Intermediate-4

[0794]

[0795] At room temperature, K was added to a stirred solution of 4-(4-bromo-2-methylphenyl)sulfonyl-5-methyl-2,3-dihydro-1H-quinoxaline (500 mg, 1.31 mmol, 1.00 equivalent) and CD3I (1521 mg, 10.5 mmol, 8.00 equivalents) in DMF (5 mL). 2CO 3 (724 mg, 5.25 mmol, 4.00 equivalents). The reaction mixture was heated at 80 °C. After completion, the reaction mixture was poured into ice-cold water (50 mL), and a brown solid precipitated out, which was filtered and dried. Purification was carried out by column chromatography in 4% ethyl acetate:hexane to elute the desired product to afford 4-(4-bromo-2-methyl-phenyl)sulfonyl-5-methyl-1-(trideuteriomethyl)-2,3-dihydroquinoxaline as a white solid (370 mg, 0.901 mmol, 69% yield). MS (ESI): 398.2 [M+H]+

[0796] 1H NMR (400 MHz, DMSO-d6) δ 7.88 - 7.79 (m, 1H), 7.61 (dd, J = 5.9, 2.5 Hz, 2H), 7.03 (t, J = 7.9 Hz, 1H), 6.55 (d, J = 7.5 Hz, 1H), 6.47 (d, J = 8.2 Hz, 1H), 4.15 (dd, J = 15.2, 6.8 Hz, 1H), 3.25 (s, 1H), 2.98 (s, 1H), 2.80 (s, 1H), 2.26 (s, 3H), 2.00 (s, 3H).

[0797] 5-Methyl-1-(methyl-d3)-4-((2-methyl-4-(4-methyl-1H-imidazol-1-yl)phenyl)sulfonyl)-1,2,3,4-tetrahydroquinoxaline (Compound 3)

[0798]

[0799] A stirred suspension of 4-(4-bromo-2-methyl-phenyl)sulfonyl-5-methyl-1-(trideuteriomethyl)-2,3-dihydroquinoxaline (330 mg, 0.828 mmol, 1.00 equivalent), 4-methyl-1H-imidazole (204 mg, 2.49 mmol, 3.00 equivalents) and potassium tert-butoxide (283 mg, 2.49 mmol, 3.00 equivalents) in DMF (10 mL) was degassed with nitrogen for 15 min. After 15 min, Cu 2 O (24 mg, 0.166 mmol, 0.200 equivalent) was added thereto and it was heated at 80 °C. The progress of the reaction was monitored by TLC using 60% ethyl acetate:hexane as the mobile phase. After completion, the reaction mixture was diluted with ethyl acetate (100 mL) and washed with brine solution (3 × 70 mL). The organic layer was dried over Na 2 SO 4Dry and evaporate under vacuum. The residue was purified by combi flash using (80% ethyl acetate: hexane) as the mobile phase to give an impure product, which was then repurified by preparative HPLC using (A) aqueous solution of 0.1% FA (B) 100% ACN as the mobile phase to give 5-methyl-4-[2-methyl-4-(4-methylimidazol-1-yl)phenyl]sulfonyl-1-(trideuteriomethyl)-2,3-dihydroquinoxaline as a brown solid (6.7 mg, 0.0159 mmol, 2% yield). MS (ESI): 400.06 [M+H]+.

[0800] 1H NMR (400 MHz, DMSO-d6) δ 8.33 (s, 1H), 7.97 (d, J = 8.2 Hz, 1H), 7.62 (m, 3H), 7.02 (t, J = 7.7 Hz, 1H), 6.54 (d, J = 7.4 Hz, 1H), 6.45 (d, J = 8.1 Hz, 1H), 4.15 (d, J = 13.1 Hz, 1H), 3.25 (s, 1H), 2.97 (s, 1H), 2.81 (s, 1H), 2.28 (s, 3H), 2.17 (s, 3H), 2.06 (s, 3H).

[0801] 1,5-Dimethyl-4-[2-methyl-4-(2-methyl-1,3-oxazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_313, Compound 4)

[0802]

[0803] To a stirred solution of 4-(4-bromo-2-methylphenylsulfonyl)-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (200 mg, 0.5059 mmol) at room temperature was added a solution of 2-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3-oxazole (126 mg, 0.6070 mmol), potassium carbonate (208 mg, 1.51 mmol) in 1,4-dioxane (4 mL) and water (0.3 mL), and the reaction mixture was degassed with argon for 20 min, then bis(cyclopent-1,3-diene-1-yl diphenylphosphane) dichloromethane iron dichloride (2+) (41.3 mg, 0.05059 mmol) was added at room temperature, and the reaction mixture was heated at 100 °C for 7 h. After completion, the reaction mixture was poured into water (20 mL) and extracted with EtOAc (3 × 30 mL). The organic layer was washed with brine solution (2 × 20 mL), over Na 2 SO 4Dry and evaporate. The product was added to a preparative HPLC column and eluted with a gradient of 35 - 40% ACN in 0.1% aqueous formic acid to afford 1,5-dimethyl-4-[2-methyl-4-(2-methyl-1,3-oxazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline as a white solid (45 mg, 22.0% yield).

[0804] 1H NMR (400 MHz, DMSO-d6) δ 7.96 (d, J = 8.3 Hz, 1H), 7.73 (s, 1H), 7.64 (m, 2H), 7.01 (t, J = 7.8 Hz, 1H), 6.53 (d, J = 7.5 Hz, 1H), 6.45 (d, J = 8.1 Hz, 1H), 4.13 (s, 1H), 3.31 (s, 4H), 2.96 (s, 1H), 2.80 (s, 1H), 2.40 (s, 3H), 2.26 (s, 3H), 2.03 (s, 3H). MS (ESI): 398.3 [M+H]+.

[0805] 4-[2-Fluoro-6-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_302, Compound 5)

[0806]

[0807] To a stirred solution of 4-(4-bromo-2-fluoro-6-methylphenylsulfonyl)-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (0.8 g, 1.93 mmol) at room temperature was added a solution of 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (480 mg, 2.31 mmol), potassium carbonate (800 mg, 5.79 mmol) in 1,4-dioxane (8 mL), and the reaction mixture was degassed with argon for 20 min. Subsequently, bis(cyclopentadienyl-1,3-diene-1-yl diphenylphosphine) dichloromethane iron dichloride (2+) (157 mg, 0.1930 mmol) was added at room temperature, and the reaction mixture was heated at 100 °C for 6 h. After completion, the reaction mixture was poured into water (40 mL) and extracted with EtOAc (3×30 mL). The organic layer was washed with brine solution (2×10 mL), dried over Na 2 SO 4 Dry and evaporate. The residue was purified by Biotage (50:1 CH 2 Cl 2Purified by silica gel column chromatography (petroleum ether / ethyl acetate = 3 / 1, 12S column) to give 4-[2-fluoro-6-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline as an off-white solid (0.3 g, 36.7% yield).

[0808] 1H NMR (400 MHz, chloroform-d) δ 7.77 (s, 1H), 7.66 (s, 1H), 7.13 - 6.98 (m, 3H), 6.62 (d, J = 7.5 Hz, 1H), 6.40 (d, J = 8.0 Hz, 1H), 4.50 (s, 1H), 3.96 (s, 3H), 3.33 (s, 2H), 3.03 (s, 1H), 2.51 (s, 3H), 2.32 (s, 3H), 2.22 (s, 3H). MS (ESI): 415.5 [M+H]+.

[0809] 5-Fluoro-4,8-dimethyl-1-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_299, Compound 6)

[0810]

[0811] To a stirred solution of 1-(4-bromo-2-methylphenylsulfonyl)-5-fluoro-4,8-dimethyl-1,2,3,4-tetrahydroquinoxaline (0.04 g, 0.09677 mmol, 1 equiv) at room temperature was added a solution of 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (0.024 mg, 0.0001153 mmol, 0.001 equiv) and potassium carbonate (13.3 mg, 0.09677 mmol, 1.0 equiv) in dioxane (4 mL), and the reaction mixture was degassed with argon for 20 min. Subsequently, bis(cyclopentyl(diphenylphosphine))iron(II) dichloride palladium(II) (80.0 mg, 0.09677 mmol, 1.0 equiv) was added at room temperature, and the reaction mixture was heated at 80 °C for 16 h. After completion, the reaction mixture was poured into water (25 mL) and extracted with EtOAc (3 × 25 mL). The organic layer was washed with brine solution (2 × 10 mL), dried over Na 2 SO 4 and evaporated. The product was loaded onto a preparative HPLC column and eluted with a gradient of 35 - 70% ACN in 0.1% aqueous formic acid to give 5-fluoro-4,8-dimethyl-1-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline as a white solid (0.00568 g, 14.1% yield).

[0812] 1H NMR (400 MHz, DMSO-d6) δ 2.10 (s, 3H), 2.20 (s, 3H), 2.46 (d, J = 4.3 Hz, 3H), 2.62 (s, 1H), 3.10 (s, 1H), 3.24 (s, 1H), 3.87 (s, 3H), 4.18 (s, 1H), 6.58 (dd, J = 8.6, 5.3 Hz, 1H), 6.96 (dd, J = 13.4, 8.4 Hz, 1H), 7.55 - 7.67 (m, 2H), 7.85 (d, J = 8.2 Hz, 1H), 7.99 (s, 1H), 8.30 (s, 1H).

[0813] 1,5-Dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_CaV3.3_259, Compound 7)

[0814]

[0815] At room temperature, a solution of triethylamine (89.8 mg, 888 μmol, 2 equiv) and iodomethane (75.5 mg, 532 μmol, 1.2 equiv) in dichloromethane (5 mL) was added to a stirred solution of 8-methyl-1-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl] (0.17 g, 444 μmol, 1 equiv), and the reaction mixture was stirred at room temperature for 12 h. After completion, the reaction mixture was poured into water (50 mL) and extracted with DCM (3 × 50 mL). The organic layer was washed with brine solution (2 × 10 mL) and dried over Na 2 SO 4 and evaporated. The crude product was purified by flash chromatography using [0 - 50% EtOAc / hexane] to give an impure product, which was further purified by preparative HPLC using (05 - 70% ACN in water containing 0.1% formic acid as a modifier) as the mobile phase to give 1,5-dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenyl as a white solid (0.004 g, 3% yield).

[0816] 1H NMR (400 MHz, chloroform-d) δ 7.93 (d, J = 8.2 Hz, 1H), 7.80 (s, 1H), 7.68 (s, 1H), 7.33 (dd, J = 8.3, 1.9 Hz, 1H), 7.27 (s, 1H), 7.04 (t, J = 7.9 Hz, 1H), 6.59 (d, J = 7.6 Hz, 1H), 6.39 (d, J = 8.1 Hz, 1H), 4.34 - 4.19 (m, 1H), 3.96 (s, 3H), 3.25 (s, 1H), 2.98 (q, J = 9.0, 7.4 Hz, 2H), 2.47 (s, 3H), 2.35 (s, 3H), 2.13 (s, 3H).

[0817] 1,5-Dimethyl-4-[2-methyl-4-(2-methyl-1,3-thiazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_312, Compound 8)

[0818]

[0819] At room temperature, to a stirred solution of 1,5-dimethyl-4-[2-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (100 mg, 0.2260 mmol) was added a solution of 5-bromo-2-methyl-1,3-thiazole (48.2 mg, 0.2712 mmol) and potassium carbonate (93.6 mg, 0.6779 mmol) in 1,4-dioxane (3 mL) and water (0.3 mL). The reaction mixture was degassed with argon for 20 min, then at room temperature, bis(cyclopent-1,3-diene-1-yl diphenylphosphane)dichloromethane iron dichloropalladium(2+) (18.4 mg, 0.02260 mmol) was added, and the reaction mixture was heated at 100 °C for 5 h. After completion, the reaction mixture was poured into water (30 mL) and extracted with EtOAc (3 × 20 mL). The organic layer was washed with brine solution (2 × 20 mL), dried over Na 2 SO 4 and evaporated. The product was loaded onto a preparative HPLC column and eluted with a gradient of 40 - 50% ACN in 0.1% aqueous formic acid to afford 1,5-dimethyl-4-[2-methyl-4-(2-methyl-1,3-thiazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline as a white solid (44 mg, 47.1% yield).

[0820] 1H NMR (400 MHz, DMSO-d6) δ 8.21 (s, 1H), 7.91 (d, J = 8.5 Hz, 1H), 7.61 (d, J = 7.5 Hz, 2H), 7.01 (t, J = 7.9 Hz, 1H), 6.53 (d, J = 7.5 Hz, 1H), 6.45 (d, J = 8.1 Hz, 1H), 4.13 (d, J = 9.9 Hz, 1H), 3.23 (s, 1H), 2.97 (s, 1H), 2.82 (d, J = 8.1 Hz, 1H), 2.70 (s, 3H), 2.40 (s, 3H), 2.26 (s, 3H), 2.04 (s, 3H). MS (ESI): 414.0 [M+H]+.

[0821] Synthesis of Compound 9

[0822]

[0823] 4-[4-(4-Ethyl-1H-imidazol-1-yl)-2-methylphenyl]sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline: (Broad_P_CaV3.3_347, Compound 9)

[0824]

[0825] A stirred solution of 4-(4-bromo-2-methylphenyl)sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline (0.15 g, 0.379 mmol, 1.00 equiv) and 4-ethyl-1H-imidazole (0.036 g, 0.379 mmol, 1.00 equiv) in dimethylformamide (5 mL) was degassed with nitrogen for 15 min. After 15 min, cuprous oxide (I) (0.011 g, 0.0759 mmol, 0.200 equiv) and potassium tert-butoxide (0.13 g, 1.14 mmol, 3.00 equiv) were added thereto, and it was heated at 150 °C in a sealed tube for 96 h. After 96 h, the reaction mixture was poured into cold water (50 mL) and extracted with ethyl acetate (3 × 30 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated. The residue was purified by combiflash using ethyl acetate:hexane (1:1) as the mobile phase to afford 4-[4-(4-cyclopropyl-1H-imidazol-1-yl)-2-methylphenyl]sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline Broad_P_CaV3.3_347 (0.017 g, 0.0422 mmol, 11% yield) as an off-white solid.

[0826] MS: [M+H]+ 411.00

[0827] 1 1H NMR (400 MHz, DMSO-d 6 ) δ 8.56 (s, 1H), 7.99 (s, 1H), 7.69 (s, 3H), 7.02 (s, 1H), 6.50 (d, J = 33.2 Hz, 2H), 3.25 (s, 2H), 2.97 (s, 2H), 2.81 (s, 2H), 2.41 (s, 4H), 2.27 (s, 3H), 2.05 (s, 3H), 1.21 (s, 3H).

[0828] (3S)-5-Fluoro-3,7-dimethyl-1-[2-methyl-4-(4-methylimidazol-1-yl)phenyl]sulfonyl-indoline and (3R)-5-fluoro-3,7-dimethyl-1-[2-methyl-4-(4-methylimidazol-1-yl)phenyl]sulfonyl-indoline (Broad_P_CaV3.3_661A and B) (Compound 10 and Compound 207)

[0829]

[0830] To a mixture of 1-(4-bromo-2-methyl-phenyl)sulfonyl-5-fluoro-3,7-dimethyl-indoline (250 mg, 0.628 mmol, 1.00 equiv), 4-methylimidazole (206 mg, 2.51 mmol, 4.00 equiv), and potassium tert-butoxide (211 mg, 1.88 mmol, 3.00 equiv) in dimethylformamide (5 mL) was added copper(I) oxide (45 mg, 0.314 mmol, 0.500 equiv), and the reaction mixture was heated at 140 °C for 16 h. After completion, the reaction mixture was diluted with water (100 mL) and extracted with ethyl acetate (100 mL × 3). The organic layer was dried over sodium sulfate and evaporated in vacuo. The resulting residue was purified by silica gel column chromatography using a solution of 60%-80% ethyl acetate in hexane. The product fractions were evaporated in vacuo and purified by preparative HPLC using a Phenomenex C8 (250*21.2) mm, 5 μ column with 30%-45% acetonitrile in water containing 0.1% formic acid as the mobile phase. The product fractions were lyophilized under reduced pressure to afford the racemic mixture (Broad_P_CaV3.3_661). The racemic mixture was further purified by chiral preparative HPLC using a CHIRALCEL OX-H (250*21.0) mm, 5 μ column with a solution of 40% of 0.1% DEA in IPA:ACN (70:30) / 0.1% DEA in hexane as the mobile phase. The product fractions were evaporated in vacuo to afford a light brown solid of Broad_P_CaV3.3_661A (19 mg, 0.0486 mmol, 100% purity, 8% yield) and a light brown solid of Broad_P_CaV3.3_661B (9.4 mg, 0.0235 mmol, 4% yield).

[0831] Broad_P_CaV3.3_661A

[0832] 1H NMR (400 MHz, DMSO-d6) δ 8.33 (s, 1H), 7.98 (d, J = 8.3 Hz, 1H), 7.69 (d, J = 8.5 Hz, 2H), 7.59 (s, 1H), 6.96 (ddd, J = 23.4, 9.2, 2.7 Hz, 2H), 4.20 (dd, J = 12.8, 7.3 Hz, 1H), 3.41 (dd, J = 12.0, 8.0 Hz, 1H), 3.41 (d, J = 2.5 Hz, 1H), 2.39 (s, 3H), 2.16 (d, J = 5.5 Hz, 6H), 0.99 (d, J = 6.7 Hz, 3H). MS (ESI): 400.0 [M+H]+

[0833] Broad_P_CaV3.3_661B

[0834] 1H NMR (400 MHz, DMSO-d6) δ 8.35 (s, 1H), 7.99 (t, J = 8.2 Hz, 1H), 7.71 (d, J = 8.5 Hz, 2H), 7.61 (s, 1H), 6.98 (ddd, J = 23.4, 9.2, 2.7 Hz, 2H), 4.22 (dd, J = 12.8, 7.3 Hz, 1H), 3.46 - 3.40 (m, 1H), 2.63 (s, 1H), 2.41 (s, 3H), 2.18 (d, J = 5.4 Hz, 6H), 1.01 (d, J = 6.7 Hz, 3H). MS (ESI): 400.0 [M + H]+.

[0835] Synthesis of Compound 5 and Compound 134

[0836]

[0837] N-(3-Fluoro-2-methyl-phenyl)acetamide: Intermediate - 790

[0838]

[0839] To a solution of 3-fluoro-2-methyl-aniline (7.00 g, 55.9 mmol, 1.00 equiv) in dichloromethane (70 mL) at 0 °C was added dropwise acetic anhydride (7.92 mL, 83.9 mmol, 1.50 equiv). The mixture was stirred at room temperature for 2 h. After 2 h, the mixture was quenched with cold water (500 mL) and extracted with MDC (2 × 60 mL). The organic layer was dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (20:1 Hex / EtOAc; 12S column) to afford N-(3-fluoro-2-methyl-phenyl)acetamide Broad_P_CaV3.3_400_Int_790 as a pale yellow oil (8.20 g, 47.5 mmol 85% yield) 16.4% yield).

[0840] MS: [M + H]+ 167.18.

[0841] (2-Acetamido-4-fluoro-3-methyl-phenyl)-hydroxy-oxo-ammonium: Intermediate - 791

[0842]

[0843] At -5 °C, nitric acid (5.94 mL, 142 mmol, 3.00 equivalents) was added dropwise to a solution of N-(3-fluoro-2-methyl-phenyl)acetamide (8.20 g, 47.5 mmol, 1.00 equivalent) in sulfuric acid (3.8 mL, 71.2 mmol, 1.50 equivalents). The mixture was stirred at this temperature for 1 hour. The mixture was quenched with water (30 mL) to form a solid product, which was filtered. The solid product afforded (2-acetamido-4-fluoro-3-methyl-phenyl)-hydroxy-oxo-ammonium Broad_P_CaV3.3_400_Int_791 (7.00 g, 32.8 mmol, 69% yield) as a white solid.

[0844] MS: [M+H]+ 213.30.

[0845] (2-Amino-4-fluoro-3-methyl-phenyl)-hydroxy-oxo-ammonium: Intermediate-792

[0846]

[0847] A solution of (2-acetamido-4-fluoro-3-methyl-phenyl)-hydroxy-oxo-ammonium (7.00 g, 32.8 mmol, 1.00 equivalent) in tetrahydrofuran (35 mL) was added to a solution of sodium hydroxide (2.63 g, 65.7 mmol, 2.00 equivalents) in water (35 mL) at 0 °C, and the resulting mixture was stirred at room temperature for 5 h. The reaction mixture was diluted with water (50 mL) and acidified with dilute HCl (20 mL), and extracted with EtOAc (3 × 120 mL). The organic layer was dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (5:1 Hex / EtOAc; 12S column) to afford (2-amino-4-fluoro-3-methyl-phenyl)-hydroxy-oxo-ammonium (Broad_P_CaV3.3_400_Int_792 (2.50 g, 14.6 mmol, 44% yield) as a brown solid.

[0848] 1 1H NMR (400 MHz, DMSO-d 6 ) δ 7.97 (dd, J = 9.7, 5.9 Hz, 1H), 7.41 (s, 2H), 6.53 (t, J = 9.0 Hz, 1H), 2.07 (t, J = 4.4 Hz, 3H).

[0849] 4-Fluoro-3-methyl-benzene-1,2-diamine: Intermediate-792A

[0850]

[0851] A solution of (2-amino-4-fluoro-3-methyl-phenyl)-hydroxy-oxo-ammonium (2.50 g, 14.6 mmol, 1.00 equiv) in acetic acid (25 mL) was added portionwise to zinc powder (5.73 g, 87.6 mmol, 6.00 equiv) at 25 °C, and the resulting mixture was stirred at room temperature for 6 h. The reaction mixture was diluted with water (30 mL), and then the pH was adjusted to 7 with sodium bicarbonate solution, and then extracted with EtOAc (3 × 30 mL). The organic layer was dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (8:2 Hex / EtOAc; 24S column) to afford 4-fluoro-3-methyl-benzene-1,2-diamine as a pale yellow oil (Broad_P_CaV3.3_400_Int_792A (1.30 g, 7.51 mmol, 51% yield).

[0852] MS: [M+H]+ 141.10

[0853] tert-Butyl N-(2-amino-4-fluoro-3-methyl-phenyl)carbamate: Intermediate-793

[0854]

[0855] A solution of 4-fluoro-3-methyl-benzene-1,2-diamine (1.30 g, 7.51 mmol, 1.00 equiv) in dichloromethane (10 mL) was added to triethylamine (1.05 mL, 7.51 mmol, 1.00 equiv) at 0 °C, and then di-tert-butyl dicarbonate (0.86 mL, 3.76 mmol, 0.500 equiv) was added at 0 °C, and the resulting mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water (10 mL) and extracted with EtOAc (3 × 20 mL). The organic layer was dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (5:1 Hex / EtOAc; 12S column) to afford tert-Butyl N-(2-amino-4-fluoro-3-methyl-phenyl)carbamate as a white solid (Broad_P_CaV3.3_400_Int_793 (1.10 g, 4.58 mmol, 61% yield).

[0856] 1 H NMR (400 MHz, DMSO-d 6 ) δ 8.23 (s, 1H), 6.94 (t, J = 7.4 Hz, 1H), 6.32 (t, J = 9.0 Hz, 1H), 4.85 (s, 2H), 1.98 (s, 3H), 1.44 (s, 9H).

[0857] tert-Butyl N-[2-[(4-bromo-2-fluoro-6-methylphenyl)sulfonylamino]-4-fluoro-3-methylphenyl]carbamate: Intermediate-794

[0858]

[0859] At room temperature, a solution of tert-butyl N-(2-amino-4-fluoro-3-methylphenyl)carbamate (1.10 g, 4.58 mmol, 1.00 equiv) in dichloromethane (10 mL) was added to pyridine (1.48 mL, 18.3 mmol, 4.00 equiv), and then 5-bromo-1-fluoro-3-methyl-2-methylsulfonyl-benzene (3.67 g, 13.7 mmol, 3.00 equiv) was added. The resulting mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water (10 mL) and extracted with EtOAc (3 × 20 mL). The organic layer was dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (8:2 Hex / EtOAc; 12S column) to afford tert-butyl N-[2-[(4-bromo-2-fluoro-6-methylphenyl)sulfonylamino]-4-fluoro-3-methylphenyl]carbamate (Broad_P_CaV3.3_400_Int_794) as a yellow solid (1.00 g, 1.77 mmol, 39% yield). MS: [M+H]+ 391.3.

[0860] N-(6-Amino-3-fluoro-2-methylphenyl)-4-bromo-2-fluoro-6-methylbenzenesulfonamide: Intermediate-794A

[0861]

[0862] At 0 °C, a solution of tert-butyl N-[2-[(4-bromo-2-fluoro-6-methylphenyl)sulfonylamino]-4-fluoro-3-methylphenyl]carbamate (1.00 g, 1.77 mmol, 1.00 equiv) in dichloromethane (5 mL) was added to a solution of 4.0 M hydrogen chloride in dioxane (5 mL, 1.77 mmol, 1.00 equiv), and the resulting mixture was stirred at room temperature for 3 h. The reaction mixture was diluted with water (10 mL) and extracted with MDC (3 × 20 mL). The organic layer was dried over Na 2 SO 4Dry and evaporate. Purify the residue by Biotage (8:2 Hex / EtOAc; 12S column) to afford N-(6-amino-3-fluoro-2-methyl-phenyl)-4-bromo-2-fluoro-6-methyl-benzenesulfonamide as a white solid (Broad_P_CaV3.3_400_Int_794A (0.60 g, 1.53 mmol, 87% yield).

[0863] 1H NMR (400 MHz, DMSO-d6) δ 10.14 (s, 1H), 7.64 (dd, J = 10.5, 2.0 Hz, 1H), 7.51 (s, 1H), 7.05 (t, J = 8.9 Hz, 1H), 6.88 (d, J = 6.6 Hz, 1H), 2.37 (s, 3H), 1.74 (d, J = 2.6 Hz, 3H).

[0864] 4-(4-Bromo-2-fluoro-6-methyl-phenyl)sulfonyl-6-fluoro-5-methyl-2,3-dihydro-1H-quinoxaline: Intermediate-795

[0865]

[0866] At 25 °C, a solution of N-(6-amino-3-fluoro-2-methyl-phenyl)-4-bromo-2-fluoro-6-methyl-benzenesulfonamide (0.60 g, 1.53 mmol, 1.00 equiv) in dimethylformamide (10 mL) was added to potassium carbonate (0.42 g, 3.07 mmol, 2.00 equiv), and then 1,2-dibromoethane (0.16 mL, 1.84 mmol, 1.20 equiv) was added. The resulting mixture was stirred at 100 °C for 3 h. The reaction mixture was diluted with water (20 mL) and extracted with EtOAc (3 × 25 mL). The organic layer was dried over Na 2 SO 4 Dry and evaporate. Purify the residue by Biotage (8:2 Hex / EtOAc; 12S column) to afford 4-(4-bromo-2-fluoro-6-methyl-phenyl)sulfonyl-6-fluoro-5-methyl-2,3-dihydro-1H-quinoxaline Broad_P_CaV3.3_400_Int_795_ (0.45 g, 0.927 mmol, 60% yield) as a white solid.

[0867] MS: [M+H]+ 417.27.

[0868] 6-Fluoro-4-[2-fluoro-6-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-5-methyl-2,3-dihydro-1H-quinoxaline: Broad_P_CaV3.3_453, Compound 134

[0869]

[0870] A stirred suspension of 4-(4-bromo-2-fluoro-6-methylphenyl)sulfonyl-6-fluoro-5-methyl-2,3-dihydro-1H-quinoxaline (0.45 g, 0.927 mmol, 1.00 equiv), 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazole (0.29 g, 1.39 mmol, 1.50 equiv), and potassium carbonate (0.38 g, 2.78 mmol, 3.00 equiv) in 1,4-dioxane (8 mL) and water (2 mL) was degassed with nitrogen for 15 min. After 15 min, (1,1'-bis(diphenylphosphino)ferrocene)palladium(II) dichloride (0.014 g, 0.0185 mmol, 0.0200 equiv) was added thereto, and the mixture was heated at 100 °C for 4 h. After 4 h, the reaction mixture was diluted with water (10 mL) and extracted with ethyl acetate (3 × 10 mL). The organic layer was dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (5:1 Hex / EtOAc; 12S column) to give an impure product, which was further purified by preparative HPLC using (25-70% ACN in water containing 5 mM ammonium carbonate and 0.1% aqueous ammonia solution as a modifier) as the mobile phase to give 6-fluoro-4-[2-fluoro-6-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-5-methyl-2,3-dihydro-1H-quinoxaline as an off-white solid 4-(4-bromo-2-fluoro-6-methylphenyl)sulfonyl-6-fluoro-5-methyl-2,3-dihydro-1H-quinoxaline (0.45 g, 0.927 mmol). 1 1H NMR (400 MHz, DMSO-d 6 ) δ 8.34 (s, 1H), 8.04 (s, 1H), 7.47 (d, J = 12.1 Hz, 2H), 6.84 (t, J = 9.2 Hz, 1H), 6.36 (dd, J = 9.0, 5.5 Hz, 1H), 5.86 (s, 1H), 4.06 (s, 1H), 3.87 (s, 3H), 3.13 (s, 2H), 2.82 (s, 1H), 2.33 (s, 3H), 2.14 - 2.03 (m, 3H). MS: [M+H]+ 419.6.

[0871] 6-Fluoro-4-[2-fluoro-6-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline: Broad_P_CaV3.3_400, Compound 5

[0872]

[0873] A solution of 6-fluoro-4-[2-fluoro-6-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-5-methyl-2,3-dihydro-1H-quinoxaline (0.22 g, 0.519 mmol, 1.00 equiv), dimethylformamide (5 mL), and iodomethane (0.04 mL, 0.622 mmol, 1.20 equiv) was stirred at 100 °C for 3 h. After completion of the reaction, the reaction mixture was quenched in water (5 mL) and extracted with ethyl acetate (3 × 10 mL). The organic layer was dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (5:1 Hex / EtOAc; 12S column) to afford an impure product, which was further purified by preparative HPLC using (25-70% ACN in water containing 5 mM ammonium carbonate and 0.1% aqueous ammonia as a modifier) as the mobile phase to afford 6-fluoro-4-[2-fluoro-6-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline Broad_P_CaV3.3_400 as an off-white solid (0.014 g, 0.0301 mmol, 6% yield).

[0874] MS: [M+H]+ 361.0.

[0875] 1 1H NMR (400 MHz, DMSO-d 6 ) δ 8.34 (s, 1H), 8.04 (s, 1H), 7.51 - 7.35 (m, 2H), 6.98 (t, J = 9.2 Hz, 1H), 6.47 (dd, J = 9.1, 5.3 Hz, 1H), 4.24 (d, J = 25.5 Hz, 1H), 3.86 (s, 3H), 3.00 (s, 1H), 2.91 (d, J = 9.9 Hz, 1H), 2.43 (s, 3H), 2.24 (s, 3H), 2.16 (d, J = 2.5 Hz, 3H).

[0876] 4-[4-(5-Fluoro-1-methyl-1H-pyrazol-4-yl)-2-methylbenzenesulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_309, Compound 12)

[0877]

[0878] At room temperature, a solution of potassium carbonate (84.3 mg, 0.6102 mmol) in 1,4-dioxane (3 mL) and water (0.3 mL) was added to a stirred solution of 1,5-dimethyl-4-[2-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzenesulfonyl]-1,2,3,4-tetrahydroquinoxaline (90 mg, 0.2034 mmol), and the reaction mixture was degassed with argon for 20 min. Subsequently, bis(cyclopent-1,3-diene-1-yl diphenylphosphine)dichloromethane iron dichloropalladium(2+) (16.6 mg, 0.02034 mmol) was added at room temperature, and the reaction mixture was heated at 100 °C for 8 h. After completion, the reaction mixture was poured into water (20 mL) and extracted with EtOAc (3 × 20 mL). The organic layer was washed with brine solution (2 × 20 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (50:1 CH 2 Cl 2 / MeOH; 12S column) to afford 4-[4-(5-fluoro-1-methyl-1H-pyrazol-4-yl)-2-methylbenzenesulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (60 mg, 69.2% yield) as a white solid.

[0879] 1H NMR (400 MHz, DMSO-d6) δ 7.99 (d, J = 3.1 Hz, 1H), 7.91 (d, J = 8.3 Hz, 1H), 7.57 - 7.45 (m, 2H), 7.00 (t, J = 7.8 Hz, 1H), 6.52 (d, J = 7.5 Hz, 1H), 6.45 (d, J = 8.1 Hz, 1H), 4.15 - 4.06 (m, 1H), 3.76 (s, 3H), 3.22 (s, 1H), 2.96 (s, 1H), 2.78 (d, J = 9.4 Hz, 1H), 2.41 (s, 3H), 2.26 (s, 3H), 2.03 (s, 3H). MS (ESI): 415.2 [M+H]+.

[0880] 1,5-Dimethyl-4-[[4-methyl-6-(4-methylimidazol-1-yl)-3-pyridinyl]sulfonyl]-2,3-dihydroquinoxaline (Broad_P_CaV3.3_356, Compound 13)

[0881]

[0882] At 0 °C, 4-methylimidazole (83 mg, 1.01 mmol, 2.00 eq) was added to a stirred solution of 4-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-1,5-dimethyl-2,3-dihydroquinoxaline (200 mg, 0.505 mmol, 1.00 eq) in DMF (2 mL), and the mixture was stirred at the same temperature for 30 min. After 30 min, a suspension of 60% sodium hydride in paraffin oil (26 mg, 0.757 mmol, 1.50 eq) was added thereto, and the mixture was stirred at room temperature for 16 h. After completion, the reaction mixture was poured into cold water (20 mL) and extracted with ethyl acetate (3 × 20 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated. The residue was purified by Combi-flash machine using ethyl acetate:hexanes (3:7) to give an impure compound, which was further purified by preparative HPLC using (25 - 50% ACN in water containing 0.1% formic acid as a modifier) as the mobile phase to give 1,5-dimethyl-4-[[4-methyl-6-(4-methylimidazol-1-yl)-3-pyridinyl]sulfonyl]-2,3-dihydroquinoxaline as a white solid (40 mg, 19.9% yield).

[0883] 1H NMR (400 MHz, DMSO-d6) δ 8.83 (s, 1H), 8.48 (s, 1H), 7.72 (d, J = 11.8 Hz, 2H), 7.05 (t, J = 7.9 Hz, 1H), 6.59 (d, J = 7.5 Hz, 1H), 6.45 (d, J = 8.1 Hz, 1H), 4.28 (dd, J = 14.8, 7.4 Hz, 1H), 3.27 (dd, J = 14.4, 7.2 Hz, 1H), 2.97 (dd, J = 11.4, 6.5 Hz, 1H), 2.86 (dd, J = 11.5, 8.0 Hz, 1H), 2.33 (d, J = 3.1 Hz, 6H), 2.17 (s, 3H), 1.97 (s, 3H). MS (ESI): 398.0 [M+H]+.

[0884] 1,5-Dimethyl-4-[[4-methyl-6-(1-methylpyrazol-4-yl)-3-pyridinyl]sulfonyl]-3H-quinoxalin-2-one (Broad_P_CaV3.3_407, Compound 14)

[0885]

[0886] A stirred suspension of 4-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-1,5-dimethyl-3H-quinoxalin-2-one (310 mg, 0.356 mmol, 1.00 equiv), 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazole (111 mg, 0.534 mmol, 1.50 equiv) and potassium carbonate (148 mg, 1.07 mmol, 3.00 equiv) in dioxane (2.8254 mL) was degassed with nitrogen for 15 min. After 15 min, (1,1'-bis(diphenylphosphino)ferrocene)palladium(II) dichloride (26 mg, 0.0356 mmol, 0.100 equiv) was added thereto and heated at 100 °C for 16 h. After 16 h, the reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The organic layer was dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (40 / 60 Hex / EtOAc; 12S column) to give an impure product, which was further purified by preparative HPLC using (20 - 55% ACN in water containing 0.1% aqueous formic acid as modifier) as the mobile phase to give Broad_P_Cav3.3_407 as an off-white solid, (28 mg, 0.0677 mmol, 19% yield).

[0887] 1H NMR (400 MHz, DMSO-d6) δ 8.43 (d, J = 14.4 Hz, 2H), 8.08 (d, J = 26.5 Hz, 1H), 7.63 (s, 1H), 7.35 (t, J = 7.8 Hz, 1H), 7.15 (d, J = 7.6 Hz, 1H), 6.93 (d, J = 8.2 Hz, 1H), 4.52 - 4.25 (m, 2H), 3.89 (s, 3H), 2.52 (s, 6H), 1.95 (s, 3H). MS (ESI): 412.3 [M+H]+.

[0888] 4-[(6-chloro-4-methyl-3-pyridinyl)sulfonyl]-1,5-dimethyl-3H-quinoxalin-2-one

[0889]

[0890] At room temperature, methyl iodide (0.08 mL, 1.31 mmol, 1.50 equiv) was added to a stirred solution of 4-[(6-chloro-4-methyl-3-pyridinyl)sulfonyl]-5-methyl-1,3-dihydroquinoxalin-2-one (350 mg, 0.872 mmol, 1.00 equiv) and potassium carbonate (362 mg, 2.62 mmol, 3.00 equiv) in DMF (4.385 mL). The reaction mixture was heated at 50 °C and stirred for 15 h. After completion, the reaction mixture was quenched with ice water (50 mL) and extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine solution (2 × 30 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by flash column chromatography and the product was eluted with a solution of 30% EtOAc in hexane as a gradient to afford Broad_P_Cav3.3_407_Int-825 as an off-white solid (310 mg, 0.399 mmol, 46% yield). MS (ESI): 366.2 [M+H]+.

[0891] 4-[(6-chloro-4-methyl-3-pyridinyl)sulfonyl]-5-methyl-1,3-dihydroquinoxalin-2-one

[0892]

[0893] At room temperature, to a stirred solution of 2-[2-amino-N-[(6-chloro-4-methyl-3-pyridinyl)sulfonyl]-6-methyl-anilino]acetic acid (470 mg, 1.03 mmol, 1.00 equiv) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (236 mg, 1.23 mmol, 1.20 equiv) in DMF (3.62 mL). The reaction mixture was stirred at 30 °C for 6 h. After completion, the reaction mixture was quenched with water (50 mL) and extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine solution (3 × 30 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by combi-flash column chromatography and eluted with a solution of 2 - 3% MeOH in DCM as a gradient to afford Broad_P_Cav3.3_407_int-824 as an off-white solid (350 mg, 0.872 mmol, 85% yield). MS (ESI): 352.4 [M+H]+.

[0894] 2-[2-amino-N-[(6-chloro-4-methyl-3-pyridinyl)sulfonyl]-6-methyl-anilino]acetic acid

[0895]

[0896] To a stirred solution of ethyl 2-[2-amino-N-[(6-chloro-4-methyl-3-pyridinyl)sulfonyl]-6-methylanilino]acetate (1.00 g, 1.90 mmol, 1.00 equiv) in MeOH (2.2737 mL), THF (2.2737 mL), and water (1.1369 mL) at room temperature was added lithium hydroxide monohydrate (0.32 g, 7.62 mmol, 4.00 equiv) at the same temperature. The reaction mixture was stirred at 30 °C for 5 h. After completion, the reaction mixture was acidified with dilute HCl solution (5 mL) and the solvent was concentrated in vacuo. The residue was diluted with EtOAc (50 mL) and the organic layer was washed with water (3 × 40 mL) and brine solution (3 × 40 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated to afford Broad_P_Cav3.3_407_Int-823 (470 mg, 1.03 mmol, 54% yield) as an off-white solid. MS (ESI): 370.1 [M+H]+.

[0897]

[0898] ethyl 2-[2-amino-N-[(6-chloro-4-methyl-3-pyridinyl)sulfonyl]-6-methylanilino]acetate

[0899] To a stirred solution of N-(2-amino-6-methylphenyl)-6-chloro-4-methylpyridine-3-sulfonamide; hydrochloride (1.50 g, 3.25 mmol, 1.00 equiv), ethyl 2-bromoacetate (0.43 mL, 3.90 mmol, 1.20 equiv), and potassium carbonate (1.35 g, 9.76 mmol, 3.00 equiv) in DMF (11.328 mL) at room temperature. The reaction mixture was stirred at 30 °C for 3 h. After completion, the reaction mixture was quenched with ice water (50 mL) and extracted with EtOAc (3 × 50 mL). The combined organic layers were washed with brine solution (3 × 30 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by combi-flash column chromatography and eluted with a solution of 70% EtOAc in hexane as a gradient to afford Broad_P_Cav3.3_407_Int-822 (1.00 g, 2.16 mmol, 66% yield) as a white solid. MS (ESI): 398.2 [M+H]+.

[0900] N-(2-Amino-6-methyl-phenyl)-6-chloro-4-methyl-pyridine-3-sulfonamide; hydrochloride

[0901]

[0902] To a stirred solution of tert-butyl N-[2-[(6-bromo-4-methyl-3-pyridyl)sulfonylamino]-3-methyl-phenyl]carbamate (1.70 g, 2.45 mmol, 1.00 equiv) in DCM (13.164 mL) was added a solution of 4 M HCl in dioxane (4 M, 6.13 mL, 24.5 mmol, 10.0 equiv) and it was stirred at room temperature for 3 h. After completion, the reaction mixture was evaporated to afford Broad_P_Cav3.3_407_Int-728 (1.50 g, 3.25 mmol, quantitative) as an off-white solid. MS (ESI): 310.3 [M-HCl-1]+.

[0903] tert-butyl N-[2-[(6-bromo-4-methyl-3-pyridyl)sulfonylamino]-3-methyl-phenyl]carbamate

[0904]

[0905] A solution of tert-butyl N-(2-amino-3-methyl-phenyl)carbamate (1.56 g, 7.02 mmol, 1.00 equiv) in dichloromethane (10 mL) was added to pyridine (2.26 mL, 28.1 mmol, 4.00 equiv) at 25 °C and then 6-bromo-4-methyl-pyridine-3-sulfonyl chloride (1.90 g, 7.02 mmol, 1.00 equiv) was added and the resulting mixture was stirred at room temperature for 16 h. The reaction mixture was diluted with water (100 mL) and extracted with EtOAc (3 × 80 mL). The organic layer was dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (8:2 Hex / EtOAc; 12S column) to afford tert-butyl N-[2-[(4-bromo-2-fluoro-6-methyl-phenyl)sulfonylamino]-4-fluoro-3-methyl-phenyl]carbamate (Broad_P_Cav3.3_407_Int-727 (1.70 g, 2.45 mmol, 35% yield) as a brown solid.

[0906] 1H NMR (400 MHz, DMSO-d6) δ 9.43 (s, 1H), 8.47 (d, J = 16.0 Hz, 1H), 7.90 (s, 1H), 7.74 (d, J = 54.6 Hz, 1H), 7.48 (d, J = 8.2 Hz, 1H), 7.18 (t, J = 7.9 Hz, 1H), 6.99 (d, J = 7.6 Hz, 1H), 2.38 (d, J = 3.9 Hz, 3H), 2.22 (s, 3H), 1.39 (d, J = 3.4 Hz, 9H). MS (ESI): 454.24 [M-H]-.

[0907] Synthesis of Compound 15 and Compound 46

[0908]

[0909] (4R)-4,8-Dimethyl-1-[2-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-3,4-dihydro-2H-quinoline and (4S)-4,8-dimethyl-1-[2-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-3,4-dihydro-2H-quinoline: Broad_P_CaV3.3_430 and Broad_P_CaV3.3_431 (Compound 15 and its stereoisomer)

[0910] Under a nitrogen atmosphere, 4,8-dimethyl-1,2,3,4-tetrahydroquinoline (0.20 g, 1.24 mmol, 1.00 equiv) and 2-methyl-4-(1-methylpyrazol-4-yl)benzenesulfonyl chloride (0.84 g, 3.10 mmol, 2.50 equiv) were dissolved in acetonitrile (4 mL). Zinc oxide (0.20 g, 2.48 mmol, 2.00 equiv) was added and the reaction mixture was stirred at room temperature for 72 h. After completion, water was added and the crude product was extracted with ethyl acetate (3 × 25 mL). The organic layers were combined, washed with brine, dried over anhydrous sodium sulfate and concentrated to give a crude product, which was purified as follows: First, column chromatography was used to give the racemic compound 758E with LCMS purity of 96% (254 nm), and then chiral preparative HPLC purification was carried out to provide two fractions. The pure fractions were evaporated to give Broad_P_CaV3.3_430 (7.6 mg, 0.0191 mmol, 2% yield) (Fr-1) and Broad_P_CaV3.3_431 (3.5 mg, 0.00876 mmol, 100% purity, 0.71) (Fr-2).

[0911] MS: [M+H]+ 396.10.

[0912] Fr-1 (Broad_P_CaV3.3_430):

[0913] 1H NMR (400 MHz, chloroform-d) δ 7.88 (d, J = 8.2 Hz, 1H), 7.80 (s, 1H), 7.69 (s, 1H), 7.39 - 7.33 (m, 1H), 7.32 (s, 1H), 7.14 (s, 2H), 7.01 (d, J = 7.0 Hz, 1H), 4.21 - 4.04 (m, 1H), 3.96 (s, 3H), 3.40 (s, 1H), 2.33 (s, 3H), 2.21 (s, 3H), 2.06 (s, 2H), 1.31 - 1.17 (m, 1H), 1.11 (d, J = 6.4 Hz, 3H).

[0914] Fr-2 (Broad_P_CaV3.3_431):

[0915] 1H NMR (400 MHz, chloroform-d) δ 7.87 (d, J = 8.2 Hz, 1H), 7.80 (s, 1H), 7.69 (s, 1H), 7.39 - 7.33 (m, 1H), 7.31 (s, 1H), 7.15 (d, J = 7.4 Hz, 2H), 7.00 (d, J = 6.8 Hz, 1H), 4.13 (s, 1H), 3.95 (s, 3H), 3.40 (s, 1H), 2.33 (s, 3H), 2.21 (s, 3H), 2.06 (s, 2H), 1.23 (d, J = 14.1 Hz, 1H), 1.11 (d, J = 6.4 Hz, 3H).

[0916] 6-Fluoro-1,5-dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_301, Compound 16)

[0917]

[0918] At room temperature, a solution of potassium carbonate (351 mg, 2.54 mmol) in 1,4-dioxane (5 mL) was added to a stirred solution of 4-(4-bromo-2-methylbenzenesulfonyl)-6-fluoro-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (350 mg, 0.8468 mmol), and the reaction mixture was degassed with argon for 20 min. Subsequently, bis(cyclopent-1,3-diene-1-yl diphenylphosphine)palladium(II) dichloride (69.1 mg, 0.08468 mmol) was added at room temperature, and the reaction mixture was heated at 100 °C for 8 h. After completion, the reaction mixture was poured into water (30 mL) and extracted with EtOAc (3 × 30 mL). The organic layer was washed with brine solution (2 × 20 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (50:1 CH 2 Cl 2 / MeOH; 12 M column) to afford 6-fluoro-1,5-dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)benzenesulfonyl]-1,2,3,4-tetrahydroquinoxaline (198 mg, 55.7% yield) as an off-white solid.

[0919] 1H NMR (400 MHz, chloroform-d) δ 2.16 (s, 3H), 2.26 (d, J = 2.7 Hz, 3H), 2.46 (s, 3H), 2.92 (d, J = 6.9 Hz, 2H), 3.23 (s, 1H), 3.96 (s, 3H), 4.28 (d, J = 13.8 Hz, 1H), 6.32 (dd, J = 9.0, 5.0 Hz, 1H), 6.87 (t, J = 9.0 Hz, 1H), 7.28 (s, 1H), 7.33 (d, J = 8.2 Hz, 1H), 7.68 (s, 1H), 7.80 (s, 1H), 7.91 (d, J = 8.3 Hz, 1H). 19F NMR (377 MHz, chloroform-d) δ -128.76. MS (ESI): 415.0 [M+H]+.

[0920] Synthesis of Compound 17

[0921]

[0922] 4-[4-(4-Cyclopropylimidazol-1-yl)-2-methyl-phenyl]sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline: Broad_P_CaV3.3_346

[0923]

[0924] A stirred solution of 4-(4-bromo-2-methylphenyl)sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline (0.15 g, 0.379 mmol, 1.00 equiv) and 4-cyclopropyl-1H-imidazole (0.082 g, 0.759 mmol, 2.00 equiv) in dimethylformamide (5 mL) was degassed with nitrogen for 15 min. After 15 min, cuprous oxide (I) (0.054 g, 0.379 mmol, 1.00 equiv) and potassium tert-butoxide (0.13 g, 1.14 mmol, 3.00 equiv) were added thereto, and it was heated at 100 °C in a sealed tube for 16 h. After 16 h, the reaction mixture was poured into cold water (50 mL) and extracted with ethyl acetate (3 × 30 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated. The residue was purified by combiflash using ethyl acetate:hexane (1:1) as the mobile phase to afford 4-[4-(4-cyclopropylimidazol-1-yl)-2-methylphenyl]sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline Broad_P_CaV3.3_346 (0.015 g, 0.0364 mmol, 10% yield) as an off-white solid.

[0925] MS: [M+H]+ 423.00.

[0926] 1 H NMR (400 MHz, DMSO-d 6 ) δ 8.28 (s, 1H), 7.96 (d, J = 8.9 Hz, 1H), 7.63 (d, J = 7.1 Hz, 3H), 7.02 (t, J = 8.0 Hz, 1H), 6.54 (d, J = 7.5 Hz, 1H), 6.45 (d, J = 8.2 Hz, 1H), 4.15 (d, J = 8.7 Hz, 1H), 2.97 (s, 1H), 2.81 (s, 2H), 2.41 (s, 3H), 2.27 (s, 3H), 2.04 (s, 3H), 1.84 (s, 2H), 0.81 (d, J = 7.2 Hz, 2H), 0.69 (s, 2H).

[0927] Synthesis of Compound 18

[0928]

[0929] 1-((4-Bromo-2-methylphenyl)sulfonyl)-7-methylindoline: Intermediate 1

[0930]

[0931] At room temperature under an inert atmosphere, triethylamine (0.16 mL, 1.13 mmol, 3.00 equiv) was added to a stirred solution of 7-methylindoline (50 mg, 0.375 mmol, 1.00 equiv) and 4-bromo-2-methyl-benzenesulfonyl chloride (121 mg, 0.450 mmol, 1.20 equiv) in pyridine (1 mL), followed by the addition of DMAP (46 mg, 0.375 mmol, 1.00 equiv), and then the mixture was stirred at room temperature. The reaction mixture was quenched with water (20 mL) and extracted with ethyl acetate (30 m×3). The organic layer was dried over anhydrous Na 2 SO 4 dried, filtered and concentrated in vacuo. Purification by column chromatography in 0 - 10% ethyl acetate:hexane provided 1-(4-bromo-2-methyl-phenyl)sulfonyl-7-methyl-indoline (90 mg, 0.241 mmol, 64% yield) as a light brown solid. MS (ESI): 366.27 [M+H]

[0932] 1 1H NMR (400 MHz, chloroform-d) δ 7.82 (d, J = 8.5 Hz, 1H), 7.43 (d, J = 8.5 Hz, 1H), 7.35 (s, 1H), 7.07 (d, J = 4.5 Hz, 2H), 6.96 (t, J = 4.5 Hz, 1H), 3.94 (t, J = 7.2 Hz, 2H), 2.51 (s, 3H), 2.36 (t, J = 7.2 Hz, 2H), 2.09 (s, 3H).

[0933] 7-Methyl-1-((2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenyl)sulfonyl)indoline

[0934]

[0935] At room temperature, water (1 mL) was added to a stirred solution of 1-(4-bromo-2-methyl-phenyl)sulfonyl-7-methyl-indoline (80 mg, 0.218 mmol, 1.00 equiv) and 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazole (91 mg, 0.437 mmol, 2.00 equiv) in dioxane (3 mL). Subsequently, sodium carbonate (69 mg, 0.655 mmol, 3.00 equiv) was added. The reaction mixture was purged with argon for 10 min and then a complex of [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) with dichloromethane (8.9 mg, 0.0109 mmol, 0.0500 equiv) was added under an inert atmosphere, and the reaction mixture was stirred at 80 °C. The reaction was quenched with water (30 mL) and extracted with ethyl acetate (30 mL × 3). The organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The crude product was purified by column chromatography to afford 7-methyl-1-[2-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-indoline (51 mg, 0.137 mmol, 63% yield) as a brown solid. MS (ESI): 367.47 [M+H]

[0936] 1 H NMR (400 MHz, DMSO-d 6 ) δ 8.29 (s, 1H), 7.98 (s, 1H), 7.86 (d, J = 8.3 Hz, 1H), 7.58 (dd, J = 8.3, 1.9 Hz, 1H), 7.52 (d, J = 1.9 Hz, 1H), 7.14 - 7.07 (m, 2H), 7.06 - 6.99 (m, 1H), 3.90 (t, J = 7.2 Hz, 2H), 3.86 (s, 3H), 2.44 (s, 3H), 2.26 (t, J = 7.2 Hz, 2H), 1.99 (s, 3H).

[0937] 1,5-Dimethyl-4-[2-methyl-4-(4-methylimidazol-1-yl)phenyl]sulfonyl-2,3-dihydroquinoxaline (Broad_P_Cav3.3_291, Compound 19)

[0938]

[0939] A stirred suspension of 4-(4-bromo-2-methyl-phenyl)sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline (1.50 g, 3.64 mmol, 1.00 equiv), 4-methyl-1H-imidazole (0.75 g, 9.09 mmol, 2.50 equiv) and potassium tert-butoxide (0.82 g, 7.27 mmol, 2.00 equiv) in DMF (15 mL) was degassed with nitrogen for 15 min. After 15 min, cuprous oxide (I) (0.14 g, 1.82 mmol, 0.500 equiv) was added thereto and it was heated at 120 °C for 16 h. After completion, the reaction mixture was diluted with ethyl acetate (100 mL) and washed with brine solution (3 × 70 mL). The organic layer was dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combi flash using (80% ethyl acetate:hexanes) as the mobile phase to give an impure product, which was then repurified by preparative HPLC using (10 - 30% ACN and water containing 0.1% formic acid as the modifier) as the mobile phase to give Broad_P_Cav3.3_291 as a brown solid (45 mg, 0.110 mmol, 3% yield).

[0940] 1H NMR (400 MHz, DMSO-d6) δ 8.32 (s, 1H), 7.98 (d, J = 8.5 Hz, 1H), 7.65 (d, J = 7.8 Hz, 2H), 7.60 (s, 1H), 7.03 (t, J = 7.8 Hz, 1H), 6.55 (d, J = 7.5 Hz, 1H), 6.47 (d, J = 8.2 Hz, 1H), 4.16 (dd, J = 14.9, 6.9 Hz, 1H), 3.25 (s, 1H), 2.98 (t, J = 8.6 Hz, 1H), 2.83 (s, 1H), 2.43 (s, 3H), 2.29 (s, 3H), 2.17 (s, 3H), 2.06 (s, 3H). MS (ESI): 397.2 [M+H]+.

[0941] 4-(4-bromo-2-methyl-phenyl)sulfonyl-1,5-dimethyl-2,3-dihydroquinoxaline

[0942]

[0943] To a stirred solution of 4-(4-bromo-2-methyl-phenyl)sulfonyl-5-methyl-2,3-dihydro-1H-quinoxaline (2.00 g, 4.93 mmol, 1.00 equiv) and potassium carbonate (2.04 g, 14.8 mmol, 3.00 equiv) in DMF (10.12 mL) at room temperature was added methyl iodide (0.46 mL, 7.40 mmol, 1.50 equiv). The reaction mixture was heated at 80 °C and stirred for 16 h. After completion, the reaction mixture was poured into ice water (100 mL) and extracted with EtOAc (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL) and dried over Na 2 SO 4 and evaporated. The residue was purified by biotage (40:60, Hex / EtOAc) to afford Broad_P_Cav3.3_291_Int-538C as a white solid (1.50 g, 3.64 mmol, 74% yield). MS (ESI): 397.2 [M+H]+.

[0944] 4-(4-Bromo-2-methyl-phenyl)sulfonyl-5-methyl-2,3-dihydro-1H-quinoxaline; hydrochloride

[0945]

[0946] To a stirred solution of tert-butyl 4-(4-bromo-2-methyl-phenyl)sulfonyl-5-methyl-2,3-dihydroquinoxaline-1-carboxylate (3.10 g, 6.44 mmol, 1.00 equiv) in dichloromethane (30 mL) at 0 °C was added a solution of HCl in 1,4-dioxane (4 M solution in dioxane, 20 mL, 80.0 mmol, 12.4 equiv). The reaction mixture was stirred at room temperature for 5 h. After completion, the reaction mixture was concentrated in vacuo. The residue was washed with n-hexane 3 - 4 times and the solid was dried in vacuo to afford 4-(4-bromo-2-methyl-phenyl)sulfonyl-5-methyl-2,3-dihydro-1H-quinoxaline; hydrochloride as a light brown solid (2.60 g, 5.85 mmol, 91% yield).

[0947] 1H NMR (400 MHz, DMSO-d6) δ 7.84 (d, J = 8.5 Hz, 1H), 7.69 - 7.56 (m, 2H), 6.87 (t, J = 7.7 Hz, 1H), 6.37 (t, J = 8.9 Hz, 2H), 5.86 (s, 4H), 4.00 (s, 1H), 3.57 (s, 1H), 3.11 (s, 2H), 2.20 (s, 3H), 2.12 (s, 3H). MS (ESI): 381.2 [M+H]+.

[0948] tert-Butyl 4-(4-bromo-2-methylphenyl)sulfonyl-5-methyl-2,3-dihydroquinoxaline-1-carboxylate

[0949]

[0950] At room temperature, K 2 2 CO 3 (3.64 g, 26.4 mmol, 4.00 equiv) was added to a stirred solution of tert-butyl N-[2-[(4-bromo-2-methylphenyl)sulfonylamino]-3-methylphenyl]carbamate (3.00 g, 6.59 mmol, 1.00 equiv) and 1,2-dibromoethane (0.71 mL, 7.91 mmol, 1.20 equiv) in DMF (20 mL). The reaction mixture was heated at 90 °C for 16 h. After completion, the reaction mixture was poured into ice-cold water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL), dried over Na 2 2 SO 4 and evaporated in vacuo to afford tert-butyl 4-(4-bromo-2-methylphenyl)sulfonyl-5-methyl-2,3-dihydroquinoxaline-1-carboxylate (3.10 g, 6.18 mmol, 94% yield) as a yellow solid.

[0951] 1H NMR (400 MHz, DMSO-d6) δ 7.90 (d, J = 8.6 Hz, 1H), 7.67 - 7.53 (m, 2H), 7.39 (s, 1H), 7.20 (t, J = 7.9 Hz, 1H), 7.04 (d, J = 7.6 Hz, 1H), 4.29 (d, J = 13.6 Hz, 1H), 3.30 (d, J = 10.7 Hz, 2H), 2.89 (s, 1H), 2.73 (s, 1H), 2.37 (s, 3H), 2.00 (s, 3H), 1.37 (s, 9H). MS (ESI): 427.2 [M - 56]+.

[0952] tert-Butyl N-[2-[(4-bromo-2-methylphenyl)sulfonylamino]-3-methylphenyl]carbamate

[0953]

[0954] At room temperature, 4-bromo-2-methyl-benzenesulfonyl chloride (5.09 g, 18.9 mmol, 1.50 eq) was added to a stirred solution of tert-butyl N-(2-amino-3-methyl-phenyl)carbamate (2.80 g, 12.6 mmol, 1.00 eq) and pyridine (5.09 mL, 63.0 mmol, 5.00 eq) in dichloromethane (30 mL). The reaction mixture was stirred at the same temperature for 16 h. After completion, the reaction was quenched with water and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by silica gel column chromatography (8% ethyl acetate: hexanes as the mobile phase) to afford tert-butyl N-[2-[(4-bromo-2-methyl-phenyl)sulfonylamino]-3-methyl-phenyl]carbamate (5.00 g, 10.6 mmol, 84% yield) as an off-white solid.

[0955] 1H NMR (400 MHz, DMSO-d6) δ 9.36 (s, 1H), 7.67 (s, 1H), 7.62 (s, 1H), 7.56 (d, J = 13.2 Hz, 3H), 7.15 (t, J = 7.8 Hz, 1H), 6.92 (d, J = 7.7 Hz, 1H), 2.43 (s, 3H), 2.08 (s, 3H), 1.49 - 1.32 (m, 9H). MS (ESI): 455.3 [M+H]+.

[0956] Synthesis of Compound 20

[0957]

[0958] 1-(4-Bromo-2-methyl-phenyl)sulfonyl-5-fluoro-7-methyl-indoline: Intermediate - 1290

[0959]

[0960] At room temperature, 4-bromo-2-methyl-benzenesulfonyl chloride (641.85 mg, 2.38 mmol, 2.00 eq) was added to a stirred solution of 5-fluoro-7-methyl-indoline (0.20 g, 1.32 mmol, 1.00 eq) and pyridine (0.43 mL, 5.29 mmol, 4.00 eq) in DCM (5 mL). The reaction mixture was stirred at the same temperature for 12 h. After completion, the reaction was quenched with 10% citric acid solution (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL), dried over Na 2 SO 4Dry and evaporate. The residue was purified by silica gel column chromatography (6:4, ethyl acetate: hexanes as the mobile phase) to afford Broad_P_CaV3.3_625_Int-1290 as an off-white solid (180 mg, 0.47 mmol, 35% yield).

[0961] 1H NMR (400 MHz, chloroform-d) δ 7.85 (d, J = 8.5 Hz, 1H), 7.49 (dd, J = 8.5, 2.1 Hz, 1H), 7.43 (d, J = 2.0 Hz, 1H), 6.83 (dd, J = 9.8, 2.6 Hz, 1H), 6.73 (dd, J = 7.7, 2.6 Hz, 1H), 3.99 (t, J = 7.2 Hz, 2H), 2.54 (s, 3H), 2.40 (t, J = 7.3 Hz, 2H), 2.21 (s, 3H).

[0962] 5-Fluoro-7-methyl-1-[2-methyl-4-(4-methyl-1H-imidazol-1-yl)phenyl]sulfonyl-indoline: Broad_P_Cav3.3_625, Compound 20

[0963]

[0964] A stirred suspension of 1-(4-bromo-2-methyl-phenyl)sulfonyl-5-fluoro-7-methyl-indoline (0.18 g, 0.47 mmol, 1.00 equiv), 4-methyl-1H-imidazole (0.076 g, 0.94 mmol, 2.00 equiv) and Ktb (0.157 g, 1.41 mmol, 3.00 equiv) in DMF (5 mL) was degassed with nitrogen for 15 min. After 15 min, cuprous oxide (I) (0.020 g, 0.140 mmol, 0.3 equiv) was added thereto and it was heated in a microwave at 170 °C for 4 h. After completion, the reaction mixture was diluted with ethyl acetate (100 mL) and washed with brine solution (3×70 mL). The organic layer was dried over Na 2 SO 4 dried and evaporated in vacuo. The residue was purified by combi flash using (1:1, ethyl acetate: hexanes) as the mobile phase to afford a mixture of isomers which was further purified by preparative HPLC to yield Broad_P_CaV3.3_625 as an off-white solid (20 mg, 0.05 mmol, 10% yield).

[0965] MS: [M+H] + 385.9

[0966] 1H NMR (400 MHz, DMSO-d6) δ 8.35 (s, 1H), 7.99 (d, J = 9.2 Hz, 1H), 7.71 (dd, J = 6.2, 2.6 Hz, 2H), 7.61 (s, 1H), 6.98 (ddd, J = 23.8, 9.2, 2.7 Hz, 2H), 3.96 (t, J = 7.2 Hz, 2H), 2.45 (s, 3H), 2.30 (t, J = 7.3 Hz, 2H), 2.15 (d, J = 19.7 Hz, 6H).

[0967] 19F NMR (376 MHz, DMSO-d6) δ -115.92

[0968] Synthesis of Compound 21 and Compound 138

[0969]

[0970] 3,8-Dimethyl-2,3-dihydro-1H-quinolin-4-one: Intermediate - 891C

[0971]

[0972] To a stirred solution of 3,8-dimethyl-1H-quinolin-4-one (2.00 g, 11.5 mmol, 1.00 equiv) in THF (20 mL) was added phenylsilane (5.00 g, 46.2 mmol, 4.00 equiv), and then dibutyltin dichloride (7.02 g, 23.1 mmol, 2.00 equiv) was added; the reaction mixture was stirred at room temperature. After completion, the reaction mixture was poured into water (50 mL) and extracted with ethyl acetate (3 × 30 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated. The residue was purified by combi-flash using ethyl acetate:hexanes (3:7) to afford Int-891C as a bright yellow solid (1.60 g, 9.13 mmol, 79% yield).

[0973] MS: [M+H]+ 176.0

[0974] 4-Bromo-2-methylbenzenesulfonyl chloride: Broad_P_CaV3.3_449 and 450

[0975]

[0976] To a stirred solution of 3,8-dimethyl-2,3-dihydro-1H-quinolin-4-one (0.50 g, 2.85 mmol, 1.00 equiv) and 2-methyl-4-(1-methylpyrazol-4-yl)benzenesulfonyl chloride (0.93 g, 3.42 mmol, 1.20 equiv) in ACN (10 mL) was added zinc oxide (0.46 g, 5.71 mmol, 2.00 equiv) and it was stirred at room temperature for 48 h. After completion, the reaction mixture was filtered through a bed of celite and washed with ethyl acetate (3 × 20 mL). The filtrate was evaporated in vacuo and the residue was purified by combi-flash using ethyl acetate:hexanes (3:7) to afford the racemic product, which was further purified by chiral preparative HPLC to give Broad_P_CaV3.3_449 (20 mg, 0.0488 mmol, 100% purity, 2% yield) as an off-white solid and Broad_P_CaV3.3_450 (20 mg, 0.0477 mmol, 2% yield) as an off-white solid.

[0977] Broad_P_CaV3.3_449

[0978] MS: [M+H]+ 410.2

[0979] 1H NMR (400 MHz, DMSO-d6) δ 8.32 (s, 1H), 8.01 (s, 1H), 7.83 (d, J = 8.2 Hz, 1H), 7.72 - 7.57 (m, 4H), 7.40 (t, J = 7.6 Hz, 1H), 4.23 (dd, J = 14.8, 6.3 Hz, 1H), 3.87 (s, 3H), 3.61 (dd, J = 14.7, 12.5 Hz, 1H), 2.47 - 2.42 (m, 1H), 2.30 (s, 3H), 2.14 (s, 3H), 0.92 (d, J = 7.0 Hz, 3H).

[0980] [α]D 25 = -35.00°

[0981] Chiral separation conditions: (CHIRALPAK IB-N (250*4.6 mm) 5u), 0.1% DEA / hexanes in IPA solution) and CO 2 gas as the mobile phase

[0982] Elution order: fraction-1 (RT: 11.03 min); fraction-2 (RT: 12.91 min)

[0983] Broad_P_CaV3.3_450

[0984] MS: [M+H]+ 410.2

[0985] 1H NMR (400 MHz, DMSO-d6) δ 8.32 (s, 1H), 8.01 (s, 1H), 7.83 (d, J = 8.1 Hz, 1H), 7.69 - 7.57 (m, 4H), 7.40 (t, J = 7.6 Hz, 1H), 4.23 (dd, J = 14.8, 6.3 Hz, 1H), 3.87 (s, 3H), 3.67 - 3.57 (m, 1H), 2.44 (d, J = 6.7 Hz, 1H), 2.30 (s, 3H), 2.14 (s, 3H), 0.92 (d, J = 7.0 Hz, 3H).

[0986] [α]D 25 = +33.40°

[0987] Chiral separation conditions: (CHIRALPAK IB-N (250 * 4.6 mm) 5u), 0.1% DEA / solution of hexane in IPA) and CO 2 gas as the mobile phase

[0988] Elution order: fraction - 1 (RT: 11.03 min); fraction - 2 (RT: 12.91 min)

[0989] 6-Fluoro-1,4-dimethyl-3-[[4-methyl-6-(4-methylimidazol-1-yl)-3-pyridinyl]sulfonyl]indole (Broad_P_CaV3.3_676, Compound 22)

[0990]

[0991] A stirred suspension of 3-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-6-fluoro-1,4-dimethyl-indole (3.60 g, 9.06 mmol, 1.00 equivalent), 4-methyl-1H-imidazole (2.98 g, 36.2 mmol, 4.00 equivalents), Cu 2 O (0.39 g, 2.72 mmol, 0.300 equivalent) and potassium tert-butoxide (3.05 g, 27.2 mmol, 3.00 equivalents) in dimethylformamide (72 mL) was heated at 150 °C for 2 h. After completion, the reaction mixture was diluted with ethyl acetate (100 mL) and washed with aqueous saline solution (3 × 70 mL). The organic layer was passed through Na 2 SO 4Dry and evaporate under vacuum. The residue was purified by combi flash using (1:9, MeOH:DCM) as the mobile phase to give a mixture of isomers, which was further purified by reverse-phase purification using 15 to 85% acetonitrile and water (0.1% formic acid as the modifier) to yield Broad_P_CaV3.3_676 as an off-white solid (1.02 g, 2.48 mmol, 27% yield).

[0992] 1H NMR (400 MHz, DMSO-d6) δ 8.80 (s, 1H), 8.48 (s, 1H), 8.34 (s, 1H), 7.87 (s, 1H), 7.70 (s, 1H), 7.38 (dd, J = 9.4, 2.4 Hz, 1H), 6.91 (dd, J = 10.5, 2.4 Hz, 1H), 3.87 (s, 3H), 2.54 (s, 3H), 2.46 (s, 3H), 2.16 (s, 3H). MS (ESI): 399.5 [M+H]+.

[0993] 3-[(6-Bromo-4-methyl-3-pyridinyl)sulfonyl]-6-fluoro-1,4-dimethyl-indole

[0994]

[0995] At 0 °C, ozone (757 mg, 2.46 mmol, 3.00 equiv) was added to a stirred solution of 3-[(6-bromo-4-methyl-3-pyridinyl)thio]-6-fluoro-1,4-dimethyl-indole (300 mg, 0.821 mmol, 1.00 equiv) in tetrahydrofuran (3 mL) and water (3 mL). The reaction mixture was stirred at 25 °C for 16 h. After completion, the reaction was quenched with water and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL) and dried over Na 2 SO 4 Dry and evaporate. The residue was purified by silica gel column chromatography using a 40% solution of ethyl acetate in hexanes as the mobile phase to give Broad_P_CaV3.3_676_Int-1445 as a pale yellow semi-solid (200 mg, 0.423 mmol, 51% yield). MS (ESI): 399.1 [M+H]+.

[0996] 3-[(6-Bromo-4-methyl-3-pyridinyl)thio]-6-fluoro-1,4-dimethyl-indole

[0997]

[0998] At 25 °C, tetrabutylammonium iodide (2037 mg, 5.52 mmol, 2.00 equiv) was added to a stirred solution of 6-fluoro-1,4-dimethyl-indole (450 mg, 2.76 mmol, 1.00 equiv) and 6-bromo-4-methyl-pyridine-3-sulfonyl chloride (1492 mg, 5.52 mmol, 2.00 equiv) in dimethylformamide (4.5 mL). The reaction mixture was stirred at the same temperature for 2 h. After completion, the reaction was quenched with water and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL) and dried over Na 2 SO 4 and evaporated. The residue was purified by silica gel column chromatography using a 60% solution of ethyl acetate in hexane as the mobile phase to afford Broad_P_CaV3.3_676 as a pale yellow semi-solid (300 mg, 0.791 mmol, 29% yield). MS (ESI): 365.4 [M+H]+.

[0999] 5-chloro-1-methyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad000415-105, Compound 23)

[1000]

[1001] Bromosulfonamide (100 mg, 0.2405 mmol, 1 equiv), methylpyrazoleboronic acid (60.0 mg, 0.2885 mmol, 1.2 equiv), XPhos Pd G2 (9.45 mg, 0.01202 mmol, 0.05 equiv) and sodium carbonate (76.4 mg, 0.7214 mmol, 3 equiv) were added to a Schlenk tube. The reaction mixture was stirred at 80 °C for 2 h. After cooling to room temperature, water was added and the product was extracted with EtOAc. The combined organic layers were dried over MgSO 4 and concentrated. The crude product was purified by reverse phase chromatography (ACN / H2O) to afford the desired chloro N-methylsulfonamide methylpyrazole as a white solid (20 mg, 18.5% yield).

[1002] 1H NMR (400 MHz, chloroform-d) δ 7.97 - 7.91 (m, 1H), 7.82 (d, J = 0.9 Hz, 1H), 7.70 (s, 1H), 7.35 (d, J = 7.3 Hz, 2H), 7.03 (t, J = 8.1 Hz, 1H), 6.67 (dd, J = 8.0, 1.3 Hz, 1H), 6.56 (dd, J = 8.4, 1.3 Hz, 1H), 4.25 (s, 1H), 3.97 (s, 3H), 3.34 (d, J = 89.8 Hz, 3H), 2.82 (s, 3H), 2.50 (s, 3H). MS (ESI): 417.0 [M + H]+.

[1003] Synthesis of Compound 24 and Compound 116.

[1004]

[1005] 3,8-Dimethyl-3,4-dihydro-1H-quinoxalin-2-one:

[1006]

[1007] At room temperature, DL-alanine (14.37 g, 161 mmol, 3.00 equiv) was added to a solution of 2-bromo-6-methylaniline (10.00 g, 53.7 mmol, 1.00 equiv) in dimethyl sulfoxide (DMSO) (50 mL). 1,2-Dimethylethylenediamine (DMEDA) (2.84 g, 32.2 mmol, 0.600 equiv), copper(I) chloride (0.80 g, 8.06 mmol, 0.150 equiv) and tripotassium phosphate (K 3 PO 4 )(34.23 g, 161 mmol, 3.00 equiv) were added. Then the reaction mixture was heated for 18 h. The reaction mixture was cooled to room temperature and poured into water (200 mL × 2), and extracted with ethyl acetate (100 mL × 2). The organic layer was separated. Then the organic layer was evaporated under reduced pressure. The product was purified by column chromatography (10 - 20% ethyl acetate in hexane) to give Int-683A as a yellow solid (7.00 g, 32.6 mmol, 61% yield).

[1008] MS: [M + H]+ 177.0

[1009] 3,4,8-Trimethyl-1,3-dihydroquinoxalin-2-one

[1010]

[1011] To a solution of 3,8-dimethyl-3,4-dihydro-1H-quinoxalin-2-one (7.00 g, 39.7 mmol, 1.00 eq) in methanol (50 mL) at room temperature was added paraformaldehyde (4.77 g, 119 mmol, 3.00 eq) and sodium cyanoborohydride (NaCNBH4) (4.99 g, 79.4 mmol, 2.00 eq). The reaction mixture was stirred at room temperature for 24 h. Methanol was evaporated under reduced pressure, and the residue was extracted with water (50 mL × 2) and ethyl acetate (50 mL × 2). The organic layer was separated and evaporated under reduced pressure. The residue was further purified by column chromatography (5% ethyl acetate in hexane) to give 3,4,8-trimethyl-1,3-dihydroquinoxalin-2-one (3.00 g, 13.7 mmol, 34% yield) as a yellow solid.

[1012] MS: [M+H]+ 191.2

[1013] 3,4,8-Trimethyl-2,3-dihydro-1H-quinoxaline:

[1014]

[1015] Then, a solution of 1M LAH in THF (30 mL, 31.5 mmol, 2.00 eq) was added dropwise to a solution of 3,4,8-trimethyl-1,3-dihydroquinoxalin-2-one (3.00 g, 15.8 mmol, 1.00 eq) in THF (30 mL) at -5 °C. The reaction mixture was then heated for 6 h. The reaction mixture was quenched into ice-cold water (100 mL x 2) and extracted with ethyl acetate (50 mL x 2). The organic layer was evaporated under reduced pressure. The residue was further purified by column chromatography (2% ethyl acetate in hexane) to give 3,4,8-trimethyl-2,3-dihydro-1H-quinoxaline (1.50 g, 8.42 mmol, 53% yield) as a yellowish-brown liquid.

[1016] MS: [M+H]+ 176.26

[1017] 4-(4-Bromo-2-methyl-phenyl)sulfonyl-1,2,5-trimethyl-2,3-dihydroquinoxaline:

[1018]

[1019] Then, at room temperature, triethylamine (3.56 mL, 25.5 mmol, 3.00 equivalents), 4-dimethylaminopyridine (1.04 g, 8.51 mmol, 1.00 equivalent), and 4-bromo-2-methyl-benzenesulfonyl chloride (6.88 g, 25.5 mmol, 3.00 equivalents) were added to a solution of 3,4,8-trimethyl-2,3-dihydro-1H-quinoxaline (1.50 g, 8.51 mmol, 1.00 equivalent) in pyridine. The reaction mixture was then stirred at room temperature for 16 h. Then, the reaction mixture was poured into water (50 mL) and extracted with ethyl acetate (50 mL). The organic layer was further washed with a citric acid solution and then with water. The organic layer was separated and evaporated under reduced pressure. The residue was purified by column chromatography (2% ethyl acetate in hexane) to give Int-686A (1.20 g, 2.76 mmol, 32% yield) as a pale brown oily liquid.

[1020] MS: [M+H]+ 411.5

[1021] 1,2,5-Trimethyl-4-[2-methyl-4-(4-methylimidazol-1-yl)phenyl]sulfonyl-2,3-dihydroquinoxaline

[1022]

[1023] At room temperature, tripotassium phosphate (K 3 PO 4 )(1.24 g, 5.86 mmol, 2.00 equivalents), tris(dibenzylideneacetone)dipalladium(0) (Pd 2 (dba) 3(0.27 g, 0.293 mmol, 0.1000 equiv), 2 - Di - tert - butylphosphino - 2',4',6' - triisopropylbiphenyl (tBuXPhos) (0.25 g, 0.586 mmol, 0.200 equiv), and 4 - methyl - 1H - imidazole (0.48 g, 5.86 mmol, 2.00 equiv). The reaction mixture was then heated for 16 h. The reaction mixture was then poured into water (50 mL x 2) and extracted with ethyl acetate (50 mL × 2). The organic layer was separated and evaporated under reduced pressure. The residue was purified by column chromatography (50% ethyl acetate in hexane solution), yielding 0.25 g of the compound, which was further purified by preparative HPLC (0.1% formic acid in water solution, gradient 0 to 100% ACN for 23 min), yielding 0.06 g of the compound, which was further purified by chiral SFC (CHIRALPAK AD - H(250*4.6 mm) 5u), 0.1% DEA in MeOH solution), yielding (2R) - 1,2,5 - trimethyl - 4 - [2 - methyl - 4 - (4 - methylimidazol - 1 - yl)phenyl]sulfonyl - 2,3 - dihydroquinoxaline (4.0 mg, 0.00977 mmol, 0.33) and (2S) - 1,2,5 - trimethyl - 4 - [2 - methyl - 4 - (4 - methylimidazol - 1 - yl)phenyl]sulfonyl - 2,3 - dihydroquinoxaline (4.6 mg, 0.0111 mmol, 0.38).

[1024] Broad_P_CaV3.3_411

[1025] MS: [M + H]+ 411.4

[1026] 1H NMR (400 MHz, DMSO - d6) δ 8.08 (d, J = 8.5 Hz, 1H), 7.91 (s, 1H), 7.24 (d, J = 2.1 Hz, 1H), 7.17 (d, J = 2.2 Hz, 1H), 7.05 (t, J = 7.8 Hz, 2H), 6.63 (d, J = 7.7 Hz, 1H), 6.33 (d, J = 8.2 Hz, 1H), 4.43 (dd, J = 14.6, 7.3 Hz, 1H), 3.22 - 3.12 (m, 1H), 3.04 - 2.96 (m, 1H), 2.38 (s, 3H), 2.30 (s, 6H), 2.08 (s, 3H), 0.93 (d, J = 5.9 Hz, 3H).

[1027] Broad_P_CaV3.3_412

[1028] MS: [M + H]+ 411.4

[1029] 1H NMR (400 MHz, DMSO-d6) δ 8.29 (s, 1H), 7.97 (d, J = 7.1, 1H), 7.62 (s, 2H), 7.57 (s, 1H), 7.02 (t, J = 8.0 Hz, 1H), 6.55 (d, J = 8.4 Hz 1H), 6.38 (d, J = 8.4 Hz 1H), 4.32 (dd, J = 13.2, 5.2 Hz, 1H), 2.92 - 2.98 (m, 2H), 2.29 (s, 3H), 2.23 (s, 3H), 2.16 (s, 3H), 1.97 (s, 3H), 0.84 (t, J = 7.2 Hz, 3H).

[1030] Synthesis of Compound 25

[1031]

[1032] 1 - ((4 - Bromo - 2 - methylphenyl)sulfonyl)-7 - methylindoline:

[1033]

[1034] At room temperature, 4 - bromo - 2 - methyl - benzenesulfonyl chloride (809 mg, 3.00 mmol, 2.00 equiv) was added to a stirred solution of 7 - methylindoline (0.20 g, 1.50 mmol, 1.00 equiv) and pyridine (0.24 mL, 3.00 mmol, 2.00 equiv) in DCM (5 mL). The reaction mixture was stirred at the same temperature for 12 h. After completion, the reaction was quenched with 10% citric acid solution (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by silica gel column chromatography (6:4, ethyl acetate:hexanes as the mobile phase) to afford Broad_P_CaV3.3_624_Int - 933 as an off - white solid (200 mg, 0.546 mmol, 36% yield).

[1035] 1H NMR (400 MHz, chloroform - d) δ 7.84 (d, J = 8.4 Hz, 1H), 7.45 (dd, J = 8.5, 2.1 Hz, 1H), 7.37 (d, J = 2.0 Hz, 1H), 7.10 (d, J = 4.5 Hz, 2H), 6.99 (t, J = 4.4 Hz, 1H), 3.97 (t, J = 7.2 Hz, 2H), 2.54 (s, 3H), 2.38 (t, J = 7.2 Hz, 2H), 2.11 (s, 3H).

[1036] 7-Methyl-1-((2-methyl-4-(4-methyl-1H-imidazol-1-yl)phenyl)sulfonyl)indoline:

[1037]

[1038] A stirred suspension of 1-(4-bromo-2-methyl-phenyl)sulfonyl-7-methyl-indoline (0.20 g, 0.546 mmol, 1.00 equiv), 4-methyl-1H-imidazole (0.090 g, 1.09 mmol, 2.00 equiv) and KOtBu (0.18 g, 1.64 mmol, 3.00 equiv) in DMF (5 mL) was degassed with nitrogen for 15 min. Copper(I) oxide (0.023 g, 0.164 mmol, 0.300 equiv) was added and it was heated at 140 °C for 16 h. After completion, the reaction mixture was diluted with ethyl acetate (100 mL) and washed with aqueous saline solution (3 × 70 mL). The organic layer was dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combi flash using (1:1, ethyl acetate:hexanes) as the mobile phase to afford a mixture of isomers, which was further purified by preparative HPLC to give Broad_P_CaV3.3_624 as a white solid (47 mg, 0.128 mmol, 23% yield).

[1039] MS (ESI): 367.47 [M+H]+

[1040] 1H NMR (400 MHz, DMSO-d6) δ 8.35 (s, 1H), 8.01 (d, J = 8.6 Hz, 1H), 7.80 - 7.50 (m, 3H), 7.09 (dd, J = 29.3, 4.6 Hz, 3H), 3.94 (t, J = 7.2 Hz, 2H), 2.45 (s, 3H), 2.31 (t, J = 7.3 Hz, 2H), 2.17 (s, 3H), 2.06 (s, 3H).

[1041] 1H NMR (400 MHz, methanol-d4) δ 8.20 (s, 1H), 8.08 (d, J = 8.6 Hz, 1H), 7.57 (d, J = 8.6 Hz, 1H), 7.50 (s, 1H), 7.42 (s, 1H), 7.10 (d, J = 4.5 Hz, 2H), 6.99 (d, J = 5.1 Hz, 1H), 3.98 (t, J = 7.3 Hz, 2H), 2.50 (s, 3H), 2.34 (t, J = 7.2 Hz, 2H), 2.25 (s, 3H), 2.12 (s, 3H).

[1042] 1,5-Dimethyl-4-[2-methyl-4-(5-methylpyridin-3-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_CaV3.3_297)

[1043]

[1044] A stirred solution of 4-(4-bromo-2-methylphenylsulfonyl)-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (0.2 g, 505 μmol, 1 equiv), (5-methylpyridin-3-yl)boronic acid (82.9 mg, 606 μmol, 1.2 equiv), and potassium carbonate (208 mg, 1.51 mmol, 3 equiv) in 1,4-dioxane (3 mL) and water (0.5 mL) was degassed with nitrogen for 15 minutes, then palladium(II) bis(dibenzylideneacetone) (41.2 mg, 50.5 μmol, 0.1 equiv) was added and the reaction mixture was heated at 80 °C for 16 h. After completion, the reaction mixture was quenched in water (100 mL) and extracted with ethyl acetate (3 × 100 mL). The combined organic layers were dried over sodium sulfate, filtered, and concentrated under reduced pressure to give the crude product, which was purified by flash chromatography using [0 - 50% EtOAc / hexanes] to afford the impure product. The impure product was purified by preparative HPLC using (35 - 80% ACN in water containing 0.1% formic acid as a modifier) as the mobile phase to give 1,5-dimethyl-4-[2-methyl-4-(5-methylpyridin-3-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline as a light brown solid (0.035 g, 17.0% yield).

[1045] 1H NMR (400 MHz, DMSO-d6) δ 8.75 (d, J = 2.3 Hz, 1H), 8.47 (d, J = 2.0 Hz, 1H), 7.98 (d, J = 8.2 Hz, 2H), 7.78 - 7.68 (m, 2H), 7.02 (t, J = 7.8 Hz, 1H), 6.54 (d, J = 7.5 Hz, 1H), 6.46 (d, J = 8.1 Hz, 1H), 4.16 (d, J = 8.2 Hz, 1H), 3.26 (s, 1H), 2.97 (s, 1H), 2.82 (s, 1H), 2.39 (d, J = 7.6 Hz, 6H), 2.28 (s, 3), 2.10 (s, 3H). MS (ESI): 408.2 [M+H]+.

[1046] Synthesis of Broad_P_CaV3.3_506 and 507 (Compound 27 and Compound 55)

[1047]

[1048] 2-Bromo-6-methyl-N-(2-methylallyl)aniline: Intermediate-899B

[1049]

[1050] At 0 °C, 60% NaH in mineral oil (1.16 g, 48.4 mmol, 1.50 equiv) was added to a stirred solution of 2-bromo-6-methylaniline (6.00 g, 32.2 mmol, 1.00 equiv) in DMF (60 mL) and the mixture was stirred at the same temperature for 20 min. 3-Bromo-2-methyl-prop-1-ene (4.79 g, 35.5 mmol, 1.10 equiv) was added thereto and the mixture was stirred at room temperature. After 16 h, the reaction mixture was poured into cold water (600 mL) and extracted with ethyl acetate (3 × 100 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated. The residue was purified by combi-flash using ethyl acetate:hexanes (3:7) to afford Int-899B as a yellow oil (5.00 g, 20.7 mmol, 64% yield).

[1051] MS: [M+H] + 242.0

[1052] 1 H NMR (400 MHz, chloroform-d) δ 7.39 (t, J = 7.1 Hz, 1H), 7.13 (t, J = 6.9 Hz, 1H), 6.77 (q, J = 7.6, 7.2 Hz, 1H), 4.98 (d, J = 6.1 Hz, 1H), 4.86 (d, J = 6.0 Hz, 1H), 4.30 (q, J = 6.9 Hz, 1H), 3.66 (t, J = 6.9 Hz, 2H), 2.32 (d, J = 6.2 Hz, 3H), 1.78 (d, J = 6.1 Hz, 3H).

[1053] 3,8-Dimethyl-1,2,3,4-tetrahydroquinoline and 3,3,7-Trimethylindoline: Intermediate-899C and 899F

[1054]

[1055] To a stirred solution of 2-bromo-6-methyl-N-(2-methylallyl)aniline (5.00 g, 20.8 mmol, 1.00 equiv) in toluene (50 mL) was added azobisisobutyronitrile (0.68 g, 4.16 mmol, 0.200 equiv) and tributyltin hydride (6.67 g, 22.9 mmol, 1.10 equiv). The reaction mixture was then heated at 80 °C. After completion, the reaction mixture was poured into water (100 mL) and extracted with ethyl acetate (3 × 80 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated. The residue was purified by combi-flash using ethyl acetate:hexanes (1:9) to afford Int-899C (0.40 g, 2.26 mmol, 91.18% purity, 11% yield) as a yellow oil and Int-899F (1.50 g, 8.33 mmol, 40% yield).

[1056] Int-899C:

[1057] MS: [M+H]+ 162.00

[1058] 1 H NMR (400 MHz, DMSO-d 6 ) δ 6.71 (dd, J = 7.2 Hz, 2H), 6.35 (t, J = 7.4 Hz, 1H), 5.01 (s, 1H), 3.26 (m, 1H), 2.78 (t, J = 6.4 Hz, 1H), 2.66 (m, 1H), 2.33 (dd, J = 10.4 Hz, 1H), 1.98 (s, 3H), 1.59 (m, 1H), 1.29 (m, 3H), 1.10 (t, J = 8.0 Hz, 1H), 0.97 (d, J = 6.4 Hz, 1H), 0.87 (t, J = 7.6 Hz, 3H). (The product contains aliphatic impurities).

[1059] Int-899F:

[1060] MS: [M+H]+ 162.00

[1061] 1 H NMR (400 MHz, DMSO-d 6)δ 6.81 (d, J = 7.2 Hz, 1H), 6.74 (d, J = 7.3 Hz, 1H), 6.49 (t, J = 7.4 Hz, 1H), 5.18 (s, 1H), 3.17 (s, 2H), 2.05 (s, 3H), 1.60 (p, J = 7.7 Hz, 1H), 1.32 (dt, J = 14.7, 7.2 Hz, 1H), 1.20 (s, 6H), 1.12 (d, J = 8.2 Hz, 1H), 0.88 (t, J = 7.3 Hz, 1H).

[1062] (R)-3,8-Dimethyl-1-((2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenyl)sulfonyl)-1,2,3,4-tetrahydroquinoline and (S)-3,8-dimethyl-1-((2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenyl)sulfonyl)-1,2,3,4-tetrahydroquinoline: Broad_P_CaV3.3_506 and 507

[1063]

[1064] To a stirred solution of 3,8-dimethyl-1,2,3,4-tetrahydroquinoline (0.40 g, 2.26 mmol, 1.00 equiv) in pyridine (4 mL) was added triethylamine (687 mg, 6.79 mmol, 3.00 equiv), 4-dimethylaminopyridine (276 mg, 2.26 mmol, 1.00 equiv), and it was heated at 80 °C. After 0.5 h, the reaction mixture was cooled to room temperature and 2-methyl-4-(1-methylpyrazol-4-yl)benzenesulfonyl chloride (1225 mg, 4.52 mmol, 2.00 equiv) was added portionwise to the reaction mixture. The reaction mixture was heated at 80 °C for 3 h. After completion, the reaction mixture was poured into 5% citric acid solution (20 mL) and extracted with ethyl acetate (3 × 20 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combi-flash using ethyl acetate:hexanes (4:6) to afford the crude product, which was further purified by chiral preparative HPLC using (CHIRALPAK IG (250*4.6 mm) 5u), 0.1% DEA in MeOH solution) to afford Broad_P_CaV3.3_506 (30 mg, 0.0758 mmol, 3% yield) and Broad_P_CaV3.3_507 (30 mg, 0.0758 mmol, 3% yield) as off-white solids.

[1065] Broad_P_CaV3.3_506:

[1066] MS: [M+H]+ 396.2

[1067] 1 1H NMR (400 MHz, DMSO-d 6 ) δ 8.21 (s, 1H), 7.92 (s, 1H), 7.83 - 7.76 (m, 1H), 7.56 (d, J = 6.6 Hz, 2H), 7.12 (q, J = 3.7, 2.8 Hz, 2H), 6.94 (dd, J = 6.0, 3.1 Hz, 1H), 3.88 (s, 4H), 2.33 (d, J = 5.9 Hz, 1H), 2.29 (s, 3H), 2.16 (s, 3H), 1.98 (s, 1H), 1.73 (s, 1H), 1.26 (s, 1H), 0.81 (d, J = 6.7 Hz, 3H).

[1068] [α]D 25 = -27.00°

[1069] Chiral separation conditions: (CHIRALCEL IH (250*4.6 mm) 5u), 0.1% DEA - hexane solution in IPA:MeOH (1:1)) and CO 2 gas as the mobile phase

[1070] Elution order: fraction - 1 (RT: 9.05 min); fraction - 2 (RT: 9.76 min)

[1071] Broad_P_CaV3.3_507:

[1072] MS: [M+H]+ 396.2

[1073] 1 1H NMR (400 MHz, DMSO-d 6 ) δ 8.21 (s, 1H), 7.92 (s, 1H), 7.79 (d, J = 8.7 Hz, 1H), 7.56 (d, J = 6.5 Hz, 2H), 7.12 (q, J = 3.8, 2.8 Hz, 2H), 6.94 (dd, J = 5.9, 3.1 Hz, 1H), 3.88 (s, 4H), 2.33 (d, J = 5.8 Hz, 1H), 2.29 (s, 3H), 2.16 (s, 3H), 1.98 (s, 1H), 1.74 (s, 1H), 1.26 (s, 1H), 0.81 (d, J = 6.7 Hz, 3H).

[1074] [α]D 25 = +26.00°

[1075] Chiral separation conditions: (CHIRALCEL IH (250 * 4.6 mm) 5u), 0.1% DEA - hexane solution in IPA:MeOH (1:1)) and CO 2 gas as the mobile phase

[1076] Elution order: fraction - 1 (RT: 9.05 min); fraction - 2 (RT: 9.76 min)

[1077] 4 - [4 - (1 - ethyl - 1H - pyrazol - 4 - yl) - 2 - methylbenzenesulfonyl] - 1,5 - dimethyl - 1,2,3,4 - tetrahydroquinoxaline (Broad000415 - 040, compound 28)

[1078]

[1079] To a round - bottom flask, add N - methyl bromosulfonamide (75 mg, 0.1897 mmol, 1 equiv) in dioxane / water 4:1 (1.5 mL), ethylpyrazole boronic acid pinacol ester (50.5 mg, 0.2276 mmol, 1.2 equiv), sodium carbonate (60.3 mg, 0.5691 mmol, 3 equiv), XPhos Pd G2 (7.46 mg, 0.009485 mmol, 0.05 equiv). Stir the reaction mixture at 80 °C for 2 h. After cooling to room temperature, partition the reaction mixture between water and EtOAc. Dry the organic layer with MgSO 4 dry, filter and concentrate. Purify the crude product by flash chromatography on silica gel (hexane / EtOAc) to afford the desired N - ethylpyrazole N - sulfonamide (67 mg, 97% purity, 83% yield). Perform a second purification on reverse - phase chromatography, eluting with (water / ACN) to remove pinacol and obtain N - ethylpyrazole N - sulfonamide (4.9 mg, 6.10% yield).

[1080] 1H NMR (400 MHz, chloroform - d) δ 7.92 (d, J = 8.3 Hz, 1H), 7.80 (s, 1H), 7.71 (s, 1H), 7.33 (dd, J = 8.3, 1.8 Hz, 1H), 7.28 (s, 1H), 7.04 (t, J = 7.9 Hz, 1H), 6.59 (d, J = 7.5 Hz, 1H), 6.39 (d, J = 8.1 Hz, 1H), 4.22 (q, J = 7.3 Hz, 3H), 3.24 (s, 1H), 2.97 (m, 2H), 2.47 (s, 3H), 2.35 (s, 3H), 2.13 (s, 3H), 1.54 (t, J = 7.3 Hz, 3H). MS (ESI): 411.8 [M + H]+.

[1081] Synthesis of Compound 31 and Compound 45

[1082]

[1083] tert-Butyl N-[2-[(4-bromo-2-methylphenyl)sulfonylamino]-3-methylphenyl]carbamate:

[1084]

[1085] To a stirred solution of tert-butyl N-(2-amino-3-methylphenyl)carbamate (6.00 g, 27.0 mmol, 1.00 equiv) and pyridine (8.73 mL, 108 mmol, 4.00 equiv) in DCM (5 mL) at room temperature was added 4-bromo-2-methylbenzenesulfonyl chloride (8.73 g, 32.4 mmol, 1.20 equiv). The reaction mixture was stirred at the same temperature for 16 h. After completion, the reaction was quenched with 10% citric acid solution (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by silica gel column chromatography (6:4, ethyl acetate:hexanes as the mobile phase) to afford Broad_P_CaV3.3_495_Int-536 as a yellow solid (12.00 g, 26.4 mmol, 98% yield).

[1086] 1H NMR (400 MHz, DMSO-d6) δ 9.36 (s, 1H), 7.67 (s, 1H), 7.62 (s, 1H), 7.56 (d, J = 13.2 Hz, 3H), 7.15 (t, J = 7.9 Hz, 1H), 6.92 (d, J = 7.7 Hz, 1H), 2.43 (s, 3H), 2.08 (s, 3H), 1.40 (s, 9H).

[1087] tert-Butyl 4-(4-bromo-2-methylphenyl)sulfonyl-5-methyl-2,3-dihydroquinoxaline-1-carboxylate:

[1088]

[1089] To a stirred solution of tert-butyl N-[2-[(4-bromo-2-methylphenyl)sulfonylamino]-3-methylphenyl]carbamate (12.00 g, 26.4 mmol, 1.00 equiv) and 1,2-dibromoethane (2.73 mL, 31.6 mmol, 1.20 equiv) in DMF (100 mL) was added potassium carbonate (7.28 g, 52.7 mmol, 2.00 equiv). The reaction mixture was heated at 80 °C and stirred at the same temperature for 12 h. After completion, the reaction mixture was poured into ice-cold water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL), dried over Na 2 SO 4 and evaporated in vacuo to afford Broad_P_CaV3.3_495_Int-540A as a brown solid (10.20 g, 21.2 mmol, 80% yield).

[1090] 1H NMR (400 MHz, DMSO-d6) δ 7.90 (d, J = 8.5 Hz, 1H), 7.65 - 7.54 (m, 1H), 7.40 (d, J = 8.2 Hz, 1H), 7.20 (t, J = 7.9 Hz, 1H), 7.04 (d, J = 7.5 Hz, 1H), 5.76 (s, 0H), 4.30 (dt, J = 13.1, 4.3 Hz, 1H), 3.29 (h, J = 6.0 Hz, 2H), 2.37 (s, 2H), 2.00 (s, 2H), 1.37 (s, 6H), 1.32 (s, 2H).

[1091] tert-Butyl 5-methyl-4-[2-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-2,3-dihydroquinoxaline-1-carboxylate:

[1092]

[1093] tert-Butyl 4-(4-bromo-2-methylphenyl)sulfonyl-5-methyl-2,3-dihydroquinoxaline-1-carboxylate (10.20 g, 21.2 mmol, 1.00 equiv), 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)pyrazole (5.29 g, 25.4 mmol, 1.20 equiv), and potassium carbonate (5.86 g, 42.4 mmol, 2.00 equiv) in a stirred suspension in 1,4-dioxane (80 mL) and water (20 mL) were degassed with nitrogen for 15 min. [1,1'-Bis(diphenylphosphino)ferrocene]dichloropalladium(II) complex with dichloromethane (0.87 g, 1.06 mmol, 0.0500 equiv) was added and it was heated at 120 °C for 16 h. After completion, the reaction mixture was diluted with ethyl acetate (100 mL) and washed with brine solution (3 × 70 mL). The organic layer was dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combi flash using (1:1, ethyl acetate:hexanes) as the mobile phase to afford Broad_P_CaV3.3_495_Int-540B as a brown solid (10.00 g, 19.3 mmol, 91% yield).

[1094] MS: [M+H]+ 482.6

[1095] 5-Methyl-4-[2-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-2,3-dihydro-1H-quinoxaline:

[1096]

[1097] To a stirred solution of tert-butyl 5-methyl-4-[2-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-2,3-dihydroquinoxaline-1-carboxylate (10.00 g, 20.7 mmol, 1.00 equiv) in 1,4-dioxane (70 mL) at 0 °C was added a 4.0 M solution of hydrogen chloride in dioxane (10.07 mL, 290 mmol, 14.0 equiv). The reaction mixture was stirred at room temperature for 12 h. After completion, the reaction mixture was concentrated in vacuo. The residue was stirred with n-hexane (100 mL) and the free solid was filtered through a Buchner funnel and washed with ethyl acetate (2 × 30 mL). The solid was dried in vacuo and dissolved in saturated NaHCO 3 solution (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were dried over Na 2 SO 4Dry and evaporate under vacuum to afford Broad_P_CaV3.3_495_Int-540C as an off-white solid (7.00 g, 17.8 mmol, 86% yield).

[1098] MS: [M+H]+ 382.48

[1099] 1H NMR (400 MHz, DMSO-d6) δ 8.29 (s, 1H), 7.99 (s, 1H), 7.84 (d, J = 8.2 Hz, 1H), 7.60 - 7.50 (m, 2H), 6.85 (t, J = 7.7 Hz, 1H), 6.35 (t, J = 8.7 Hz, 2H), 5.92 (s, 1H), 3.96 (s, 1H), 3.87 (s, 4H), 3.53 (s, 2H), 3.07 (s, 2H), 2.68 (s, 2H), 2.21 (s, 3H), 2.15 (s, 3H).

[1100] 5-Methyl-4-[2-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-1-(trifluoromethyl)-2,3-dihydroquinoxaline:

[1101]

[1102] To a stirred solution of 5-methyl-4-[2-methyl-4-(1-methylpyrazol-4-yl)phenyl]sulfonyl-2,3-dihydro-1H-quinoxaline (1.00 g, 2.61 mmol, 1.00 equiv) in acetonitrile (8 mL) was added tetramethylammonium (trifluoromethyl)sulfanide (0.60 g, 3.40 mmol, 1.30 equiv), and the reaction mixture was stirred at room temperature for 15 min, then silver(I) fluoride (1.66 g, 13.1 mmol, 5.00 equiv) was added at room temperature. The reaction mixture was stirred at 50 °C for 24 h. After completion, the reaction mixture was quenched by the addition of water (50 mL) and extracted with ethyl acetate (3 × 80 mL). The combined organic layers were washed with brine solution (3 × 50 mL), dried over Na 2 SO 4 and evaporated under vacuum. The residue was purified by silica gel column chromatography using (1:5, ethyl acetate:hexanes) as the mobile phase to afford an impure compound, which was further purified by preparative HPLC using (45 - 100% solution of ACN in water and 0.1% solution of NH3 in water as the modifier) to afford Broad_P_CaV3.3_495 as a white solid (135 mg, 0.299 mmol, 11% yield).

[1103] MS: [M+H]+ 450.48

[1104] 1H NMR (400 MHz, DMSO-d6) δ 8.28 (s, 1H), 7.97 (s, 1H), 7.88 (d, J = 8.3 Hz, 1H), 7.61 - 7.49 (m, 2H), 7.21 (t, J = 8.0 Hz, 1H), 7.03 (d, J = 7.6 Hz, 1H), 6.87 (d, J = 8.3 Hz, 1H), 4.35 (d, J = 13.9 Hz, 1H), 3.87 (s, 3H), 3.48 - 3.37 (m, 1H), 3.28 (d, J = 7.0 Hz, 2H), 2.34 (s, 3H), 2.04 (s, 3H).

[1105] 19F NMR (376 MHz, DMSO-d6) δ -58.50.

[1106] 1,5-Dimethyl-4-[2-methyl-3-(3-methyl-1,2-oxazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad000374-080, Compound 32)

[1107]

[1108] At room temperature, to a stirred solution of 8-methyl-1-[2-methyl-3-(3-methyl-1,2-oxazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (150 mg, 0.3911 mmol), iodomethane (83.2 mg, 0.5866 mmol) and potassium carbonate (161 mg, 1.17 mmol) in DMF (4 mL). The reaction mixture was heated at 50 °C and stirred at the same temperature for 18 h. After completion, the reaction mixture was poured into ice water (20 mL) and extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine solution (2 × 20 mL), dried over Na 2 SO 4 dried and evaporated. The residue was purified by Biotage (5:1 Hex / EtOAc; 12S column) to afford 1,5-dimethyl-4-[2-methyl-3-(3-methyl-1,2-oxazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline as a white solid (110 mg, 69.0% yield).

[1109] 1H NMR (400 MHz, DMSO-d6) δ 8.18 (d, J = 7.9 Hz, 1H), 7.83 (d, J = 7.7 Hz, 1H), 7.55 (t, J = 7.9 Hz, 1H), 7.02 (t, J = 7.8 Hz, 1H), 6.61 (s, 1H), 6.54 (d, J = 7.5 Hz, 1H), 6.46 (d, J = 8.2 Hz, 1H), 4.20 - 4.05 (m, 1H), 3.27 (s, 1H), 2.96 (s, 1H), 2.67 (d, J = 8.3 Hz, 1H), 2.41 (s, 3H), 2.28 (d, J = 8.7 Hz, 6H), 2.03 (s, 3H). MS (ESI): 398.4 [M+H]+.

[1110] 1-Ethyl-5-methyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad000415-036. Compound 33)

[1111]

[1112] To a Schlenk flask, add sulfamide pyrazole (68.6 mg, 0.1793 mmol, 1 equiv) and potassium carbonate (74.3 mg, 0.5379 mmol, 3 equiv) in DMF (0.7 mL). After stirring for 15 min, add iodoethane (100 μL, 1.25 mmol, 7 equiv). Stir the reaction mixture at 60 °C for 1 h and at 70 °C for 65 h. Pour the reaction mixture into water and extract the product with EtOAc. Wash the organic layer with LiCl (5%), dry over MgSO 4 dry, filter and concentrate. Purify the crude product by flash chromatography on silica gel (hexanes / EtOAc) to afford the desired N-ethylsulfamide methyl pyrazole (27 mg, 36.2% yield).

[1113] 1H NMR (400 MHz, chloroform-d) δ 7.92 (d, J = 8.2 Hz, 1H), 7.78 (s, 1H), 7.66 (s, 1H), 7.33 (d, J = 8.3 Hz, 1H), 7.02 (t, J = 7.8 Hz, 1H), 6.57 (d, J = 7.5 Hz, 1H), 6.44 (d, J = 8.2 Hz, 1H), 4.29 (d, J = 16.3 Hz, 1H), 3.96 (s, 3H), 3.24 (m, J = 15.9 Hz, 1H), 3.01 (m, J = 6.4 Hz, 4H), 2.36 (s, 3H), 2.13 (s, 3H), 0.84 (t, J = 7.1 Hz, 3H). MS (ESI): 411.40 [M+H]+.

[1114] 6-Fluoro-1,4-dimethyl-3-[2-methyl-4-(4-methyl-1H-imidazol-1-yl)phenyl]sulfonyl-indole (Broad_P_CaV3.3_640, Compound 22)

[1115]

[1116] To a stirred suspension of 3-(4-bromo-2-methyl-phenyl)sulfonyl-6-fluoro-1,4-dimethyl-indole (185 mg, 0.467 mmol, 1.00 equiv) in DMF was added 4-methyl-1H-imidazole (153 mg, 1.87 mmol, 4.00 equiv), copper(I) oxide (20 mg, 0.140 mmol, 0.300 equiv), potassium tert-butoxide (157 mg, 1.40 mmol, 3.00 equiv), and the reaction mixture was stirred at 140 °C for 16 h. After 16 h, the reaction mixture was diluted with water (5 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combi flash using (25:1, DCM:MeOH) as the mobile phase to give an impure product; it was further purified by preparative HPLC using (20 - 60% ACN and water (containing 0.1% formic acid as a modifier) as the mobile phase to give Broad_P_CaV3.3_640 as a white solid, (8.4 mg, 0.0209 mmol, 4% yield).

[1117] 1H NMR (400 MHz, DMSO-d6) δ 8.28 (d, J = 6.5 Hz, 2H), 7.92 (d, J = 8.6 Hz, 1H), 7.73 (d, J = 2.3 Hz, 1H), 7.65 (dd, J = 8.6, 2.4 Hz, 1H), 7.55 (s, 1H), 7.37 (dd, J = 9.4, 2.3 Hz, 1H), 6.89 (dd, J = 10.5, 2.4 Hz, 1H), 3.88 (s, 3H), 2.54 (s, 3H), 2.42 (s, 3H), 2.16 (s, 3H). MS (ESI): [M+H]+ 398.0.

[1118] 3-(4-Bromo-2-methyl-phenyl)sulfonyl-6-fluoro-1,4-dimethyl-indole

[1119]

[1120] To a solution of 3-(4-bromo-2-methylphenyl)thio-6-fluoro-1,4-dimethylindole (310 mg, 0.851 mmol, 1.00 equiv) in DCM (6 mL) was added 3-chloroperoxybenzoic acid (441 mg, 2.55 mmol, 3.00 equiv), and the reaction mixture was stirred at 25 °C for 12 h. After completion, the reaction mixture was diluted with ethyl acetate (100 mL) and washed with sodium bicarbonate solution (3 × 70 mL). The organic layer was dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combi flash using (1:1, ethyl acetate:hexanes) as the mobile phase to afford Broad_P_CaV3.3_640_Int_1340 as a yellow solid (185 mg, 0.467 mmol, 55% yield). MS (ESI): [M+H]+ 398.0.

[1121] 3-(4-bromo-2-methylphenyl)thio-6-fluoro-1,4-dimethylindole

[1122]

[1123] To a solution of 6-fluoro-1,4-dimethylindole (300 mg, 1.84 mmol, 1.00 equiv) in DMF (3 mL) at 25 °C was added tetrabutylammonium iodide (1358 mg, 3.68 mmol, 2.00 equiv) and 4-bromo-2-methylbenzenesulfonyl chloride (496 mg, 1.84 mmol, 1.00 equiv), and the reaction mixture was stirred at 25 °C for 4 h. After completion, the reaction was quenched with water (100 mL) and extracted with ethyl acetate (3 x 15 mL). The combined organic layers were washed with water (3 × 100 mL), brine, dried over anhydrous Na 2 SO 4 and concentrated in vacuo to give the crude product, which was then purified by column chromatography using 25% ethyl acetate in hexanes as the mobile phase to afford Broad_P_CaV3.3_640_Int_1339 as a yellow solid (310 mg, 0.851 mmol, 46% yield).

[1124] 1H NMR (400 MHz, chloroform-d) δ 7.92 (s, 1H), 7.84 (d, J = 8.3 Hz, 1H), 7.46 (d, J = 7.8 Hz, 2H), 6.94 (dd, J = 8.7, 2.3 Hz, 1H), 6.81 (dd, J = 10.3, 2.4 Hz, 1H), 3.87 (s, 3H), 2.61 (s, 3H), 2.51 (d, J = 8.8 Hz, 3H).

[1125] 8-Methyl-1-[2-methyl-3-(3-methyl-1,2-oxazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_272, Compound 35)

[1126]

[1127] To a stirred solution of 1-(3-bromo-2-methylphenylsulfonyl)-8-methyl-1,2,3,4-tetrahydroquinoxaline (350 mg, 0.9179 mmol), xphos (61.2 mg, 0.1285 mmol), and palladium(II) acetate (14.4 mg, 0.06425 mmol) in 1,4-dioxane (5 mL) at room temperature was added 3-methyl-5-(tributylstannyl)-1,2-oxazole (409 mg, 1.10 mmol) at the same temperature. The reaction mixture was purged with argon for 10 min and heated at 100 °C for 8 h. After completion, the reaction mixture was poured into water (30 mL) and extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine solution (3 × 20 mL), dried over Na 2 SO 4 dried and evaporated. The residue was purified by Biotage (5:1 Hex / EtOAc; 12S column) to afford 8-methyl-1-[2-methyl-3-(3-methyl-1,2-oxazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (250 mg, 71.2% yield) as a white solid.

[1128] 1H NMR (400 MHz, DMSO-d6) δ 8.17 (d, J = 8.0 Hz, 1H), 7.88 (d, J = 7.7 Hz, 1H), 7.56 (t, J = 7.9 Hz, 1H), 6.86 (t, J = 7.7 Hz, 1H), 6.67 (s, 1H), 6.42 - 6.31 (m, 2H), 5.98 (s, 1H), 3.98 (s, 1H), 3.12 (s, 2H), 2.68 (s, 1H), 2.30 (s, 3H), 2.24 (s, 3H), 2.19 (s, 3H). MS (ESI): 384.2 [M+H]+.

[1129] (3S)-3,7-Dimethyl-1-[[4-methyl-6-(4-methyl-1H-imidazol-1-yl)-3-pyridinyl]sulfonyl]indoline (Broad_P_CaV3.3_660A) and (3R)-3,7-dimethyl-1-[[4-methyl-6-(4-methyl-1H-imidazol-1-yl)-3-pyridinyl]sulfonyl]indoline (Broad_P_CaV3.3_660B) (Compounds 36 and 90)

[1130]

[1131] A mixture of 1-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-3,7-dimethyl-indoline (200 mg, 0.525 mmol, 1.00 equiv), 4-methyl-1H-imidazole (172 mg, 2.10 mmol, 4.00 equiv), tBuXPhos (45 mg, 0.105 mmol, 0.200 equiv), and tripotassium phosphate (223 mg, 1.05 mmol, 2.00 equiv) in 1,4-dioxane (5 mL) was degassed for 10 minutes, and tris(dibenzylideneacetone)dipalladium(0) (48 mg, 0.0525 mmol, 0.100 equiv) was added to the reaction mixture and heated at 120 °C for 16 h. After completion, the reaction mixture was diluted with water (100 mL) and the product was extracted in ethyl acetate (100 mL × 3). The organic layer was dried over sodium sulfate and evaporated in vacuo to afford a residue. The residue was purified by silica gel column chromatography using a solution of 60%-70% ethyl acetate in hexane. The product fractions were evaporated in vacuo to afford an impure product. The impure product was further purified by preparative HPLC using 5%-55% acetonitrile in water containing 0.1% formic acid as a modifier as the mobile phase in a SUNFIRE C18 (250*19) mm, 5 μm column. The product fractions were lyophilized under reduced pressure to afford a racemic mixture (Broad_P_CaV3.3_660). The racemic mixture was purified by chiral preparative HPLC using a solution of 10% of 0.1% DEA in IPA:methanol (50:50) / 0.1% DEA in n-hexane as the mobile phase in a CHIRALPAK IH (250*21) mm, 5 μm column. The product fractions were evaporated in vacuo and lyophilized under reduced pressure to afford an off-white solid of Broad_P_CaV3.3_660B (21 mg, 0.0533 mmol, 10% yield) and an off-white solid of Broad_P_CaV3.3_660A (21 mg, 0.0532 mmol, 10% yield).

[1132] Broad_P_CaV3.3_660A

[1133] 1H NMR (400 MHz, DMSO-d6) δ 8.87 (s, 1H), 8.50 (d, J = 1.4 Hz, 1H), 7.78 (s, 1H), 7.71 (s, 1H), 7.24 - 7.08 (m, 2H), 7.03 (d, J = 6.8 Hz, 1H), 4.31 (dd, J = 12.9, 7.3 Hz, 1H), 3.44 (dd, J = 12.9, 10.4 Hz, 1H), 2.60 (dq, J = 15.3, 5.8, 5.0 Hz, 1H), 2.42 (s, 3H), 2.17 (s, 3H), 2.06 (s, 3H), 1.01 (d, J = 6.7 Hz, 3H). MS (ESI): 383.0 [M+H]+.

[1134] Broad_P_CaV3.3_660B

[1135] 1H NMR (400 MHz, DMSO-d6) δ 8.87 (s, 1H), 8.57 - 8.43 (m, 1H), 7.74 (d, J = 28.0 Hz, 2H), 7.24 - 7.11 (m, 2H), 7.03 (d, J = 6.8 Hz, 1H), 4.30 (dd, J = 12.9, 7.3 Hz, 1H), 3.43 (dd, J = 12.9, 10.4 Hz, 1H), 2.60 (dt, J = 10.1, 6.9 Hz, 1H), 2.41 (s, 3H), 2.17 (s, 3H), 2.06 (s, 3H), 1.00 (d, J = 6.7 Hz, 3H). MS (ESI): 383.0 [M+H]+.

[1136] 1-[(6-Bromo-4-methyl-3-pyridinyl)sulfonyl]-3,7-dimethyl-indoline

[1137]

[1138] At 0 °C, 6-bromo-4-methyl-pyridine-3-sulfonyl chloride (1654 mg, 6.11 mmol, 1.50 equiv) was added to a solution of 3,7-dimethylindoline (600 mg, 4.08 mmol, 1.00 equiv) in dichloromethane (12 mL), followed by the addition of pyridine (1.65 mL, 20.4 mmol, 5.00 equiv), and the reaction mixture was stirred at room temperature for 16 h. After completion, the reaction mixture was diluted with water (100 mL) and the product was extracted in dichloromethane (100 mL × 3). The organic layer was dried over sodium sulfate and evaporated in vacuo to afford a residue. The residue was purified by silica gel column chromatography using a 1%-2% solution of ethyl acetate in hexane. The product fractions were evaporated in vacuo to afford a reddish-brown semi-solid of Int-1402 (500 mg, 0.837 mmol, 21% yield). MS (ESI): 383.2 [M+H]+.

[1139] 3,7-dimethylindoline

[1140]

[1141] Sodium cyanoborohydride (1.30 g, 20.7 mmol, 3.00 equiv) was added portionwise to a solution of 3,7-dimethyl-1H-indole (1.00 g, 6.89 mmol, 1.00 equiv) in acetic acid (10 mL) at 0 °C, and the reaction mixture was stirred for 3 h. After completion, the reaction was basified with 2 M aqueous sodium hydroxide and extracted with ethyl acetate (150 mL × 3). The organic layer was dried over sodium sulfate and evaporated in vacuo to afford a crude product. The crude product was purified by silica gel column chromatography using a 0%-5% solution of ethyl acetate in hexane as the mobile phase. The product fractions were collected and evaporated in vacuo to afford a yellow oil of 3,7-dimethylindoline Int-1364 (500 mg, 1.46 mmol, 21% yield). MS (ESI): 148.1 [M+H]+.

[1142] 7-methyl-1-[[4-methyl-6-(4-methylimidazol-1-yl)-3-pyridinyl]sulfonyl]indoline (Broad_P_CaV3.3_649, Compound 37)

[1143]

[1144] A stirred suspension of 1-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-7-methyl-indoline (200 mg, 0.545 mmol, 1.00 equiv), 4-methyl-1H-imidazole (89 mg, 1.09 mmol, 2.00 equiv) and potassium tert-butoxide (183 mg, 1.63 mmol, 3.00 equiv) in DMF (5 mL) was degassed with nitrogen for 15 min. Cuprous(I) oxide (23 mg, 0.163 mmol, 0.300 equiv) was added thereto and it was heated at 140 °C for 12 h. After completion, the reaction mixture was diluted with ethyl acetate (100 mL) and washed with brine solution (3 × 70 mL). The organic layer was dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combi flash using (1:1, ethyl acetate:hexanes) as the mobile phase to afford a mixture of isomers which was further purified by preparative HPLC to yield Broad_P_CaV3.3_649 as an off-white solid (20 mg, 0.0543 mmol, 10% yield).

[1145] 1H NMR (400 MHz, DMSO-d6) δ 8.88 (s, 1H), 8.54 (s, 1H), 7.76 (d, J = 20.9 Hz, 2H), 7.16 (d, J = 4.5 Hz, 2H), 7.06 (t, J = 4.4 Hz, 1H), 4.03 (t, J = 7.2 Hz, 2H), 2.46 (s, 3H), 2.33 (t, J = 7.2 Hz, 2H), 2.19 (s, 3H), 2.01 (s, 3H). MS (ESI): 369.2 [M+H]+.

[1146] 1-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-7-methyl-indoline

[1147]

[1148] To a stirred solution of 7-methyl-indoline (200 mg, 1.50 mmol, 1.00 equiv) and pyridine (0.49 mL, 6.01 mmol, 4.00 equiv) in DCM (5 mL) at room temperature was added 6-bromo-4-methyl-pyridine-3-sulfonyl chloride (812 mg, 3.00 mmol, 2.00 equiv). The reaction mixture was stirred at the same temperature for 12 h. After completion, the reaction was quenched with 10% citric acid solution (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL) and dried over Na 2 SO 4Dry and evaporate. The residue was purified by silica gel column chromatography (6:4, ethyl acetate: hexanes as the mobile phase) to afford Broad_P_CaV3.3_649_Int-1378 as a brown solid (390 mg, 0.722 mmol, 48% yield). LCMS: 368.2 [M+H]+.

[1149] 1,5-Dimethyl-4-{[2-methyl-6-(4-methyl-1H-imidazol-1-yl)pyridin-3-yl]sulfonyl}-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_359, Compound 38)

[1150]

[1151] To a stirred solution of 4-[(6-bromo-2-methylpyridin-3-yl)sulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (0.6 g, 1.51 mmol) at room temperature was added 4-methyl-1H-imidazole (247 mg, 3.02 mmol), a solution of potassium tert-butoxide (508 mg, 4.53 mmol) in DMF (5 mL), and the reaction mixture was degassed with argon for 20 min. Subsequently, copper(I) oxide (43.2 mg, 0.302 mmol) was added at room temperature, and the reaction mixture was heated at 120 °C for 16 h. After completion, the reaction mixture was poured into water (100 mL) and extracted with EtOAc (3 × 30 mL). The organic layer was washed with brine solution (2 × 30 mL), dried over Na 2 SO 4 Dry and evaporate. The product was loaded onto a preparative HPLC column and eluted with a 35%-50% ACN gradient in 0.1% aqueous formic acid to afford 1,5-dimethyl-4-{[2-methyl-6-(4-methyl-1H-imidazol-1-yl)pyridin-3-yl]sulfonyl}-1,2,3,4-tetrahydroquinoxaline as an off-white solid (178 mg, 29.3% yield).

[1152] 1H NMR (400 MHz, chloroform-d) δ 8.55 (s, 1H), 8.27 (d, J = 8.8 Hz, 1H), 7.40 (s, 1H), 7.22 (d, J = 8.6 Hz, 1H), 7.09 (dd, J = 9.3, 6.5 Hz, 1H), 6.67 (d, J = 7.6 Hz, 1H), 6.40 (d, J = 8.2 Hz, 1H), 4.42 - 4.28 (m, 1H), 3.07 - 2.92 (m, 2H), 2.40 (d, J = 2.9 Hz, 6H), 2.32 (s, 2H). MS (ESI): 398.3 [M+H]+.

[1153] Synthesis of 3,7-dimethyl-1-[2-methyl-4-(4-methylimidazol-1-yl)phenyl]sulfonyl-indole (Compound 40)

[1154]

[1155] 2-Isopropenyl-6-methyl-aniline: Intermediate 1098A

[1156]

[1157] A mixture of 2-bromo-6-methyl-aniline (1500 mg, 8.06 mmol, 1.00 equiv), 2-isopropenyl-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (1626 mg, 9.67 mmol, 1.20 equiv) and cesium carbonate (7881 mg, 24.2 mmol, 3.00 equiv) in tetrahydrofuran (15 mL) and water (1.5 mL) was degassed under nitrogen for 10 minutes, and a complex of [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) with dichloromethane (658 mg, 0.806 mmol, 0.100 equiv) was added to the reaction mixture, and the reactants were heated at 80 °C for 4 h. After completion, the reaction mixture was diluted with water (100 mL) and the product was extracted in ethyl acetate (3 × 100 mL). The organic layer was dried over sodium sulfate and evaporated in vacuo. The residue was purified by silica gel column chromatography using a 5%-10% solution of ethyl acetate in hexane as the mobile phase. The product fractions were evaporated in vacuo to afford 2-isopropenyl-6-methyl-aniline Int-1098A as a yellow semi-solid (500 mg, 2.45 mmol, 30% yield). MS (ESI): 148.1 [M+1] +

[1158] 4-Bromo-N-(2-isopropenyl-6-methyl-phenyl)-2-methyl-benzenesulfonamide: Intermediate 1098B

[1159]

[1160] At room temperature, pyridine (0.99 mL, 12.3 mmol, 5.00 equiv) was added dropwise to a solution of 2-isopropenyl-6-methyl-aniline (500 mg, 2.45 mmol, 1.00 equiv) and 4-bromo-2-methyl-benzenesulfonyl chloride (991 mg, 3.68 mmol, 1.50 equiv) in dichloromethane (7.22 mL), and the reaction mixture was stirred at room temperature for 16 h. After completion, the reaction mixture was concentrated under vacuum and purified by silica gel column chromatography using a 10%-15% solution of ethyl acetate in hexane. The product fraction was evaporated under vacuum to afford a off-white solid of 4-bromo-N-(2-isopropenyl-6-methyl-phenyl)-2-methyl-benzenesulfonamide Int-1098B (500 mg, 0.864 mmol, 35% yield). MS (ESI): 382.0 [M+2H] +

[1161] N-(2-Isopropenyl-6-methyl-phenyl)-2-methyl-4-(4-methyl-imidazol-1-yl)benzenesulfonamide: Intermediate 1098C

[1162]

[1163] A mixture of 4-bromo-N-(2-isopropenyl-6-methyl-phenyl)-2-methyl-benzenesulfonamide (100 mg, 0.173 mmol, 1.00 equiv), 4-methyl-1H-imidazole (57 mg, 0.691 mmol, 4.00 equiv), tBuXPhos (15 mg, 0.0345 mmol, 0.200 equiv) and tripotassium phosphate (73 mg, 0.345 mmol, 2.00 equiv) in 1,4-dioxane (1.31 mL) was degassed for 10 min. After degassing, tris(dibenzylideneacetone)dipalladium(0) (16 mg, 0.0173 mmol, 0.100 equiv) was added and the reaction mixture was heated at 120 °C for 16 h. After 16 h, the reaction mixture was poured into a mixture of water (50 mL) and ethyl acetate (3 × 50 mL). The organic layer was dried over sodium sulfate and evaporated under vacuum. The residue was purified by silica gel column chromatography using an 80%-90% solution of ethyl acetate in hexane as the mobile phase. The product fraction was evaporated under vacuum to afford a light brown semi-solid of N-(2-isopropenyl-6-methyl-phenyl)-2-methyl-4-(4-methyl-imidazol-1-yl)benzenesulfonamide Int-1098C (50 mg, 0.102 mmol, 59% yield). 1 H NMR (400 MHz, methanol-d 4)δ 8.20 (d, J = 1.6 Hz, 1H), 7.81 (d, J = 8.5 Hz, 1H), 7.62 (d, J = 2.3 Hz, 1H), 7.51 - 7.40 (m, 2H), 7.16 (d, J = 4.7 Hz, 2H), 6.98 (t, J = 4.6 Hz, 1H), 4.80 - 4.62 (m, 2H), 2.72 (s, 3H), 2.29 (d, J = 6.2 Hz, 6H), 1.74 (s, 3H). MS(ESI): 382.3 [M + H] +

[1164] 3,7 - Dimethyl - 1 - [2 - methyl - 4 - (4 - methyl - 1H - imidazol - 1 - yl)phenyl]sulfonyl - indole (Compound 40)

[1165]

[1166] To a solution of N - (2 - isopropenyl - 6 - methyl - phenyl) - 2 - methyl - 4 - (4 - methyl - 1H - imidazol - 1 - yl)benzenesulfonamide (200 mg, 0.407 mmol, 1.00 equiv) in dimethylformamide (1.55 mL) was added silver nitrate (138 mg, 0.815 mmol, 2.00 equiv) and the reaction mixture was heated at 120 °C for 16 h. After completion, the reaction mixture was diluted with water (100 mL) and extracted with ethyl acetate (3 × 100 mL). The organic layer was dried over sodium sulfate and evaporated in vacuo. The residue was purified by silica gel column chromatography using a solution of 50% - 60% ethyl acetate in hexane as the mobile phase. The product fractions were evaporated in vacuo to afford an impure product. The impure product was purified by preparative HPLC using a Phenomenex C8 (250 * 21.2) mm, 5 μ column and 20% - 45% acetonitrile in water containing 0.1% formic acid as the mobile phase to give 3,7 - dimethyl - 1 - [2 - methyl - 4 - (4 - methyl - 1H - imidazol - 1 - yl)phenyl]sulfonyl - indole as an off - white solid Broad_P_CaV3.3_553 (30 mg, 0.0777 mmol, 19% yield).

[1167] 1 H NMR(400 MHz, DMSO - d 6 )δ 8.29 (s, 1H), 7.84 (d, J = 2.3 Hz, 1H), 7.65 (d, J = 9.4 Hz, 2H), 7.56 (s, 1H), 7.48 (dd, J = 8.3, 4.8 Hz, 2H), 7.22 (t, J = 7.5 Hz, 1H), 7.09 (d, J = 7.4 Hz, 1H), 2.34 (s, 3H), 2.28 (s, 3H), 2.15 (s, 3H).

[1168] 1 H NMR (400 MHz, DMSO-d 6, D2O exchange) δ 8.25 (s, 1H), 7.76 (s, 1H), 7.61 (d, J = 8.6 Hz, 2H), 7.57 - 7.49 (m, 2H), 7.46 (d, J = 7.9 Hz, 1H), 7.21 (t, J = 7.6 Hz, 1H), 7.07 (d, J = 7.4 Hz, 1H), 2.46 (s, 3H), 2.31 (s, 3H), 2.25 (s, 3H), 2.13 (s, 3H). MS (ESI): 379.9 [M] +

[1169] 1,5 - Dimethyl - 4 - {[4 - methyl - 6 - (1 - methyl - 1H - pyrazol - 4 - yl)pyridin - 3 - yl]sulfonyl}-1,2,3,4 - tetrahydroquinoxaline (Broad_P_CaV3.3_286, Compound 41)

[1170]

[1171] At room temperature, potassium carbonate (215 mg, 1.56 mmol, 4 equiv) was added to a stirred solution of 8 - methyl - 1 - {[4 - methyl - 6 - (1 - methyl - 1H - pyrazol - 4 - yl)pyridin - 3 - (0.15 g, 391 μmol, 1 equiv) in DMF (2 mL) and stirred for 30 min. Subsequently, methyl iodide (110 mg, 782 μmol, 2 equiv) was added dropwise at room temperature and the reaction mixture was stirred at 70 °C for 16 h. After completion, the reaction mixture was poured into water (50 mL) and extracted with EtOAc (3 × 50 mL). The organic layer was washed with brine solution (2 × 50 mL), dried over Na 2 SO 4 and evaporated. The impure product was purified by flash chromatography using [0 - 5% MeOH / DCM] to give the impure product. The impure product was purified by preparative HPLC using (20 - 70% ACN in water containing 0.1% formic acid as a modifier) as the mobile phase to give 1,5 - dimethyl - 4 - {[4 - methyl - 6 - (1 - methyl - 1H - pyrazol - 4 - yl)pyridin - 3 - yl]sulfonyl}-1,2,3,4 - tetrahydroquinoxaline as an off - white solid (0.032 g, 20.6% yield).

[1172] 1H NMR (400 MHz, DMSO-d6) δ 8.84 (s, 1H), 8.39 (s, 1H), 8.08 (s, 1H), 7.60 (s, 1H), 7.03 (t, J = 7.8 Hz, 1H), 6.57 (d, J = 7.5 Hz, 1H), 6.44 (d, J = 8.2 Hz, 1H), 4.24 (dd, J = 14.8, 7.2 Hz, 1H), 3.89 (s, 3H), 2.97 (dd, J = 11.4, 6.5 Hz, 1H), 2.84 (t, J = 9.6 Hz, 1H), 2.32 (d, J = 5.2 Hz, 6H), 1.92 (s, 3H). MS (ESI): 398.3 [M+H]+.

[1173] 4-{4-[1-(Difluoromethyl)-1H-pyrazol-4-yl]-2-methylbenzenesulfonyl}-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (Broad000415-088, Compound 42)

[1174]

[1175] To a Schlenk tube was added N-methyl bromotetrahydroquinoxaline (45 mg, 0.1138 mmol, 1 equiv) in dioxane:water 4:1 (1 mL), N-difluoromethylpyrazole boronic acid (33.3 mg, 0.1365 mmol, 1.2 equiv), sodium carbonate (36.1 mg, 0.3414 mmol, 3 equiv) and XPhos Pd G2 (4.47 mg, 0.005690 mmol, 0.05 equiv). The reaction mixture was stirred at 80 °C for 1 day. The reaction mixture was partitioned between water and EtOAc. The combined organic layers were dried over MgSO 4 4, filtered and concentrated. The crude product was purified by reverse phase chromatography (ACN / H2O) to afford the desired difluoromethylpyrazole tetrahydroquinoxaline sulfonamide (20 mg, 37.8% yield).

[1176] 1H NMR (400 MHz, chloroform-d) δ 8.11 (s, 1H), 8.02 - 7.93 (m, 2H), 7.42 - 7.31 (m, 2H), 7.10 - 7.00 (m, 1H), 6.62 (d, J = 7.6 Hz, 1H), 6.42 (d, J = 8.1 Hz, 1H), 4.30 (s, 1H), 3.28 (s, 1H), 3.00 (s, 2H), 2.48 (s, 3H), 2.35 (s, 3H), 2.17 (s, 3H). MS (ESI): 433.3 [M+H]+.

[1177] 1,5,6-Trimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_306, Compound 43)

[1178]

[1179] At room temperature, a solution of 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (91.4 mg, 0.4396 mmol) and potassium carbonate (150 mg, 1.09 mmol) in 1,4-dioxane (3 mL) was added to a stirred solution of 4-(4-bromo-2-methylphenylsulfonyl)-1,5,6-trimethyl-1,2,3,4-tetrahydroquinoxaline (150 mg, 0.3664 mmol). The reaction mixture was degassed with argon for 20 min, then bis(cyclopentadienyl)dichloropalladium(II) dichloride (29.9 mg, 0.03664 mmol) was added at room temperature, and the reaction mixture was heated at 100 °C for 6 h. After completion, the reaction mixture was poured into water (30 mL) and extracted with EtOAc (3 × 30 mL). The organic layer was washed with brine solution (2 × 20 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (50:1 CH 2 Cl 2 / MeOH; 12M column) to afford 1,5,6-trimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (90 mg, 57.9% yield) as an off-white solid.

[1180] 1H NMR (400 MHz, chloroform-d) δ 7.91 (d, J = 8.2 Hz, 1H), 7.79 (s, 1H), 7.68 (s, 1H), 7.36 - 7.30 (m, 1H), 7.28 (s, 1H), 6.95 (d, J = 8.2 Hz, 1H), 6.31 (d, J = 8.2 Hz, 1H), 4.36 - 4.26 (m, 1H), 3.96 (s, 3H), 3.26 (ddd, J = 14.5, 10.7, 7.4 Hz, 1H), 2.99 - 2.86 (m, 2H), 2.41 (s, 3H), 2.27 (s, 3H), 2.19 (s, 3H), 2.09 (s, 3H). MS (ESI): 411.2 [M+H]+.

[1181] Synthesis of Compound 45

[1182]

[1183] 1-(4-Bromo-2-methylbenzenesulfonyl)-8-methyl-1,2,3,4-tetrahydroquinoline: Intermediate-55

[1184]

[1185] A solution of 8-methyl-1,2,3,4-tetrahydroquinoline (0.15 g, 1.01 mmol, 1 equiv), 4-bromo-2-methylbenzene-1-sulfonyl chloride (816 mg, 3.03 mmol, 3 equiv), triethylamine (102 mg, 1.01 mmol, 1.0 equiv) and 2-dimethylaminopyridine (12.3 mg, 101 μmol, 0.1 equiv) in pyridine (2 mL) was stirred at 110 °C for 16 h. After completion, the reaction mixture was evaporated and the residue was purified by flash chromatography using [0 - 15% EtOAc / hexanes] to afford 1-(4-bromo-2-methylbenzenesulfonyl)-8-methyl-1,2,3,4-tetrahydroquinoline as a white solid (0.15 g, 39.0% yield).

[1186] MS: [M+H]+ 382.00

[1187] 8-Methyl-1-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)benzenesulfonyl]-1,2,3,4-tetrahydroquinoline: Broad_P_CaV3.3_257 (Compound 45)

[1188]

[1189] A stirred solution of 1-(4-bromo-2-methylbenzenesulfonyl)-8-methyl-1,2,3,4-tetrahydroquinoline (0.15 g, 394 μmol, 1 equiv), 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (98.2 mg, 472 μmol, 1.2 equiv), and potassium carbonate (163 mg, 1.18 mmol, 3 equiv) in 1,4-dioxane (5 mL) and water (1 mL) was degassed with nitrogen for 15 min, then tetrakis(triphenylphosphine)palladium (45.5 mg, 39.4 μmol, 0.1 equiv) was added and the reaction mixture was heated at 90 °C for 16 h. After completion, the reaction mixture was quenched in water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were dried over sodium sulfate, filtered, and concentrated under reduced pressure to give a crude product, which was purified by flash chromatography using [0 - 50% EtOAc / hexanes] to afford an impure product, which was further purified by preparative HPLC using (40 - 50% ACN in water containing 0.1% formic acid as a modifier) as the mobile phase to give 8-methyl-1-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)benzenesulfonyl]-1,2,3,4-tetrahydroquinoline as a white solid (0.053 g, 35.3% yield).

[1190] MS: [M+H]+ 382.40.

[1191] 1 H NMR (400 MHz, DMSO-d6) δ 8.30 (s, 1H), 8.00 (s, 1H), 7.81 (d, J = 8.7 Hz, 1H), 7.59 (d, J = 7.0 Hz, 2H), 7.14 (s, 2H), 6.97 - 6.91 (m, 1H), 4.01 (s, 1H), 3.29 (s, 1H), 3.87 (s, 4H), 2.30 (s, 3H), 2.04 (s, 3H), 1.91 (s, 1H), 1.63 (s, 1H), 1.50 (s, 1H).

[1192] 5'-fluoro-7'-methyl-1'-[[4-methyl-6-(4-methylimidazol-1-yl)-3-pyridinyl]sulfonyl]spiro[cyclopropane-1,3'-indoline] (Broad_P_CaV3.3_684, Compound 47)

[1193]

[1194] At room temperature, 4-methylimidazole (0.28 g, 3.40 mmol, 4.00 equiv), potassium tert-butoxide (0.29 g, 2.55 mmol, 3.00 equiv) and copper(I) oxide (0.037 g, 0.255 mmol, 0.300 equiv) were added to a solution of 1'-[(6-bromo-4-methyl-3-pyridyl)sulfonyl]-5'-fluoro-7'-methyl-spiro[cyclopropane-1,3'-indoline] (0.35 g, 0.851 mmol, 1.00 equiv) in dimethyl sulfoxide (3.5 mL), and the reaction mixture was stirred at 140 °C for 1 h. The reaction mixture was quenched in water (250 mL) and extracted with EtOAc (3 × 50 mL). The combined organic layers were dried over anhydrous Na 2 SO 4 and evaporated to give the crude product, which was purified by column chromatography using a 2% methanol in DCM solution as the mobile phase to afford the compound, and finally purified by reverse-phase preparative HPLC using a solution of 10 - 100% acetonitrile in water (0.1% formic acid as the modifier) to yield Broad_P_CaV3.3_684 as a pale orange solid (45 mg, 0.106 mmol, 12% yield).

[1195] 1H NMR (400 MHz, DMSO-d6) δ 8.84 (s, 1H), 8.50 (s, 1H), 7.79 (s, 1H), 7.71 (s, 1H), 6.99 (dd, J = 10.1, 2.7 Hz, 1H), 6.55 (dd, J = 8.3, 2.7 Hz, 1H), 4.00 (s, 2H), 2.48 (s, 3H), 2.19 (s, 3H), 1.97 (s, 3H), 0.52 (s, 4H). MS (ESI): 411 [M-H]-.

[1196] 1'-[(6-bromo-4-methyl-3-pyridyl)sulfonyl]-5'-fluoro-7'-methyl-spiro[cyclopropane-1,3'-indoline]

[1197]

[1198] At room temperature, 6-bromo-4-methylpyridine-3-sulfonyl chloride (0.55 g, 2.03 mmol, 2.00 equiv) and pyridine (0.33 mL, 4.06 mmol, 4.00 equiv) were added to a solution of 5'-fluoro-7'-methyl-spiro[cyclopropane-1,3'-indoline] (0.18 g, 1.02 mmol, 1.00 equiv) in dichloromethane (1.8 mL), and the reaction mixture was stirred at the same temperature for 1 h. The reaction mixture was quenched in water (100 mL) and extracted with EtOAc (3 × 50 mL). The combined organic layers were dried over anhydrous Na 2SO 4 Dried and evaporated to afford 1'-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-5'-fluoro-7'-methyl-spiro[cyclopropane-1,3'-indoline] (0.35 g, 0.851 mmol). Broad_P_Cav3.3_684. MS (ESI): 413.0 [M+H]+

[1199] 5'-fluoro-7'-methyl-spiro[cyclopropane-1,3'-indoline]

[1200]

[1201] To a solution of 5'-fluoro-7'-methyl-spiro[cyclopropane-1,3'-indolin]-2'-one (0.55 g, 2.88 mmol, 1.00 equiv) in tetrahydrofuran (11 mL) at room temperature was added dropwise lithium aluminum hydride (1 M solution in THF) (14.39 mL, 14.4 mmol, 5.00 equiv) and the reaction mixture was stirred at the same temperature for 12 h. The reaction was quenched in water (100 mL) and extracted with EtOAc (3×100 mL). The combined organic layers were dried over anhydrous Na 2 SO 4 Dried and evaporated to afford 5'-fluoro-7'-methyl-spiro[cyclopropane-1,3'-indoline] (0.20 g, 0.858 mmol, 30% yield).

[1202] 1H NMR (400 MHz, DMSO-d6) δ 6.55 (dd, J = 10.3, 2.6 Hz, 1H), 6.30 (dd, J = 8.7, 2.6 Hz, 1H), 5.20 (s, 1H), 3.45 (d, J = 2.7 Hz, 2H), 2.04 (s, 3H), 0.90 (s, 4H). MS (ESI): 178.0 [M+H]+.

[1203] 5'-fluoro-7'-methyl-spiro[cyclopropane-1,3'-indolin]-2'-one

[1204]

[1205] Sodium hydride (60% in oil) (4019 mg, 167 mmol, 6.00 eq) was added portionwise to a solution of trimethylsulfoxonium iodide (30710 mg, 140 mmol, 5.00 eq) in DMSO (40 mL). The reaction mixture was stirred at room temperature for 5 min. 5-Fluoro-7-methyl-indoline-2,3-dione (5.00 g, 27.9 mmol, 1.00 eq) was added by dissolving in DMSO (20 mL) and the mixture was stirred at room temperature for 4 h. The reaction was quenched in saturated ammonium bromide solution (200 mL) and extracted with EtOAc (3 × 200 mL). The combined organic layers were dried over anhydrous Na 2 SO 4 and evaporated to give 5'-fluoro-7'-methyl-spiro[cyclopropane-1,3'-indoline]-2'-one (0.55 g, 2.79 mmol, 10% yield). MS (ESI): 192.0 [M+H]+.

[1206] 5-Fluoro-7-methyl-indoline-2,3-dione

[1207]

[1208] (2E)-N-(4-Fluoro-2-methyl-phenyl)-2-oximino-acetamide (9.50 g, 48.4 mmol, 1.00 eq) in H 2 SO 4 (76 mL) was stirred at 50 °C for 3 h. The reaction was quenched in water (500 mL) and extracted with EtOAc (3 × 300 mL). The combined organic layers were dried over anhydrous Na 2 SO 4 and evaporated to give 5-fluoro-7-methyl-indoline-2,3-dione (6.30 g, 34.8 mmol, 72% yield). MS (ESI): 180.0 [M+H]+.

[1209] (2E)-N-(4-Fluoro-2-methyl-phenyl)-2-oximino-acetamide

[1210]

[1211] A solution of chloral hydrate (14.54 g, 87.9 mmol, 1.10 eq) and sodium sulfate (11.35 g, 79.9 mmol, 1.00 eq) in water (120 mL) was stirred at 50 °C for 15 min. A solution of 4-fluoro-2-methyl-aniline (10.00 g, 79.9 mmol, 1.00 eq) in water (60 mL), 1,4-dioxane (60 mL), and concentrated HCl (8.5 mL) were added to the reaction mixture, and the mixture was stirred at 70 °C for 15 min. A solution of hydroxylamine hydrochloride (11.11 g, 160 mmol, 2.00 eq) in water (60 mL) was added to the reaction mixture. The reaction was quenched in water (500 mL) and extracted with EtOAc (3 × 300 mL). The combined organic layers were dried over anhydrous Na 2 SO 4 and evaporated to give (2E)-N-(4-fluoro-2-methyl-phenyl)-2-oximino-acetamide as a yellow solid. MS (ESI): 197.1 [M+H]+.

[1212] 1-Ethyl-6-fluoro-4-methyl-3-[[4-methyl-6-(4-methylimidazol-1-yl)-3-pyridinyl]sulfonyl]indole (Broad_P_CaV3.3_683, Compound 48)

[1213]

[1214] To a solution of 3-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-1-ethyl-6-fluoro-4-methyl-indole (0.41 g, 0.997 mmol, 1.00 eq) in dimethylformamide (4 mL) was added potassium tert-butoxide (0.34 g, 2.99 mmol, 3.00 eq) and the mixture was purged with argon for 15 min. 99% Copper(I) oxide (based on metal) (0.043 g, 0.299 mmol, 0.300 eq) was added and the mixture was stirred at 140 °C for 6 h. After 6 h, the reaction mixture was diluted with water (15 mL) and extracted with EtOAc (3 × 20 mL). The organic layer was dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combi flash using DCM:MeOH (9:1) as the mobile phase to give an impure product, which was further purified by reverse-phase preparative HPLC using 40 - 100% ACN in water containing 0.1% formic acid as the mobile phase. A white solid of Broad-P_CaV3.3_683 was obtained (0.058 g, 0.141 mmol, 14% yield).

[1215] 1H NMR (400 MHz, DMSO-d6) δ 8.82 (s, 1H), 8.50 (s, 1H), 8.40 (s, 1H), 7.88 (s, 1H), 7.71 (s, 1H), 7.49 (d, J = 9.7 Hz, 1H), 6.91 (d, J = 10.5 Hz, 1H), 4.33 (q, J = 7.1 Hz, 2H), 2.52 (s, 3H), 2.47 (s, 3H), 2.18 (s, 3H), 1.40 (t, J = 7.1 Hz, 3H). MS (ESI): 413.0 [M+H]+.

[1216] 3-[(6-Bromo-4-methylpyridin-3-yl)sulfonyl]-1-ethyl-6-fluoro-4-methylindole

[1217]

[1218] To a suspension of 3-[(6-bromo-4-methylpyridin-3-yl)thio]-1-ethyl-6-fluoro-4-methylindole (0.67 g, 1.77 mmol, 1.00 equiv) in dichloromethane (6.7 mL) was added m-chloroperbenzoic acid (0.91 g, 5.30 mmol, 3.00 equiv), and the mixture was stirred at 25 °C for 12 h. After completion, the reaction mixture was quenched with saturated NaHCO 3 solution (50 mL) and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by silica gel column chromatography using a 20% ethyl acetate in hexanes solution as the mobile phase to afford Broad_P_CaV3.3_683 as a yellow solid (0.41 g, 0.701 mmol, 40% yield). MS (ESI): 413.1 [M+H]+.

[1219] 3-[(6-Bromo-4-methylpyridin-3-yl)thio]-1-ethyl-6-fluoro-4-methylindole

[1220]

[1221] To a stirred solution of 1-ethyl-6-fluoro-4-methylindole (0.61 g, 3.44 mmol, 1.00 equiv) and 6-bromo-4-methylpyridine-3-sulfonyl chloride (1.86 g, 6.88 mmol, 2.00 equiv) in DMF (10 mL) was added tetra-n-butylammonium iodide (2.54 g, 6.88 mmol, 2.00 equiv). The reaction mixture was stirred at the same temperature for 4 h. After completion, the reaction mixture was quenched with saturated Na 2 S2 O 3 The solution (50 mL) was quenched and extracted with ethyl acetate (3 × 50 mL). The combined organic layers were washed with brine solution (2 × 50 mL) and dried over Na 2 SO 4 and evaporated. The residue was purified by silica gel column chromatography using a 15% solution of ethyl acetate in hexanes as the mobile phase to afford Broad_P_Cav3.3_683_1476 as a pale yellow solid (0.67 g, 1.77 mmol, 51% yield). MS (ESI): 381.2 [M+H]+.

[1222] 1-Ethyl-6-fluoro-4-methyl-indole

[1223]

[1224] To a solution of 4-bromo-1-ethyl-6-fluoro-indole (0.90 g, 3.72 mmol, 1.00 equiv) in 1,4-dioxane (9 mL) was added potassium carbonate (1539 mg, 11.2 mmol, 3.00 equiv) dissolved in water (2 mL) and methylboronic acid (267 mg, 4.46 mmol, 1.20 equiv). The reaction mixture was purged with nitrogen and then 1,1'-bis(diphenylphosphino)ferrocene-palladium(II) dichloride dichloromethane (304 mg, 0.372 mmol, 0.100 equiv) was added and the mixture was stirred at 110 °C for 2 h. After completion, the reaction mixture was diluted with ethyl acetate (10 mL) and washed with brine solution (3 × 40 mL). The organic layer was dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combiflash using (1:20, ethyl acetate:hexanes) as the mobile phase to afford Broad_P_CaV3.3_683 as a light brown liquid (0.61 g, 2.99 mmol, 81% yield). MS (ESI): 178.1 [M+H]+.

[1225] 4-Bromo-1-ethyl-6-fluoro-indole

[1226]

[1227] At 0 °C, sodium hydride (60% in mineral oil) (0.17 g, 7.01 mmol, 1.50 equiv) was added portionwise to a solution of 4-bromo-6-fluoro-1H-indole (1.00 g, 4.67 mmol, 1.00 equiv) in DMF and then it was stirred for 15 min. Subsequently, ethyl iodide (1.46 g, 9.34 mmol, 2.00 equiv) was added at the same temperature. The reaction mixture was stirred at 25 °C for 2 h. After completion, the reaction mixture was diluted with ethyl acetate (10 mL) and washed with brine solution (3 × 70 mL). The organic layer was dried over Na 2 SO 4 and evaporated under vacuum to give Broad_P_CaV3.3_683 (0.90 g, 3.72 mmol, 80% yield) as the major product. MS (ESI): 244.0 [M+H]+.

[1228] 1,5-Dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxalin-2-one (Broad_P_Cav3.3_326, Compound 49)

[1229]

[1230] At room temperature, a solution of iodomethane (455 mg, 3.21 mmol) and potassium carbonate (887 mg, 6.42 mmol) in DMF (8 mL) was added to a stirred solution of 5-methyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxalin-2-one (0.85 g, 2.14 mmol). The reaction mixture was heated at 50 °C and stirred at the same temperature for 5 h. After completion, the reaction mixture was poured into ice water (50 mL) and extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine solution (2 × 30 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (50:1 CH 2 Cl 2 / MeOH; 12M column) to afford 1,5-dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxalin-2-one (0.7 g, 79.6% yield) as an off-white solid.

[1231] 1H NMR (400 MHz, chloroform-d) δ 7.77 (s, 1H), 7.67 (t, J = 4.1 Hz, 2H), 7.33 (dd, J = 8.2, 1.9 Hz, 1H), 7.26 - 7.21 (m, 2H), 7.09 (d, J = 7.6 Hz, 1H), 6.66 (d, J = 8.0 Hz, 1H), 4.75 (d, J = 17.8 Hz, 1H), 3.96 (s, 3H), 3.89 (d, J = 17.7 Hz, 1H), 2.61 (s, 3H), 2.58 (s, 3H), 2.04 (s, 3H). MS (ESI): 411.4 [M+H]+.

[1232] 4-[2,6-Dimethyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_305, Compound 50)

[1233]

[1234] At room temperature, to a stirred solution of 4-(4-bromo-2,6-dimethylphenylsulfonyl)-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (0.85 g, 2.07 mmol) was added a solution of 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (516 mg, 2.48 mmol) and potassium carbonate (856 mg, 6.20 mmol) in 1,4-dioxane (6 mL). The reaction mixture was degassed with argon for 20 min, then bis(cyclopentadienyl-1,3-diene-1-yl diphenylphosphine)palladium(II) dichloride (169 mg, 0.207 mmol) was added at room temperature, and the reaction mixture was heated at 100 °C for 6 h. After completion, the reaction mixture was poured into water (40 mL) and extracted with EtOAc (3 × 30 mL). The organic layer was washed with brine solution (2 × 10 mL) and dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (50:1 CH 2 Cl 2 / MeOH; 12S column) to afford 4-[2,6-dimethyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (0.55 g, 64.7% yield) as an off-white solid.

[1235] 1H NMR (400 MHz, chloroform-d) δ 7.80 (s, 1H), 7.68 (s, 1H), 7.19 (s, 2H), 7.02 (t, J = 7.9 Hz, 1H), 6.47 (dd, J = 7.9, 2.8 Hz, 2H), 4.33 (d, J = 8.4 Hz, 1H), 3.96 (s, 3H), 3.37 - 3.20 (m, 2H), 3.13 (s, 1H), 2.73 (s, 3H), 2.43 (s, 6H), 1.92 (s, 3H). MS (ESI): 411.4 [M+H]+.

[1236] 4-[4-(1-Cyclopropyl-1H-pyrazol-4-yl)-2-methylbenzenesulfonyl]-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (Broad000415-041, Compound 51)

[1237]

[1238] To a Schlenk flask, add N-methyl bromosulfonamide (75 mg, 0.1897 mmol, 1 equiv), cyclopropylpyrazole pinacol borate (53.2 mg, 0.2276 mmol, 1.2 equiv), sodium carbonate (60.3 mg, 0.5691 mmol, 3 equiv) and XPhos Pd G2 (7.46 mg, 0.009485 mmol, 0.05 equiv) in dioxane / water 4:1 (1.5 mL). Stir the reaction mixture at 80 °C for 2 h. After cooling to room temperature, partition the reaction mixture between water and EtOAc. Dry the organic layer over MgSO 4 dry, filter and concentrate. Purify the crude product by flash chromatography on silica gel (hexanes / EtOAc) to afford the desired N-methylsulfonamide cyclopropylpyrazole (61 mg, 100% purity, 76% yield). A second purification was performed on reverse phase chromatography, eluting with (water / ACN containing 0.1% formic acid) to remove the pinacol and afford N-methylsulfonamide cyclopropylpyrazole (13.6 mg, 16.9% yield).

[1239] 1H NMR (400 MHz, chloroform-d) δ 7.92 (d, J = 8.3 Hz, 1H), 7.77 (d, J = 5.4 Hz, 2H), 7.33 (dd, J = 8.3, 1.7 Hz, 1H), 7.27 (s, 1H), 7.05 (t, J = 7.9 Hz, 1H), 6.61 (d, J = 7.5 Hz, 1H), 6.41 (d, J = 8.1 Hz, 1H), 4.28 (s 1H), 3.64 (m, 1H), 3.27 (s, 1H), 2.99 (s, 2H), 2.49 (s, 3H), 2.34 (s, 3H), 2.15 (s, 3H), 1.18 (s, 2H), 1.07 (s, 2H). MS (ESI): 424.8 [M+H]+.

[1240] 7-Fluoro-1,5-dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_300, Compound 52)

[1241]

[1242] At room temperature, a solution of 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (0.0903 g, 433 μmol, 1.196 equiv) and potassium carbonate (0.149 g, 1.07 mmol, 2.956 equiv) in 1,4-dioxane (4 mL) and water (1 mL) was added to a stirred solution of 4-(4-bromo-2-methylphenylsulfonyl)-7-fluoro-1,5-dimethyl-1 (0.15 g, 362 μmol, 1 equiv), and the reaction mixture was degassed with argon for 20 min. Subsequently, bis(cyclopent-1,3-diene-1-yl diphenylphosphine) dichloromethane (0.0592 g, 72.3 μmol, 0.2 equiv) was added at room temperature, and the reaction mixture was heated at 100 °C for 16 h. After completion, the reaction mixture was poured into water (25 mL) and extracted with EtOAc (3 × 25 mL). The organic layer was washed with brine solution (2 × 10 mL), dried over Na 2 SO 4 and evaporated. The product was loaded onto a preparative HPLC column and eluted with a 15 - 55% ACN gradient in 0.1% aqueous formic acid to afford 7-fluoro-1,5-dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (0.03125 g, 20.7% yield).

[1243] 1H NMR (400 MHz, DMSO-d6) δ 8.29 (s, 1H), 7.99 (s, 1H), 7.81 (d, J = 8.3 Hz, 1H), 7.56 (d, J = 7.6 Hz, 2H), 6.37 - 6.25 (m, 2H), 4.09 (dd, J = 14.5, 6.5 Hz, 1H), 3.87 (s, 3H), 3.21 (d, J = 13.6 Hz, 1H), 2.98 (dd, J = 11.6, 5.5 Hz, 1H), 2.78 (d, J = 6.8 Hz, 1H), 2.44 (s, 3H), 2.23 (s, 3H), 2.09 (s, 3H).

[1244] 6-Chloro-1,5-dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_307, Compound 53)

[1245]

[1246] At room temperature, a solution of 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (26.1 mg, 0.1256 mmol) and potassium carbonate (43.4 mg, 0.3141 mmol) in 1,4-dioxane (2 mL) was added to a stirred solution of 4-(4-bromo-2-methylphenylsulfonyl)-6-chloro-1,5-dimethyl-1,2,3,4-tetrahydroquinoxaline (45 mg, 0.1047 mmol). The reaction mixture was degassed with argon for 20 min, then bis(cyclopentadienyl-1,3-diene-1-yl diphenylphosphine)palladium(II) dichloride (8.55 mg, 0.01047 mmol) was added at room temperature, and the reaction mixture was heated at 100 °C for 6 h. After completion, the reaction mixture was poured into water (20 mL) and extracted with EtOAc (3 × 10 mL). The organic layer was washed with brine solution (2 × 10 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (1:1 Hex / EtOAc; 12S column) to afford 6-chloro-1,5-dimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (30 mg, 63.8% yield) as an off-white solid.

[1247] 1H NMR (400 MHz, DMSO-d6) δ 8.30 (s, 1H), 7.99 (s, 1H), 7.80 (d, J = 8.5 Hz, 1H), 7.57 (d, J = 7.1 Hz, 2H), 7.17 (d, J = 8.9 Hz, 1H), 6.52 (d, J = 8.9 Hz, 1H), 4.10 (dd, J = 14.9, 6.7 Hz, 1H), 3.87 (s, 3H), 3.23 (dd, J = 14.7, 5.8 Hz, 1H), 2.98 (dd, J = 11.7, 5.5 Hz, 1H), 2.74 - 2.66 (m, 1H), 2.46 (s, 3H), 2.25 (s, 3H), 2.05 (s, 3H). MS (ESI): 431.4 [M+H]+.

[1248] 1,5-Dimethyl-4-[2-methyl-4-(3-methyl-1,2-oxazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_CaV3.3_253, Compound 54)

[1249]

[1250] At room temperature, a solution of triethylamine (76.5 mg, 756 μmol, 2 equiv) and iodomethane (64.2 mg, 453 μmol, 1.2 equiv) in dichloromethane (10 mL) was added to a stirred solution of 8-methyl-1-[2-methyl-4-(3-methyl-1,2-oxazol-5-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (0.145 g, 378 μmol, 1 equiv), and the reaction mixture was stirred at room temperature for 3 h. After completion, the reaction mixture was poured into water (50 mL) and extracted with EtOAc (3 × 50 mL). The organic layer was washed with brine solution (2 × 10 mL) and dried over Na 2 SO 4 and evaporated. The crude product was purified by flash chromatography using [0 - 30% EtOAc / hexane] to give an impure product, which was further purified by preparative HPLC using (55 - 75% ACN in water containing 0.1% formic acid as a modifier) as the mobile phase to give 1,5-dimethyl-4-[2-methyl-4-(3-methyl-1,2-oxazol-5-yl)phenyl as a white solid (0.0405 g, 27.0% yield).

[1251] 1H NMR (400 MHz, DMSO-d6) δ 8.02 (d, J = 8.2 Hz, 1H), 7.85 - 7.77 (m, 2H), 7.05 (s, 1H), 7.02 (t, J = 7.9 Hz, 1H), 6.54 (d, J = 7.4 Hz, 1H), 6.45 (d, J = 8.2 Hz, 1H), 4.17 (dd, J = 14.7, 6.9 Hz, 1H), 3.25 (s, 1H), 2.80 (t, J = 10.4 Hz, 1H), 2.36 (s, 3H), 2.28 (d, J = 12.5 Hz, 6H), 2.06 (s, 3H).

[1252] 1-[2-Ethyl-5-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-8-methyl-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_224, Compound 56)

[1253]

[1254] At room temperature, to a stirred solution of N-(2-amino-6-methylphenyl)-2-ethyl-5-(1-methyl-1H-pyrazol-4-yl)benzene-1-sulfonamide (35 mg, 0.09447 mmol), dibromoethane (21.2 mg, 0.1133 mmol) and potassium carbonate (39.1 mg, 0.2834 mmol) in DMF (2 mL). The reaction mixture was heated at 100 °C and stirred at the same temperature for 12 h. After completion, the reaction mixture was poured into ice water (10 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were washed with brine solution (2 × 10 mL) and dried over Na 2 SO 4 and evaporated. The product was loaded onto a preparative HPLC column and eluted with a 45 - 65% ACN gradient in 0.1% aqueous formic acid to afford 1-[2-ethyl-5-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-8-methyl-1,2,3,4-tetrahydroquinoxaline as a white solid (12 mg, 32.0% yield).

[1255] 1H NMR (400 MHz, DMSO-d6) δ 8.22 (s, 1H), 7.96 (d, J = 2.0 Hz, 1H), 7.85 (s, 1H), 7.77 (dd, J = 8.0, 2.0 Hz, 1H), 7.40 (d, J = 8.0 Hz, 1H), 6.86 (t, J = 7.7 Hz, 1H), 6.37 (t, J = 8.1 Hz, 2H), 5.93 (s, 1H), 3.97 (s, 1H), 3.86 (s, 3H), 3.10 (s, 2H), 2.71 (s, 1H), 2.54 (s, 2H), 2.21 (s, 3H), 1.04 (t, J = 7.4 Hz, 3H). MS (ESI): 397.2 [M+H]+.

[1256] 1,4-Dimethyl-3-[[4-methyl-6-(4-methyl-1H-imidazol-1-yl)-3-pyridinyl]sulfonyl]indole (Broad_P_CaV3.3_639, Compound 57)

[1257]

[1258] A stirred suspension of 3-[(6-bromo-4-methyl-3-pyridinyl)sulfonyl]-1,4-dimethyl-indole (3.60 g, 9.49 mmol, 1.00 equiv), 4-methyl-1H-imidazole (1.56 g, 19.0 mmol, 2.00 equiv) and potassium tert-butoxide (3.20 g, 28.5 mmol, 3.00 equiv) in dimethylformamide (36 mL) was degassed with nitrogen for 15 min. Copper(I) oxide (0.41 g, 2.85 mmol, 0.300 equiv) was added and it was heated at 140 °C for 2 h. After completion, the reaction mixture was diluted with ethyl acetate (40 mL) and washed with brine solution (3 × 20 mL). The organic layer was dried over Na 2 SO 4 and evaporated in vacuo. The residue was purified by combi flash using DCM:methanol (20:1) as the mobile phase to afford a mixture of isomers which was further purified by preparative HPLC using ACN:water (10 - 100%) containing 0.1% aqueous formic acid as the modifier to yield Broad_P_CaV3.3_639 as a white solid (1.11 g, 2.86 mmol, 30% yield).

[1259] 1H NMR (400 MHz, DMSO-d6) δ 8.80 (s, 1H), 8.48 (s, 1H), 8.35 (s, 1H), 7.86 (s, 1H), 7.69 (s, 1H), 7.45 (d, J = 8.3 Hz, 1H), 7.23 (t, J = 7.8 Hz, 1H), 6.98 (d, J = 7.3 Hz, 1H), 3.91 (s, 3H), 2.54 (s, 3H), 2.45 (s, 3H), 2.16 (s, 3H). MS (ESI): 381.0 [M+H]+.

[1260] 3-[(6-Bromo-4-methyl-3-pyridinyl)sulfonyl]-1,4-dimethyl-indole

[1261]

[1262] At 25 °C, ozone (7.08 g, 23.0 mmol, 4.00 equiv) was added to a stirred solution of 3-[(6-bromo-4-methyl-3-pyridinyl)thio]-1,4-dimethyl-indole (2.00 g, 5.76 mmol, 1.00 equiv) in tetrahydrofuran (11.079 mL) and water (11.079 mL). The reaction mixture was stirred at 25 °C for 16 h. After completion, the reaction mixture was dissolved in water (30 mL) and extracted with ethyl acetate (3 × 30 mL). The combined organic layers were dried over Na 2 SO 4 and evaporated in vacuo to afford a crude product, which was purified by flash chromatography using ethyl acetate:hexanes (2:8) as the eluent to afford Broad_P_CaV3.3_639_1335 as a yellow solid (1.30 g, 3.43 mmol, 60% yield). MS (ESI): 381.1 [M+H]+.

[1263] 3-[(6-Bromo-4-methyl-3-pyridinyl)thio]-1,4-dimethyl-indole

[1264]

[1265] At 25 °C, tetrabutylammonium iodide (15260 mg, 41.3 mmol, 2.00 equiv) was added to a stirred solution of 1,4-dimethyl-indole (3.00 g, 20.7 mmol, 1.00 equiv) and 6-bromo-4-methyl-pyridine-3-sulfonyl chloride (11.18 g, 41.3 mmol, 2.00 equiv) in dimethylformamide (39 mL). The reaction mixture was stirred at the same temperature for 3 h. After completion, the reaction was quenched with saturated Na 2 S 2 O 3The solution (50 mL) was quenched and extracted with ethyl acetate (3 × 100 mL). The combined organic layers were washed with brine solution (2 × 150 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by silica gel column chromatography using a 10% solution of ethyl acetate in hexanes as the mobile phase to afford Broad_P_CaV3.3_639_Int-1334 as a pale yellow solid (3.00 g, 8.64 mmol, 42% yield). MS (ESI): 349.2 [M+H]+.

[1266] 1,5-Dimethyl-4-[2-methyl-4-(2-methyl-2H-1,2,3-triazol-4-yl)benzenesulfonyl]-1,2,3,4-tetrahydroquinoxaline (Broad_P_Cav3.3_289, Compound 58)

[1267]

[1268] To a stirred solution of 1,5-dimethyl-4-[2-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzenesulfonyl]-1,2,3,4-tetrahydroquinoxaline (0.1 g, 226 μmol, 1 equiv) at room temperature was added a solution of 4-bromo-2-methyl-2H-1,2,3-triazole (54.9 mg, 339 μmol, 1.5 equiv), potassium carbonate (93.7 mg, 678 μmol, 3.0 equiv) in 1,4-dioxane (3 mL) and water (0.5 mL), and the reaction mixture was degassed with argon for 20 min, then bis(cyclopentadienyl)dichloropalladium(II) dichloride (18.4 mg, 22.6 μmol, 0.1 equiv) was added at room temperature and the reaction mixture was heated at 80 °C for 16 h. After completion, the reaction mixture was poured into water (25 mL) and extracted with EtOAc (3 × 25 mL). The organic layer was washed with brine solution (2 × 30 mL), dried over Na 2 SO 4 and evaporated. The residue was purified by Biotage (8:2 Hex / EtOAc; 12S column) to afford 1,5-dimethyl-4-[2-methyl-4-(2-methyl-2H-1,2,3-triazol-4-yl)benzenesulfonyl]-1,2,3,4-tetrahydroquinoxaline as a light brown solid (4.9 mg, 5.45% yield).

[1269] 1H NMR (400 MHz, DMSO-d6) δ 8.36 (s, 1H), 7.97 (d, J = 8.3 Hz, 1H), 7.84 - 7.78 (m, 2H), 7.01 (t, J = 7.8 Hz, 1H), 6.53 (d, J = 7.4 Hz, 1H), 6.45 (d, J = 8.2 Hz, 1H), 4.22 (s, 3H), 4.15 (d, J = 10.2 Hz, 1H), 2.96 (s, 1H), 2.39 (s, 3H), 2.27 (s, 3H), 2.06 (s, 3H).

[1270] (2S)-1,2,5-Trimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Compound 59) and (2R)-1,2,5-Trimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline (Compound 120) (Broad_P_Cav3.3_330 and 331)

[1271]

[1272] To a stirred solution of 4-(4-bromo-2-methylphenylsulfonyl)-1,2,5-trimethyl-1,2,3,4-tetrahydroquinoxaline (100 mg, 0.2442 mmol) and 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (50.8 mg, 0.2442 mmol) in 1,4-dioxane (2 mL) and water (1 mL) was added sodium carbonate (77.6 mg, 0.7326 mmol) and the mixture was degassed with nitrogen for 5 min. Pd(dppf)Cl2·DCM (9.97 mg, 0.01221 mmol) was added and it was heated at 100 °C for 3 h. After completion, the reaction mixture was filtered through Celite and washed with ethyl acetate (10 mL). The resulting filtrate was passed through Na 2 SO 4Dry and evaporate. Purify the residue by Biotage (1:1 Hex / EtOAc; 12M column) to give the crude product, which is further purified by chiral preparative HPLC using a solution of CO2 and 0.1% diethylamine in IPA:hexane (70:30) as the mobile phase to give (2S)-1,2,5-trimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline as a brown semi-solid (10 mg, 9.70%) and (2R)-1,2,5-trimethyl-4-[2-methyl-4-(1-methyl-1H-pyrazol-4-yl)phenylsulfonyl]-1,2,3,4-tetrahydroquinoxaline as an off-white solid (35 mg, 34.9%).

[1273] Broad_P_CaV3.3_330

[1274] 1H NMR (400 MHz, DMSO-d6) δ 8.28 (s, 1H), 7.98 (s, 1H), 7.84 (d, J = 8.2 Hz, 1H), 7.61 - 7.46 (m, 2H), 7.00 (t, J = 7.8 Hz, 1H), 6.53 (d, J = 7.5 Hz, 1H), 6.38 (d, J = 8.1 Hz, 1H), 4.34 - 4.17 (m, 1H), 3.86 (s, 3H), 3.04 - 2.87 (m, 2H), 2.25 (d, J = 14.5 Hz, 6H), 1.95 (s, 3H), 0.84 (d, J = 4.8 Hz, 3H). MS (ESI): 411.2 [M+H]+.

[1275] Broad_P_CaV3.3_331

[1276] 1H NMR (400 MHz, DMSO-d6) δ 8.28 (s, 1H), 7.98 (s, 1H), 7.84 (d, J = 8.2 Hz, 1H), 7.54 (dd, J = 10.9, 2.9 Hz, 2H), 7.00 (t, J = 7.8 Hz, 1H), 6.53 (d, J = 7.5 Hz, 1H), 6.38 (d, J ...

Claims

1. A compound having the structure of formula (I) or a pharmaceutically acceptable salt thereof: wherein the dashed circle represents an optionally unsaturated ring; p is 0 or 1; m is 0, 1, 2, 3 or 4; n is 0, 1, 2, 3 or 4; X A1 is N, O, or C; X A2 is N or C; X A3 is N or CR A3 ; R A1 is independently at each occurrence absent, hydrogen, alkyl, -C(O)OR, -C(O)R, haloalkyl, hydroxy or amino; and two Rs A1 may together form =O or a 3- to 6-membered spiro ring; R A2 is independently hydrogen, alkyl each time it appears; where any two geminal R A2 groups may together form =O or a 3- to 6-membered spiro ring; R A3 is independently, at each occurrence, hydrogen, alkyl, alkoxy, cyano, -C(O)OR, -C(O)R or halogen; R L is -S(=O) 2 -, -S(=O)-, -S(=NR)(=O)- or -C(R)(R)-; X B1 is N, S or CR B1 , and one X B1 may not exist; X B2 is independently N or CR at each occurrence B2 ; R B1 independently selected from hydrogen, optionally unsaturated alkyl, halogen, and -R each time it appears C ; R B2 independently selected from hydrogen, optionally unsaturated alkyl, halogen, and -R each time it appears C ; and R B1 or R B2 at least one of which is a group -R having the following structure C : wherein indicates the point of attachment to the compound, and the dashed circle indicates an optional aromaticity; X C6 is C, CH, CR or N; X C1 , X C2 , X C3 , X C4 and X C5 is independently CH, CR, N, NH, NR, O or S; and when the group is a 5-membered ring, X C5 is absent; and R C1 、R C2 、R C3 、R C4 and R C5 are independently hydrogen, alkyl, -C(O)R, -C(O)NRR, halogen, haloalkyl or cycloalkyl; or may together with the R group form oxo (=O); and R is independently hydrogen or alkyl each time it appears.

2. The compound according to claim 1, wherein R C has the structure: wherein R C1 is hydrogen, alkyl, halogen, haloalkyl or cycloalkyl.

3. The compound according to claim 1 or 2, wherein R C has the structure: wherein R C1 is hydrogen, alkyl, halogen, haloalkyl, cycloalkyl.

4. The compound according to any one of claims 1-3, wherein R C1 is hydrogen or a lower alkyl, cycloalkyl or haloalkyl.

5. The compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 - 4, wherein the compound has the structure of formula (II):

6. The compound according to claim 5, wherein the compound has the structure of formula (IIa):

7. The compound according to claim 5 or 6, wherein the compound has the structure of formula (IIb), (IIc), (IId) or (IIe):

8. The compound according to any one of claims 1 - 7, wherein the compound is: or its enantiomer or diastereomer, a mixture of enantiomers or diastereomers, or its racemic mixture.

9. The compound according to any one of claims 1 - 7, wherein the compound is: or its enantiomer or diastereomer, a mixture of enantiomers or diastereomers, or its racemic mixture.

10. The compound according to any one of claims 1 - 7, wherein the compound is: or its enantiomer or diastereomer, a mixture of enantiomers or diastereomers, or its racemic mixture.

11. The compound according to claim 6, wherein the compound has the structure of formula (IIf) or (IIg):

12. The compound according to any one of claims 1 - 6 and 11, wherein the compound is:

13. The compound according to claim 11, wherein the compound is compound 25 having the following structure:

14. The compound according to claim 5, wherein the compound has the structure of formula (IIh):

15. The compound according to claim 14, wherein the compound has the structure of formula (IIi) or (IIj): or its enantiomer or diastereomer, a mixture of enantiomers or diastereomers, or its racemic mixture.

16. The compound according to any one of claims 1 - 5 and 14 - 15, wherein the compound is: or its enantiomer or diastereomer, a mixture of enantiomers or diastereomers, or its racemic mixture.

17. The compound according to any one of claims 1 - 5 and 14 - 15, wherein the compound is compound 7:

18. The compound according to any one of claims 1 - 4, wherein the compound has the structure of formula (III):

19. The compound according to claim 18, wherein the compound has the structure of formula (IIIa):

20. The compound according to claim 18 or 19, wherein the compound has the structure of formula (IIIb), (IIIc), (IIId) or (IIIe):

21. The compound according to any one of claims 1 - 4 and 19 - 20, wherein the compound is: or its enantiomers or diastereomers, a mixture of enantiomers or diastereomers, or a racemic mixture thereof.

22. The compound according to any one of claims 1-4 and 19-20, wherein the compound is:

23. The compound according to claim 1, which has the structure of formula (IV): wherein each dashed circle independently indicates optional unsaturation; X is N, C or CR 3 ; Y is = N-, -N=, -N(R 9 )-, -(C(R 7 )(R 8 )) p -, =C(R 7 )-, -C(R 7 )=, -N(R 9 )C(R 7 )(R 8 )-, -C(R 7 )(R 8 )N(R 9 )-, -N(R 9 )C(R 7 )=, =C(R 7 )N(R 9 )-, -C(R 7 )=C(R 8 )-, -N=C(R 8 )-, -C(R 7 )=N-; p is 1, 2 or 3; Z is N, C or CR 6 ; and R 4 and R 6 may together form =O; A 1 , A 2 and A 3 are independently N, C or CH; G is C, CH or N; J is N, C or CH; E is O or CH; R 1 is absent, hydrogen or alkyl; R 2 -R 6 independently is hydrogen or alkyl; R 7 -R 9 is independently hydrogen or alkyl each time it appears; or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

24. The compound according to claim 23, wherein the compound has the structure of formula (IVa): wherein n is 1 or 2.

25. The compound according to claim 23 or 24, wherein the compound is:

26. The compound according to claim 23, wherein the compound has the structure of formula (IVb): wherein Y is N, CH or CR 10 ; and R 10 is hydrogen or an alkyl group.

27. The compound according to claim 23 or 26, wherein the compound is:

28. The compound according to claim 23 or 26, wherein the compound is:

29. A compound according to any one of claims 23-26, wherein R 2 is alkyl.

30. A compound having the structure of formula (V) or a pharmaceutically acceptable salt thereof: R D1 is hydrogen, alkyl, haloalkyl, mono- or bicyclic heterocyclic group, mono- or bicyclic heteroaryl or aryl (and R D1 may optionally be substituted and any two vicinal substituents may optionally form a 5- or 6-membered ring); R D2 is hydrogen or an alkyl group; X B1 is independently N or CR at each occurrence B1 ; R B1 is independently selected from hydrogen, alkyl, and -R each time it appears C ; R B2 independently selected from hydrogen, optionally unsaturated alkyl, and -R each time it appears C ; and R B1 or R B2 at least one of which is a group -R having the following structure C :[[]] wherein indicates the point of attachment to the compound, and the dashed circle indicates an optional aromaticity; XC 6 is C, CH, CR or N; X C1 、 X C2 、 X C3 、 X C4 and X C5 is independently CH, CR, N, NH, NR, O or S; and when the group is a 5-membered ring, X C5 is absent; and R C1 、R C2 、R C3 、R C4 and R C5 independently is hydrogen, alkyl, -C(O)R, -C(O)NRR, halogen, haloalkyl or cycloalkyl; or may together with an adjacent R group form oxo (=O); and R is independently hydrogen or an optionally unsaturated alkyl group each time it appears.

31. The compound according to claim 30, wherein R D1 is an aryl or alkyl optionally substituted one or more times with substituents selected from alkyl, alkoxy, halogen, -NRR, -C(O)R, -NRC(O)R, and -C(O)NRR; and any two vicinal substituents may together form a 5- or 6-membered ring.

32. The compound according to claim 30 or 31, wherein R D1 is A phenyl group optionally substituted one or more times with alkyl, alkoxy, halogen, -NRR, -C(O)R, -NRC(O)R, and -C(O)NRR, or A 1,4-benzodioxan-5-yl group optionally substituted one or more times with alkyl.

33. A compound according to any one of claims 30 - 32, wherein R D2 is hydrogen or lower alkyl optionally substituted by alkoxy or -NRR.

34. A compound according to any one of claims 30 - 33, wherein R B2 is selected from hydrogen or an optionally unsaturated alkyl group.

35. The compound according to any one of claims 30-34, wherein X C1 is absent.

36. A compound according to any one of claims 30 - 35, wherein R C has the structure: wherein R C1 is hydrogen or an alkyl group.

37. The compound according to any one of claims 30-36, wherein the compound has the structure of formula (Va) or (Vb):

38. The compound according to any one of claims 30-37, wherein the compound has the structure of formula (Vc) or (Vd):

39. The compound according to any one of claims 30-37, wherein the compound has the structure of formula (Ve), (Vf), (Vg), V(h), V(i), or (Vj):

40. The compound according to any one of claims 30-39, wherein the compound is selected from:

41. A compound according to any one of claims 1 - 40, wherein the compound is a Ca 50 3.3 enhancer having an EC less than 100 μM. V ​ 42. A pharmaceutical composition comprising a pharmaceutically acceptable excipient and a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

43. A method of increasing sleep spindles or rescuing sleep spindle defects in a subject in need thereof, the method comprising administering a Ca V 3.3 enhancer to the subject.

44. A method of increasing sleep spindles or rescuing sleep spindle defects in a subject in need thereof, the method comprising administering to the subject a Ca V 3.3 enhancer, wherein the Ca V 3.3 enhancer is a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

45. A method of increasing rebound bursts and optionally restoring spindle wave deficits in the thalamic reticular nucleus (TRN) of a subject in need thereof, the method comprising administering a Ca V 3.3 enhancer to the subject.

46. A method of increasing rebound bursts in the thalamic reticular nucleus (TRN) in a subject in need thereof, the method comprising administering to the subject a Ca V 3.3 enhancer, wherein the Ca V 3.3 enhancer is a compound or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing according to any one of claims 1-41.

47. A method of reducing hyperthalamocortical activity and / or increasing hypothalamocortical activity in a subject in need thereof, the method comprising administering a Ca V 3.3 enhancer to the subject.

48. A method of reducing excessive thalamocortical activity in a subject in need thereof, the method comprising administering to the subject a Ca V 3.3 enhancer, wherein the Ca V 3.3 enhancer is a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

49. The method according to any one of claims 43-46, wherein the subject is a human.

50. The method according to any one of claims 43-49, wherein the subject has schizophrenia.

51. A method for treating or preventing schizophrenia or a disease, disorder or condition associated therewith in a subject in need thereof, the method comprising administering a Ca V 3.3 enhancer to the subject.

52. A method for treating or preventing schizophrenia or a disease, disorder or condition associated therewith in a subject in need thereof, the method comprising administering to the subject a Ca V 3.3 enhancer, wherein the Ca V 3.3 enhancer is a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

53. A method for treating or preventing a neurodevelopmental disorder or a condition associated therewith in a subject in need thereof, the method comprising administering Ca V 3.3 enhancer to the subject.

54. A method for treating or preventing a neurodevelopmental disorder or a condition associated therewith in a subject in need thereof, the method comprising administering to the subject a Ca V 3.3 enhancer, wherein the Ca V 3.3 enhancer is a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

55. The method according to claim 53 or 54, wherein the neurodevelopmental disorder is Alzheimer's disease.

56. The method according to any one of claims 53-55, wherein the administration will rescue cognitive and / or motor deficits associated with the neurodevelopmental disorder.

57. A method for treating or preventing reticular thalamic nucleus (TRN) hypofunction or a disorder associated therewith related to aging or neurodegeneration in a subject in need thereof, the method comprising administering a Ca V 3.3 enhancer to the subject.

58. A method for treating or preventing reticular thalamic (TRN) hypofunction or a condition associated therewith related to aging or neurodegeneration in a subject in need thereof, the method comprising administering to the subject a Ca V 3.3 enhancer, wherein the Ca V 3.3 enhancer is a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

59. The method according to any one of claims 43-58, wherein the subject has altered sleep spindle activity compared to a control subject without TRN hypofunction.

60. A method for improving cognitive function in a subject in need thereof, the method comprising administering a Ca V 3.3 enhancer to the subject.

61. A method of improving cognitive function in a subject in need thereof, the method comprising administering to the subject a Ca V 3.3 enhancer, wherein the Ca V 3.3 enhancer is a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

62. The method according to claim 60 or 61, wherein the subject has a brain dysfunction.

63. The method according to claim 62, wherein the brain dysfunction is caused by a cerebrovascular disease, a brain injury, a brain tumor, viral encephalitis, hypoxic encephalopathy, or alcoholism.

64. The method according to claim 60 or 61, wherein the subject has a cognitive dysfunction.

65. The method according to claim 64, wherein the cognitive dysfunction is selected from memory disorders, attention deficits, executive function deficits, social behavior disorders, neurodegenerative diseases, mental illnesses, or pervasive developmental disorders.

66. The method according to any one of claims 43 - 65, wherein the subject has a Ca V 3.3 mutation.

67. The method according to claim 66, wherein the subject is a human and the Ca V V3.3 mutation is the R1346H mutation, or the subject is a mouse and the CaV3.3 mutation is the R1305H mutation.

68. The method according to claim 66 or 67, wherein the Ca V 3.3 mutation is homozygous.

69. A method of increasing TRN rebound bursts in neurons, the method comprising contacting the neurons with a Ca V 3.3 enhancer.

70. A method of increasing TRN rebound bursts in neurons, the method comprising contacting the neurons with a Ca V 3.3 enhancer, wherein the Ca V 3.3 enhancer is a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

71. A method for producing a compound of formula (I) according to any one of claims 1-29, the method comprising: reacting a compound having a structure of formula (V) with a compound having a structure of formula (VI): wherein Z B1 is independently selected, each time it appears, from hydrogen, optionally unsaturated alkyl, halogen and -Z 1 , and at least one Z B1 is the coupling group Z 1 ; and Z 2 is a coupling group for coupling with Z 1 .

72. A method for monitoring target engagement and / or treatment efficacy in a subject, the method comprising: a) measuring the spindle wave density and / or amplitude in the subject to establish a baseline; b) administering a compound to the subject; c) measuring the spindle wave density and / or amplitude after the administering step; wherein the comparison of the spindle wave density and / or amplitude after the administering step with the baseline is used to monitor target engagement and / or treatment efficacy.

73. The method according to claim 63, wherein the compound is Ca V 3.3 enhancer.

74. The method according to claim 64, wherein the Ca V 3.3 enhancer is a compound according to any one of claims 1-41 or a pharmaceutically acceptable salt thereof or a prodrug of any of the foregoing.

75. The method according to any one of claims 72-74, wherein the sleep spindle wave density is the density of slow sleep spindles.

76. The method according to any one of claims 72-74, wherein the sleep spindle wave density is the density of fast sleep spindles.

77. The method according to any one of claims 72-76, wherein the subject has an autism spectrum disorder (ASD), schizophrenia, attention deficit hyperactivity disorder (ADHD), schizoaffective disorder, bipolar disorder, or Alzheimer's disease.

Images