Application of long-chain non-coding RNA SLCO4A1-AS1 inhibitor in preparation of medicine for treating lung cancer
By developing inhibitors of long-chain non-coding RNA SLCO4A1-AS1 and using Elbavir to inhibit the binding of SLCO4A1-AS1 and ALKBH5, the problem of difficult targeting the metabolic differences of lung cancer cells in the prior art has been solved, and effective inhibition of lung cancer cells and reduction of tumor growth has been achieved.
Patent Information
- Application Number
- CN202510184421.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-19
- Publication Date
- 2025-06-06
AI Technical Summary
The prior art is difficult to effectively target the metabolic differences of lung cancer cells, resulting in the inability of drugs to specifically inhibit tumor cells without affecting normal cells, and the metabolic pathways of tumor cells are highly plastic, resulting in drug failure.
By developing inhibitors of the long-chain non-coding RNA SLCO4A1-AS1, small-molecular drugs such as Elbavir inhibit the binding of SLCO4A1-AS1 to ALKBH5, thereby inhibiting the synthesis of asparagine and destroying the metabolic reprogramming mode of lung cancer cells.
It significantly inhibits the growth of lung cancer cells, reduces tumor volume, and shows good anti-tumor effects in animal models.
Smart Images

Figure BDA0005278081370000031 
Figure HDA0005278081380000011 
Figure HDA0005278081380000012
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of a long-chain non-coding RNA SLCO4A1-AS1 inhibitor in the preparation of a drug for treating lung cancer. Background Art
[0002] The morbidity and mortality of lung cancer rank first among all malignant tumors in the world. For a long time, the survival rate of lung cancer patients has been extremely low, especially the five-year survival rate of patients with mid-late and advanced lung cancer is only 9% and 1% respectively, which seriously threatens the health and life of the Chinese people. Although great progress has been made in recent years in intervention methods such as radiotherapy, chemotherapy, targeted therapy and immunotherapy, the clinical treatment effect is very poor because up to 60-80% of lung cancer patients have infiltration and metastasis at the early stage of diagnosis, and their median survival after treatment is only 20-25 months. Therefore, in-depth research on the molecular mechanism of genes closely related to the malignant progression of lung cancer provides an important theoretical basis for strengthening and promoting the prevention and treatment of lung cancer, and has important clinical value.
[0003] In order to promote tumor growth and maintain rapid proliferation, tumor cells initiate a special metabolic reprogramming mode. On the one hand, there are very significant metabolic differences between tumor cells and normal cells; on the other hand, the metabolic reprogramming of cells of different tumor types is not exactly the same. The cell state, location and supply level of nutrients in the microenvironment also have a huge impact on the metabolic reprogramming mode in tumor cells. In fact, due to the rapid consumption of nutrients such as glucose and glutamine by tumor cells and other cells in the microenvironment, tumor cells are actually in a microenvironment lacking nutrients such as glucose and glutamine in the body. However, as the most important nutrients, lung cancer cells have extremely high requirements for glucose and glutamine. In the absence of glucose or glutamine, lung cancer cells cannot survive. Therefore, lung cancer cells need to undergo further metabolic reprogramming to adapt to the nutrient-deficient microenvironment in order to maintain growth and proliferation. A deep understanding of the metabolic reprogramming mode in lung cancer cells, as well as its biological role and molecular mechanism of how to maintain growth in a nutrient-deficient microenvironment, is particularly important for understanding the metabolic characteristics of lung cancer and developing new anticancer drugs targeting lung cancer metabolism.
[0004] In view of the metabolic differences between tumor cells and normal cells, a large number of drugs targeting tumor metabolism have been developed, among which glycolysis inhibitors or drugs targeting glutamine catabolism are the main ones. However, since normal cells also need to use glucose and glutamine as energy substances, most drugs cannot specifically target tumor cells without affecting normal cells. These drugs have terminated further research due to serious systemic toxicity and drug off-target. Currently, no glycolysis inhibitors or drugs targeting glutamine catabolism have been approved by the FDA for clinical use as anti-tumor drugs. In addition, due to the strong plasticity of tumor cells, when a certain metabolic pathway is inhibited, other bypass pathways can be quickly activated to play a compensatory role, resulting in drug failure. In addition, most of our previous understanding of tumor metabolic reprogramming is based on the results of tumor cell culture in vitro, and there are significant differences in the metabolic environment in vivo and in vitro. In fact, due to the dual effects of tumor cells' rapid consumption of nutrients and relatively reduced vascularization, tumor tissues in vivo are in an environment relatively lacking in glucose and glutamine, while tumor cells cultured in vitro are highly dependent on glucose and glutamine. When deprived of glucose and glutamine, most tumor cells experience growth stagnation or even death.
[0005] Elbasvir (C49H55N9O7) is an inhibitor of hepatitis C virus nonstructural protein 5A (HCV NS5A) used to treat hepatitis C. There is currently no evidence that this compound can be used to inhibit lung cancer progression or other similar effects. Summary of the invention
[0006] The purpose of the first aspect of the present invention is to provide a long non-coding RNA SLCO4A1-AS1 and its application.
[0007] The second aspect of the present invention aims to provide the use of a substance that inhibits long non-coding RNA SLCO4A1-AS1.
[0008] The third aspect of the present invention aims to provide a medicine.
[0009] The fourth aspect of the present invention aims to provide a method.
[0010] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:
[0011] The first aspect of the present invention provides a long non-coding RNA SLCO4A1-AS1.
[0012] The nucleic acid sequence of the long non-coding RNA SLCO4A1-AS1 is shown in SEQ ID NO: 1.
[0013] The long non-coding RNA SLCO4A1-AS1 has the following applications:
[0014] 1) Preparation of products that promote aspartate anabolism;
[0015] 2) Promote aspartate synthesis in vitro for non-therapeutic purposes.
[0016] The second aspect of the present invention provides the use of a substance that inhibits long non-coding RNA SLCO4A1-AS1 in a1) to a3):
[0017] a1) Preparation of products for the treatment of cancer;
[0018] a2) Preparation of products that inhibit asparagine anabolism;
[0019] a3) In vitro non-therapeutic inhibition of aspartate synthesis.
[0020] The nucleic acid sequence of the long non-coding RNA SLCO4A1-AS1 is shown in SEQ ID NO: 1.
[0021] Preferably, the substance that inhibits long non-coding RNA SLCO4A1-AS1 includes at least one of substances that inhibit the expression amount, and / or activity, and / or the ability to bind to the interacting protein of long non-coding RNA SLCO4A1-AS1;
[0022] Preferably, the substance that inhibits the expression of long non-coding RNA SLCO4A1-AS1 includes at least one of b1) to b3):
[0023] b1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting long noncoding RNA SLCO4A1-AS1;
[0024] b2) a nucleic acid molecule encoding b1);
[0025] b3) An expression cassette, a vector or a transgenic cell line comprising b2).
[0026] Preferably, the sgRNA targeting long non-coding RNA SLCO4A1-AS1 is as shown in SEQ ID NO: 4 or SEQ ID NO: 5.
[0027] Preferably, the substance that inhibits the ability of long non-coding RNA SLCO4A1-AS1 to bind to interacting proteins includes Elbasvir.
[0028] Preferably, the interacting protein comprises ALKBH5.
[0029] Preferably, the amino acid sequence of ALKBH5 is as shown in SEQ ID NO:6.
[0030] Preferably, the Elbasvir includes Elbasvir or its derivatives; the structural formula of the Elbasvir is as shown below:
[0031]
[0032] Preferably, the derivative comprises a pharmaceutically acceptable salt.
[0033] Preferably, the pharmaceutically acceptable salt includes at least one of a metal salt, an ammonium salt, a salt formed with an inorganic acid, a salt formed with an organic base, a salt formed with an organic acid, a salt formed with a basic amino acid, and a salt formed with an acidic amino acid.
[0034] Preferably, the metal salt comprises an alkali metal salt or an alkaline earth metal salt.
[0035] Preferably, the alkali metal salt includes at least one of a sodium salt and a potassium salt.
[0036] Preferably, the alkaline earth metal salt includes at least one of calcium salt, magnesium salt, barium salt and aluminum salt.
[0037] Preferably, the salt formed with the organic base includes a salt formed with the following organic bases: at least one of trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine and N,N'-dibenzylethylenediamine.
[0038] Preferably, the salt formed with an inorganic acid includes a salt formed with the following inorganic acids: at least one of hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, and phosphoric acid.
[0039] Preferably, the salt formed with the organic acid includes a salt formed with the following organic acids: at least one of formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, and p-toluenesulfonic acid.
[0040] Preferably, the salt formed with a basic amino acid includes a salt formed with the following basic amino acids: at least one of arginine, lysine and ornithine.
[0041] Preferably, the salt formed with the acidic amino acid includes a salt formed with the following acidic amino acids: at least one of aspartic acid and glutamic acid.
[0042] Preferably, the cancer comprises lung cancer.
[0043] Preferably, the product comprises a pharmaceutical product.
[0044] Preferably, the drug further comprises pharmaceutically acceptable excipients.
[0045] The third aspect of the present invention provides a drug comprising a substance that inhibits long non-coding RNA SLCO4A1-AS1.
[0046] Preferably, the substance that inhibits the long non-coding RNA SLCO4A1-AS1 includes a substance that inhibits the expression amount of the long non-coding RNA SLCO4A1-AS1.
[0047] Preferably, the substance that inhibits the expression of long non-coding RNA SLCO4A1-AS1 includes at least one of b1) to b3):
[0048] b1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting long noncoding RNA SLCO4A1-AS1;
[0049] b2) a nucleic acid molecule encoding b1);
[0050] b3) An expression cassette, a vector or a transgenic cell line comprising b2).
[0051] Preferably, the sgRNA targeting long non-coding RNA SLCO4A1-AS1 is as shown in SEQ ID NO: 4 or SEQ ID NO: 5.
[0052] Preferably, the substance that inhibits the long non-coding RNA SLCO4A1-AS1 includes a substance that inhibits the binding ability of the long non-coding RNA SLCO4A1-AS1 with the interacting protein.
[0053] Preferably, the substance that inhibits the ability of long non-coding RNA SLCO4A1-AS1 to bind to interacting proteins includes Elbasvir.
[0054] Preferably, the drug further comprises a pharmaceutically acceptable excipient.
[0055] Preferably, the medicament further comprises another second active ingredient.
[0056] Preferably, the interacting protein includes ALKBH5; the amino acid sequence of ALKBH5 is shown in SEQ ID NO:6.
[0057] The fourth aspect of the present invention provides any one of the methods c1) to c2), wherein cells are treated with the drug of the third aspect of the present invention;
[0058] c1) Methods for inhibiting asparagine synthesis in vitro for non-therapeutic purposes;
[0059] c2) Methods for sensitizing cells to nutrient deprivation in vitro for non-therapeutic purposes.
[0060] Preferably, the cells comprise lung cancer cells.
[0061] The beneficial effects of the present invention are:
[0062] The present invention explores the mechanism of action of long non-coding RNA SLCO4A1-AS1 and finds that long non-coding RNA SLCO4A1-AS1 promotes lung cancer cells to synthesize asparagine and maintain cell growth by binding to ALKBH5. The present invention further simulates docking and screening of the structural data of long non-coding RNA SLCO4A1-AS1 and ALKBH5 with the FDA-approved drug structure database to obtain a small molecule drug that potentially inhibits the binding of SLCO4A1-AS1 to ALKBH5: Elbasvir. Furthermore, the present invention finds that Elbasvir can inhibit the growth of lung cancer cells at the cellular level; in animal models, Elbasvir can significantly inhibit tumor cell growth and reduce tumor volume. BRIEF DESCRIPTION OF THE DRAWINGS
[0063] Figure 1 The expression of non-long-chain coding RNA SLCO4A1-AS1 in lung cancer cells: A is the expression level of SLCO4A1-AS1 in lung cancer cells detected by real-time quantitative PCR; B is the growth of lung cancer cells under nutrient deficiency after knocking out non-coding RNA SLCO4A1-AS1.
[0064] Figure 2 These are the results of the binding of long non-coding RNA SLCO4A1-AS1 to ALKBH5: A is the result of the RIP experiment to detect the binding ability of SLCO4A1-AS1 to ALKBH5 in lung cancer cells; B is the asparagine content in lung cancer cells under nutrient deficiency.
[0065] Figure 3 The results of Elbasvir inhibiting the binding of long non-coding RNA SLCO4A1-AS1 and ALKBH5: A is a schematic diagram of the binding of Elbasvir to SLCO4A1-AS1 and ALKBH5; B is the result of the RIP experiment detecting the inhibitory effect of Elbasvir on the binding ability of SLCO4A1-AS1 and ALKBH5; C is the effect of Elbasvir on asparagine synthesis in lung cancer cells.
[0066] Figure 4 These are the results of Elbasvir inhibiting the growth of lung cancer cells: A is the result of the plate cloning experiment to detect the inhibitory effect of Elbasvir on the growth of lung cancer cells; B is the result of Elbasvir's ability to inhibit the growth of lung cancer cells in mice. DETAILED DESCRIPTION
[0067] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.
[0068] Example 1 Long noncoding RNA SLCO4A1-AS1 is upregulated in lung cancer cells and promotes lung cancer cells to resist nutrient deficiency
[0069] 1. Experimental methods
[0070] 1) Detection of the expression of long noncoding RNA SLCO4A1-AS1
[0071] 95D cells were seeded at a density of 2×106 in three 100×20 mm culture dishes. After the cells adhered, the culture medium was discarded, and the cells were washed twice with PBS and then discarded. 8 ml of complete culture medium (Gbico, 11965092), glucose-deficient culture medium (Gbico, 11966025) and glutamine-deficient culture medium (Gbico, 11960044) were added to culture the cells.
[0072] After 48 hours, the surviving tumor cells were collected and the total cellular RNA was extracted using the Trizol method. The extracted RNA was immediately used for subsequent experiments or stored at -40°C.
[0073] The following primers were used to detect the expression level of long noncoding RNA SLCO4A1-AS1 in 95D cells cultured in complete medium, glucose-deficient medium and glutamine-deficient medium, respectively, by real-time fluorescence quantitative PCR.
[0074] The nucleotide sequence of the long noncoding RNA SLCO4A1-AS1 is:
[0075]
[0076] Upstream primer: CTCTCCACACCTGCTCTG (SEQ ID NO: 2);
[0077] Downstream primer: GAGTCTTCAAGGGCATCTTC (SEQ ID NO: 3).
[0078] 2) Construction of a lung cancer cell line that stably silences the long noncoding RNA SLCO4A1-AS1
[0079] The lentiviral vector is used to prepare the virus liquid (cell culture liquid containing viral plasmid particles, referred to as virus liquid). The following describes the virus transfection experimental method using liposome transfection as an example.
[0080] ① A pair of sgRNAs were designed targeting the exons of SLCO4A1-AS1 through the CRISPR Guide design website (https: / / zlab.bio / guide-design-resources), and the SLCO4A1-AS1 gene knockout plasmid was constructed using the CRISPR-Cas9-2hitKO system.
[0081] The sequence of sgRNA-SLCO4A1-AS1-1 is: GUCGGGGCCCCAAGCACCCG (SEQ ID NO: 4); this primer was used in the subsequent construction of SLCO4A1-AS1-KO cells.
[0082] The sequence of sgRNA-SLCO4A1-AS1-2 is: CCAGGGACCGCGGGUGCUUG (SEQ ID NO: 5).
[0083] ②Preparation before transfection: Spread 95D cells with a cell number of about 2.0-3.0×106 / into a 100×100 mm cell culture dish.
[0084] ③ Transfection: Observe the cell status under a microscope after 24 hours to ensure that the cells are in good condition. Configure the transfection system as follows:
[0085] Solution A: SLCO4A1-AS1 gene knockout plasmid 10 μg, p3000 (Thermo, Catalog: #L3000-015) 10 μL, Opti-MEM (Gibco, Catalog: #31985070) 500 μL;
[0086] Solution B: 500 μl Opti-MEM + 10 μl lipo 3000 (Thermo, Catalog: #L3000-015) solution, mix well.
[0087] ④ Gently mix solution A and solution B, let stand at room temperature for 15 to 20 minutes, slowly and evenly add 1 mL of DNA-Lipofectamine3000 mixed solution to the 100×100 mm cell culture dish where 95D cells are cultured, gently mix and place in a cell culture incubator for 48 hours.
[0088] ⑤ Screening positive cells: The above cells were sorted by flow cytometry, and the strongly positive cells were sorted into a 96-well cell culture plate, with one cell inoculated into each well;
[0089] ⑥ Identification of positive cells: When the above cells were expanded to a sufficient number, RNA and protein were collected and extracted, and the expression of SLCO4A1-AS1 was verified by qRT-PCR and Western blot experiments to obtain 95D sg-ctrl and 95D SLCO4A1-AS1-KO cells.
[0090] 3) Plate cloning experiment
[0091] After digestion, count the cells in the logarithmic growth phase, inoculate 1000-2000 cells per well into a 6-well plate, and culture in a constant temperature incubator. Culture continuously for 1-2 weeks. When clones visible to the naked eye appear in the culture dish, terminate the culture. Discard the supernatant, wash the cells twice with 1×PBS solution; discard the 1×PBS, add 1ml pure methanol, and fix at room temperature for 15 minutes; discard the fixative, and wash the cells twice with 1×PBS solution. Discard the 1×PBS, add 1ml 4% crystal violet dye for staining, incubate at room temperature for 15 minutes, and terminate the staining, and recover the crystal violet dye. Slowly wash off the excess dye with running water and place in a fume hood to dry.
[0092] 2. Experimental results
[0093] like Figure 1 As shown in Figure A, the long noncoding RNA SLCO4A1-AS1 is upregulated in lung adenocarcinoma cells that tolerate glucose and glutamine deficiency. Figure 1 As shown in B, in the absence of glucose and glutamine, 95D sg-Ctrl cells can maintain normal growth. After knocking out SLCO4A1-AS1, the cell growth ability is significantly reduced or even lost.
[0094] Example 2 Long noncoding RNA SLCO4A1-AS1 binds to ALKBH5 to promote asparagine metabolic reprogramming
[0095] 1. Experimental methods
[0096] 1) RNA binding protein immunoprecipitation experiment
[0097] Digest and resuspend 95D cells, culture the cells in 100 × 20 mm culture dishes, and plate at 2 × 10 6 The cells were inoculated at a high density; after the cells adhered, the culture medium was discarded, and the cells were washed twice with PBS and then discarded. 8 ml of complete culture medium, glucose-deficient culture medium and glutamine-deficient culture medium were added to culture the cells respectively; the cells were collected after 48 hours, and the binding ability of long non-coding RNA SLCO4A1-AS1 with ALKBH5 (human Alk B homolog 5, ALKBH5) was detected by RIP experiment.
[0098] The amino acid sequence of ALKBH5 is: maaasgytdl reklksmtsr dnykagsrea aaaaaaavaaaaaaaaaaep ypvsgakrky qedsdpersd yeeqqlqkee earkvksgir qmrlfsqdec akiearidevvsraekglyn ehtvdraplr nkyffgegyt ygaqlqkrgp gqerlyppgd vdeipewvhq lviqklvehrvipegfvnsa vindyqpggc ivshvdpihi ferpivsvsf fsdsalcfgc kfqfkpirvs epvlslpvrrgsvtvlsgya adeithcirp qdikerraviilrktrldap rletkslsss vlppsyasdr lsgnnrdpalkpkrshrkad pdaahrpril emdkeenrrs vllpthrrrg sfssenywrk syessedcse aagsparkvkmrrh (SEQ ID NO: 6).
[0099] 1) Antibody and magnetic bead incubation: 50 μL Dynabeads Protein G (Thermo, 1004D) was added to a 1.5 mL RNase-free EP tube, washed twice with 1 mL 1×DEPC PBS, and 1 mL NT2 Buffer (solution formula: 50 mM Tris-HCl pH 7.4; 150 mM NaCl; 1 mM MgCl 2; 0.05% NP-40) for 2 times. Discard the supernatant, add 100 μL NT2 Buffer (RNase Inhibitor, Cocktail and 100 mM DTT at a ratio of 1:100, and 15 mM EDTA at a ratio of 3:200), and add 2 μg ALKBH5 antibody (proteintech, 16837-1-AP), and place on a 360-degree rotating shaker at 4°C for more than 2 hours;
[0100] 2) Cell fixation: 4.5 ml of culture medium was retained in a 100 mm culture dish, 500 μL of fixative (11% formaldehyde) was added, mixed and placed at room temperature for crosslinking for 10 min; then 500 μL of 0.25 M glycogen was added, mixed and placed at room temperature for 5 min;
[0101] 3) Cell lysis: discard the culture medium, add 5mL 1×DEPC PBS to wash twice, use a cell scraper to collect the cells into a 15mL centrifuge tube, centrifuge at 1000rpm for 5 minutes at 4℃, discard the supernatant, add 5mL 1×DEPC PBS to wash the cells again, centrifuge at 1000rpm for 5 minutes at 4℃, discard the supernatant, use 200μL PLB solution (add RNase Inhibitor, Cocktail and 100mM DTT at a ratio of 1:100, add RVC at a ratio of 1:200) to resuspend the cells and mix them evenly, transfer them to a 1.5mL RNase-free EP tube, place on ice for 30min, and turn upside down every 5-10 minutes. Centrifuge the 1.5mL RNase-free EP tube at 12000rpm for 10min at 4℃, discard the precipitate and retain the supernatant, and take out 20μL as input;
[0102] 4) Incubation of antibody and cell lysate: Add the lysate to the mixture of magnetic beads and antibody, mix thoroughly and place on a 360-degree rotating shaker at 4°C overnight. Use a magnetic stand to discard the supernatant and retain the magnetic beads, add 1 mL of NT2 Buffer to resuspend the magnetic beads, and place on a 360-degree rotating shaker at 4°C to wash the magnetic beads for 5 minutes, a total of 5 times;
[0103] 5) Digestion of DNA and protein: Use a magnetic stand to discard the supernatant and retain the magnetic beads, add 100 μL NT2 Buffer to resuspend the magnetic beads, add 2 μL RNase inhibitor (Promega, N2518) and 5 μL RNase-free DNase I (2U / μL) (GENSTAR A216-101), and incubate in a 37°C metal bath for 10 min; then add 5 μL Proteinase K (10 mg / mL) and 1 μL 10% SDS, and incubate in a 55°C metal bath for 30 min, mixing by inverting every 10 min;
[0104] 6) Extract RNA: Add 92 μL NT2 Buffer to make the volume 200 μL, and use Magen-LogPureViral DNA / RNA Kits to extract RNA. Add 200 μL Buffer AL (add Carrier RNA at a ratio of 15:1000) to the sample, vortex mix for 20 seconds; add 250 μL anhydrous ethanol, vortex mix for 20 seconds, let stand at room temperature for 5 minutes, centrifuge briefly, and pass through the column to recover RNA for subsequent experiments.
[0105] 2) Asparagine concentration detection
[0106] The cells were collected and the intracellular asparagine concentration was detected using an asparagine concentration detection kit (Mibio catalog number: mi591477).
[0107] 2. Experimental results
[0108] like Figure 2 As shown in Figure A, the long noncoding RNA SLCO4A1-AS1 can bind to the demethylase SLCO4A1-AS1ALKBH5. In addition, in 95D cells cultured in medium lacking glucose or glutamine, asparagine synthesis increased significantly (e.g. Figure 2 (shown in B).
[0109] Example 3 Elbasvir inhibits the binding of long noncoding RNA SLCO4A1-AS1 to ALKBH5 and reprograms asparagine metabolism
[0110] 1. Experimental methods
[0111] 1) Molecular docking
[0112] The long non-coding RNA SLCO4A1-AS1 and ALKBH5 were used as the main research objects for subsequent experiments. In order to screen small molecule inhibitors that bind to long non-coding RNA SLCO4A1-AS1 and ALKBH5, the computer software MOE2010.10 was used for preliminary screening, and small molecule drugs that bind to the binding sites of long non-coding RNA SLCO4A1-AS1 and ALKBH5 were screened from the FDA listed drug library (TargetMol, EN6600).
[0113] 2) Cell treatment
[0114] Digest and resuspend 95D cells, culture the cells in 100 × 20 mm culture dishes, and plate at 2 × 10 6 After the cells adhered, the culture medium was discarded, and the cells were washed twice with PBS and then discarded. 8 ml of complete culture medium, glucose-deficient culture medium, and glutamine-deficient culture medium were added to culture the cells, and Elbasvir (MCE, catalog number: HY-15789) was added at the final experimental concentrations of 250 nM, 500 nM, and 1000 nM, respectively.
[0115] After 48 hours, the cells were collected and the binding ability of the long non-coding RNA SLCO4A1-AS1 to ALKBH5 was detected by RIP experiment (same as Example 2).
[0116] At the same time, the cells were collected and the intracellular asparagine concentration was detected using an asparagine concentration detection kit.
[0117] 2. Experimental results
[0118] The present invention further simulates docking and screening the structural data of long non-coding RNA SLCO4A1-AS1 and ALKBH5 with the FDA-approved drug structure database to obtain a small molecule drug that potentially inhibits the binding of SLCO4A1-AS1 to ALKBH5: Elbavir.
[0119] like Figure 3 As shown in Figure A, in molecular docking, Elbasvir can bind to long noncoding RNA SLCO4A1-AS1 and ALKBH5. Figure 3 As shown in B and C, when 95D cells were treated with elbasvir, the binding between long noncoding RNA SLCO4A1-AS1 and ALKBH5 was weakened, and at this time, there was no significant change in asparagine concentration in 95D cells that were tolerant to glucose and lacked glutamine.
[0120] Example 4 Elbasvir inhibits lung cancer cell growth
[0121] 1. Experimental methods
[0122] 1) Plate clone staining
[0123] Digest and resuspend 95D cells, culture the cells in 6-well cell culture plates, and plate at 2 × 10 3 / well density; after the cells adhered, the culture medium was discarded, and the PBS was washed twice with PBS and then discarded. 2mL of complete culture medium, glucose-deficient culture medium and glutamine-deficient culture medium were added to culture the cells, and Elbasvir was added at experimental concentrations of 250nM, 500nM and 1000nM respectively; after 7 days of culture, the 6-well cell culture plate was taken out, the cell culture medium was removed, and the plates were washed with PBS; 1% crystal violet was used for staining for 15 minutes, and after drying, the number of clones in each well was photographed and counted.
[0124] 2) Animal experiments
[0125] Digest and count the 95D cells, and resuspend the cells in PBS solution to a final concentration of 1×10 6 / 100μL, 100μL tumor cell suspension was inoculated into mice by subcutaneous inoculation in the groin (n=10); 7 days after inoculation, the mice were divided into two groups, the control group received subcutaneous injection of 100μL normal saline (n=5), and the experimental group (Elbasvir treatment) received subcutaneous injection of 100μL Elbasvir solution (concentration: 10μM) (n=5). Subsequent administration was twice a week for 4 consecutive weeks, and the subcutaneous transplanted tumors of mice were removed after 4 weeks to observe and calculate the tumor size. The experimental animals involved were specific pathogen free (SPF) grade immunodeficient mice BALB / c-nu / nu, 5-8 weeks old, 18-20g, purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. (SCXK (Beijing) 2016-0011). All experimental animals were raised and experimental operations were carried out in the Animal Experiment Center of the North Campus of Sun Yat-sen University, and the experimental process was in accordance with animal ethics.
[0126] 2. Experimental results
[0127] The results of the plate colony formation experiment are as follows Figure 4 As shown in Figure A, Elbasvir treatment significantly inhibited the growth of lung cancer cells, and the inhibitory effect was better in the absence of glucose or glutamine. In the mouse groin subcutaneous inoculation model, Elbasvir also significantly inhibited tumor cell growth and even prevented tumor cells from forming tumors ( Figure 4 (B).
Claims
1. Application of substances inhibiting long non-coding RNA SLCO4A1-AS1 in a1) to a3): a1) Preparation of products for the treatment of cancer; a2) Preparation of products that inhibit asparagine anabolism; a3) Inhibition of aspartate synthesis in vitro for non-therapeutic purposes; The nucleic acid sequence of the long non-coding RNA SLCO4A1-AS1 is shown in SEQ ID NO:
1.
2. The use according to claim 1, characterized in that: The substance that inhibits the long non-coding RNA SLCO4A1-AS1 includes at least one of substances that inhibit the expression amount and / or activity of the long non-coding RNA SLCO4A1-AS1 and / or the ability to bind to the interacting protein.
3. The use according to claim 2, characterized in that: The substance that inhibits the expression of long non-coding RNA SLCO4A1-AS1 includes at least one of b1) to b3): b1) siRNA, dsRNA, miRNA, ribozyme, sgRNA or shRNA targeting long noncoding RNA SLCO4A1-AS1; b2) a nucleic acid molecule encoding b1); b3) An expression cassette, a vector or a transgenic cell line comprising b2).
4. The use according to claim 3, characterized in that: The sgRNA targeting the long non-coding RNA SLCO4A1-AS1 is shown in SEQ ID NO: 4 or SEQ ID NO: 5; Preferably, the substance that inhibits the ability of long non-coding RNA SLCO4A1-AS1 to bind to interacting proteins includes Elbasvir.
5. The use according to claim 4, characterized in that: The interacting proteins include ALKBH5; The amino acid sequence of ALKBH5 is shown in SEQ ID NO:
6.
6. The use according to claim 5, characterized in that: The Elbasvir includes Elbasvir or its derivatives; Preferably, the derivative comprises a pharmaceutically acceptable salt.
7. The use according to claim 1, characterized in that: The cancer includes lung cancer.
8. The use according to claim 1, characterized in that: The products include pharmaceutical products; Preferably, the drug further comprises pharmaceutically acceptable excipients.
9. Any method of c1) to c2), using the drug of any one of claims 7 to 8 to treat cells; c1) a method for inhibiting asparagine synthesis in vitro for non-therapeutic purposes; c2) Methods for sensitizing cells to nutrient deprivation in vitro for non-therapeutic purposes.
10. The method according to claim 9, characterized in that: The cells include lung cancer cells.