New application of IGF2BP1 gene
By overexpressing or interfering with the IGF2BP1 gene and identifying and stabilizing the expression of circMYO9B, the problem of unknown molecular mechanism in which the IGF2BP1 protein regulates circRNA through the m6A pathway affects myocyte development, achieving the effect of promoting goat muscle development.
Patent Information
- Application Number
- CN202510258144.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-06
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-03-06
AI Technical Summary
The prior art has not yet clarified the molecular mechanism by which IGF2BP1 protein regulates circRNA through the m6A pathway, and related applications have not yet been explored in depth.
By overexpressing or interfering with the IGF2BP1 gene, it recognizes and stabilizes the expression of circMYO9B, thereby promoting the proliferation and differentiation of goat skeletal muscle satellite cells. At the same time, by regulating the expression of METTL3 and FTO genes, the m6A methylation modification level of circMYO9B is regulated, and its stability and function are enhanced.
The promotion effect of IGF2BP1 on goat muscle development has been achieved, and the molecular mechanism in which IGF2BP1 regulates circleRNA through the m6A pathway affects myocyte development, and improves the molecular regulatory network for goat muscle development.
Smart Images

Figure CN120093952A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of poultry breeding, and in particular to a new application of an IGF2BP1 gene. Background Art
[0002] Skeletal muscle satellite cells (MuSCs) are stem cells located between the basement membrane and plasma membrane of myofiber. They can differentiate into myoblasts under specific action, providing a basis for the development of skeletal muscle. Analyzing the mechanism of key genes regulating skeletal muscle growth and development is the core content of molecular genetic breeding research in mutton sheep. Insulin like Growth Factor 2mRNA binding Proteins (IGF2BP1) is an important candidate gene affecting the economic traits of livestock and poultry, but the related molecular mechanism is still unclear. Regarding the functional level of IGF2BP1 protein, current research mainly focuses on the mechanism analysis of cancer-related diseases, and the molecular mechanism of regulating circRNA through the m6A pathway to affect muscle cell development has not been reported. Therefore, this study intends to explore the molecular mechanism of IGF2BP1 regulating circRNA through the m6A pathway to affect muscle cell development based on the m6A reading protein function of IGF2BP1. Summary of the invention
[0003] The purpose of the present invention is to further explore the molecular mechanism by which IGF2BP1 regulates circRNA through the m6A pathway to affect muscle cell development, and thus provide a new application of the IGF2BP1 gene.
[0004] In order to achieve the above object, the technical solution of the present invention is:
[0005] In a first aspect, the present invention provides the use of the IGF2BP1 gene in the preparation of a product for promoting the proliferation and differentiation of goat skeletal muscle satellite cells or a product for promoting the muscle development of goats.
[0006] Preferably, the IGF2BP1 gene promotes the proliferation and differentiation of goat skeletal muscle satellite cells or promotes goat muscle development by recognizing circMYO9B in goat skeletal muscle satellite cells.
[0007] In a second aspect, the present invention provides the use of an agent for enhancing or promoting the expression of the IGF2BP1 gene in the preparation of a product for promoting the proliferation and differentiation of goat skeletal muscle satellite cells or a product for promoting the development of goat muscles.
[0008] Reagents for enhancing or promoting the expression of the IGF2BP1 gene, such as pEGFP-IGF2BP1, are obtained by PCR amplifying the IGF2BP1 gene using homologous primers, connecting the amplified product with a linearized pEGFP-N1 vector, and transforming the resultant product into competent cells.
[0009] In a third aspect, the present invention provides the use of an agent for enhancing or promoting the expression of the circMYO9B gene in the preparation of a product for promoting the proliferation and differentiation of goat skeletal muscle satellite cells or a product for promoting goat muscle development.
[0010] Reagents that enhance or promote the expression of the circMYO9B gene, such as pCD5-circMYO9B, are obtained by PCR amplification of the full-length circMYO9B gene, restriction digestion of the amplified product and the pCD5-ciR vector, and then ligation and transformation into competent cells.
[0011] In a fourth aspect, the present invention provides the use of the circMYO9B gene in preparing a product for promoting the proliferation and differentiation of goat skeletal muscle satellite cells or a product for promoting goat muscle development.
[0012] Preferably, the upstream regulatory genes of the circMYO9B gene are METTL3 and FTO; the circMYO9B gene has an m6A methylation modification site, and the m6A methylation modification level of the circMYO9B gene is promoted by overexpressing the METTL3 gene and / or interfering with the FTO gene, thereby promoting the proliferation and differentiation of goat skeletal muscle satellite cells, or promoting goat muscle development; more preferably, the m6A methylation modification sites are circMYO9B-17 and circMYO9B-77.
[0013] Preferably, the method of overexpressing the METTL3 gene includes: designing primers and amplifying the target gene, and then connecting it to an overexpression vector and transforming it; and / or, interfering with the FTO gene includes designing interfering siRNA or using a demethylase activity inhibitor.
[0014] In a fifth aspect, the present invention provides the use of the METTL3 gene and / or the FTO gene in the preparation of a product for promoting the proliferation and differentiation of goat skeletal muscle satellite cells or a product for promoting goat muscle development.
[0015] In a sixth aspect, the present invention provides the use of an agent for enhancing or promoting the expression of the METTL3 gene in the preparation of a product for promoting the proliferation and differentiation of goat skeletal muscle satellite cells or a product for promoting goat muscle development.
[0016] Reagents for enhancing or promoting the expression of the METTL3 gene, such as pEGFP-METTL3, are obtained by PCR amplifying the METTL3 gene using homologous primers, connecting the amplified product with a linearized pEGFP-N1 vector, and transforming the amplified product into competent cells.
[0017] In a seventh aspect, the present invention provides the use of an agent for reducing or inhibiting the expression of the FTO gene in the preparation of a product for promoting the proliferation and differentiation of goat skeletal muscle satellite cells or a product for promoting goat muscle development.
[0018] Reagents that reduce or inhibit FTO gene expression include, for example, siFTO, whose sequence is shown in SEQ ID NO.35, and demethylase activity inhibitor FB23-2, etc.
[0019] Compared with the prior art, the present invention has the following beneficial effects:
[0020] The present invention overexpressed and interfered with IGF2BP1 in goat MuSCs, respectively, and proved the promoting effect of IGF2BP1 on the proliferation and differentiation of goat MuSCs. The present invention also found that the expression levels of IGF2BP1 and circMYO9B were significantly positively correlated, and that circMYO9B was a circRNA with m6A modification, which was regulated by the m6A modification level. IGF2BP1 recognized circMYO9B through the m6A pathway, stabilized its expression, and then regulated the proliferation of goat MuSCs. The technical research of the present invention provides insights into goat muscle development in epigenetics and further improves the molecular regulatory network of goat muscle development. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:
[0022] Figure 1 The effects of overexpression or interference of IGF2BP1 on proliferation and differentiation marker genes and cell phenotypes in Example 1 of the present invention, wherein A. Identification of goat MuSCs, immunofluorescence assays were performed on Pax7 (scale bar: 200 μm) and MYHC (scale bar: 400 μm) in goat MuSCs; B. Effect of overexpression of IGF2BP1 on proliferation marker genes; C. Effect of interference of IGF2BP1 on proliferation marker genes; D. Effect of overexpression of IGF2BP1 on differentiation marker genes; E. Effect of interference of IGF2BP1 on differentiation marker genes. The bar graphs represent the mean ± standard error of at least three replicates, *p<0.05, **p<0.01.
[0023] Figure 2The effect of circMYO9B on the proliferation of goat MuSCs in Example 1 of the present invention, wherein: A. Screening of circMYO9B; B. Sanger sequencing to detect circMYO9B cyclization sites; C. Expression of circMYO9B in different tissues of goats; D. Expression of IGF2BP1 during the proliferation and differentiation of goat MuSCs; E. Expression of circMYO9B during the proliferation and differentiation of goat MuSCs; F. Effect of overexpression of IGF2BP1 on circMYO9B; G. Effect of overexpression of circMYO9B on proliferation marker genes; H. Effect of overexpression of circMYO9B on the number of goat MuSCs. The bar graph represents the mean ± standard error of at least three replicates, *p<0.05, **p<0.01; any with the same letter is not significantly different, any with different letters is significantly different, and lowercase letters represent p<0.05.
[0024] Figure 3 The effect of m6A modification level on circMYO9B in Example 1 of the present invention, wherein: A. prediction of circMYO9B m6A modification sites; B. enrichment of circMYO9B fragments on m6A antibodies; C. effect of overexpression of METTL3 on circMYO9B; D. effect of interfering with FTO on circMYO9B; E. effect of interfering with METTL3 on circMYO9B m6A modification; F. effect of interfering with FTO on circMYO9B m6A modification level; G. effect of interfering with FTO on the overall m6A modification level of MuSCs; H. effect of FB23-2 on the overall m6A modification level of MuSCs; I. effect of FB23-2 on circMYO9B m6A modification level; J. schematic diagram of dual luciferase reporter vector; K. effect of interfering with FTO on luciferase activity. The bar graphs represent the mean ± standard error of at least three replicates, *p<0.05, **p<0.01; the differences were not significant if there was one identical letter, and were significant if there were different letters. Lowercase letters represent p<0.05.
[0025] Figure 4The effect of IGF2BP1 on the stability of circMYO9B in MuSCs in Example 1 of the present invention, wherein A. circMYO9B and IGF2BP1 binding prediction; B. circMYO9B enrichment on IGF2BP1 antibody; C. Effect of overexpression of IGF2BP1 on luciferase activity; D. Effect of interference with IGF2BP1 on luciferase activity; E. Effect of overexpression of IGF2BP1 on the stability of circMYO9B in MuSCs; F. Effect of interference with IGF2BP1 on the stability of circMYO9B in MuSCs; G. Effect of interference with FTO on the stability of circMYO9B in MuSCs; H. Effect of FB23-2 on the stability of circMYO9B in MuSCs. The bar graphs and scatter plots represent the mean ± standard error of at least three replicates, *p<0.05, **p<0.01.
[0026] Figure 5 In Example 1 of the present invention, IGF2BP1 recognizes circMYO9B through the m6A pathway and stabilizes its expression.
[0027] Figure 6 The verification of the coding function of circMYO9B in Example 1 of the present invention, wherein A. circMYO9B IRES site prediction; B. circMYO9B ORF prediction; C. IRES activity verification in circMYO9B; D. Schematic diagram of circMYO9B-FLAG tag protein vector; E. FLAG protein immunofluorescence results (scale: 200 μm); F. Schematic diagram of circRNA coding function research vector; G. Effects of fragments containing different numbers of m6A motifs on circRNA coding signals. The bar graph represents the mean ± standard error of at least three replicates, *p<0.05, **p<0.01; any one with the same letter is not significantly different, any one with different letters is significantly different, and lowercase letters represent p<0.05.
[0028] Figure 7 The m6A modification level of circMYO9B in Example 1 of the present invention is shown in Figure 1. In the figure, the blue part marks the m6A modified sequence. The m6A modification sites of circMYO9B were predicted by the online website SRAMP, and six sites where m6A modification may occur were found, namely circMYO9B-17, circMYO9B-77, circMYO9B-89, circMYO9B-202, circMYO9B-230 and circMYO9B-278. The two high-confidence m6A sequences marked in the figure are: circMYO9B-17 and circMYO9B-77. DETAILED DESCRIPTION
[0029] In the description of the present invention, it should be noted that, if the specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.
[0030] In an embodiment of the present invention, the process of obtaining several functional carriers is as follows:
[0031] 1) pEGFP-IGF2BP1 overexpression vector
[0032] Homologous primer design: Based on the mRNA CDS region sequence of the IGF2BP1 gene in the NCBI database (excluding the stop codon), homologous primers for IGF2BP1 were designed using the Vazyme online tool. The primer sequences are shown in Table 1.
[0033] Target fragment amplification: Use goat cDNA as template and use Max DNA Polymerase (Takara) was used as a high-fidelity enzyme for PCR amplification of the IGF2BP1 gene.
[0034] Vector linearization: Select Xho I and BamH I restriction endonucleases to linearize the pEGFP-N1 vector.
[0035] Purification of target fragment and vector: The amplified fragment of IGF2BP1 was extracted by gel electrophoresis, and the linearized pEGFP-N1 vector was purified.
[0036] Ligation: Use Vazyme's homologous recombination kit to carry out the ligation reaction between the target fragment and the linearized vector.
[0037] Transformation: The ligation product was transformed into E. coli competent cells (DH5-α), inoculated on LB solid medium containing antibiotics (Kana) by dilution plate spreading method, and grown at 37°C overnight.
[0038] Picking monoclonal colonies: Pick monoclonal colonies on the plate, inoculate them into LB liquid culture medium containing antibiotics (Kana), and culture at 37°C until the culture medium becomes turbid.
[0039] Bacterial liquid PCR: PCR amplification of the target fragment is performed using bacterial liquid as a template, and positive bacterial liquid is screened by gel electrophoresis.
[0040] Sequencing verification: The positive bacterial solution was subjected to Sanger sequencing (Sangon) identification, and after success, the bacterial solution was expanded and retained for seed.
[0041] Plasmid extraction: After expansion, the bacterial culture was used for plasmid extraction. The steps were based on the instructions for plasmid extraction (Omega).
[0042] 2) pCD5-circMYO9B overexpression vector
[0043] (1) Target fragment amplification: Primers for amplifying the full length of circMYO9B were designed based on the RNA-seq sequencing results. The forward primer was preceded by an ECORI restriction site and a TAATACTTTCAG sequence, and the reverse primer was preceded by a BamHI restriction site and an AGTTGTTCTTAC sequence. The primer sequences are shown in Table 1.
[0044] (2) Enzyme digestion and ligation: The vector used for circMYO9B overexpression was pCD5-ciR. The target fragment and pCD5-ciR vector were digested with BamHI and ECORI, respectively, at 37°C for 2 h. After digestion, the purified DNA was recovered by gel recovery and then ligated with T4 DNA ligase at 16°C overnight.
[0045] (3) Transformation: Pipette 5ul of ligation product and add 50ul of Trelief TM 5α competent cells, put on ice for 5 minutes, incubate at 42°C for 45 seconds, then put on ice for 2 minutes, add 500ul of liquid culture medium without antibiotics, mix well and pipette 100ul evenly onto a solid culture plate, place upright at 37°C for 1 hour, then invert and culture overnight.
[0046] Picking of monoclonal bacteria: On the second day, pick the monoclonal bacteria on the plate and place them in liquid culture medium containing AMP resistance. After culturing at 37°C and 200 rpm for 5 hours, send them to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After sequence identification, expand and extract plasmid DNA for subsequent experiments.
[0047] 3) pEGFP-METTL3 overexpression vector
[0048] Homologous primer design: Homologous primers were designed according to the sequence of the METTL3 gene, and the appropriate design scheme was selected in the Vazyme online tool. The primer sequences are shown in Table 1.
[0049] Target fragment amplification: Goat cDNA was used as a template to perform PCR amplification of the METTL3 gene.
[0050] Vector linearization: pEGFP-N1 vector was linearized using Xho I and BamH I.
[0051] Purification of target fragment and vector: Gel electrophoresis was performed to recover and purify the amplified METTL3 fragment and linearized vector.
[0052] Ligation: Use Vazyme's homologous recombination kit to connect the target fragment to the linearized vector.
[0053] Transformation: The ligation product was transformed into E. coli competent cells (DH5-α), inoculated on LB solid medium containing antibiotics (Kana) by dilution plate spreading method, and grown at 37°C overnight.
[0054] Picking monoclonal colonies: Pick monoclonal colonies on the plate, inoculate them into LB liquid culture medium containing antibiotics (Kana), and culture at 37°C until the culture medium becomes turbid.
[0055] Bacterial liquid PCR: PCR amplification of the target fragment is performed using bacterial liquid as a template, and positive bacterial liquid is screened by gel electrophoresis.
[0056] Sequencing verification: The positive bacterial solution was subjected to Sanger sequencing (Sangon) identification, and after success, the bacterial solution was expanded and retained for seed.
[0057] Plasmid extraction: After expansion, the bacterial culture was used for plasmid extraction. The steps were based on the instructions for plasmid extraction (Omega).
[0058] 4) pEGFP-FTO overexpression vector
[0059] Homologous primer design: Homologous primers were designed based on the sequence of the FTO gene on NCBI. Single-fragment cloning and double-enzyme linearized vectors were selected in the Vazyme online experimental tool to design homologous primers. The primer sequences are shown in Table 1.
[0060] Target fragment amplification: Use MuSCs cDNA as a template to perform PCR amplification of the FTO gene. Max DNA Polymerase (Takara) high-fidelity enzyme was used to amplify the target fragment with homologous primers. The reaction system and amplification procedure were referred to the instructions for the high-fidelity enzyme reagent.
[0061] Vector linearization: pEGFP-N1 vector was linearized using restriction endonucleases XhoⅠ and BamHI. The reaction was carried out according to the restriction endonuclease instructions.
[0062] Purification of target fragment and vector: The reaction products of the above two steps were subjected to gel electrophoresis, and the target band was cut out for gel recovery. The purification process was referred to the instructions of the gel recovery kit (Omega).
[0063] Ligation: Vazyme's homologous recombination kit was used to connect the FTO target fragment to the linearized vector.
[0064] Transformation: The ligation product was transformed into E. coli competent cells (DH5-α), inoculated on LB solid medium containing antibiotics (Kana) by dilution plate spreading method, and grown at 37°C overnight.
[0065] Picking monoclonal colonies: Pick monoclonal colonies on the plate, inoculate them into LB liquid culture medium containing antibiotics (Kana), and culture at 37°C until the culture medium becomes turbid.
[0066] Bacterial liquid PCR: PCR amplification of the target fragment is performed using bacterial liquid as a template, and positive bacterial liquid is screened by gel electrophoresis.
[0067] Sequencing verification: The positive bacterial solution was subjected to Sanger sequencing (Sangon) identification, and after success, the bacterial solution was expanded and retained for seed.
[0068] Plasmid extraction: After expansion, the bacterial culture was used for plasmid extraction. The steps were based on the instructions for plasmid extraction (Omega).
[0069] Table 1 Vector primer sequences
[0070]
[0071]
[0072] 5) Dual fluorescence vector: The dual luciferase vector used for promoter and enhancer activity verification is also constructed by homologous recombination. The Basic vector is used to verify promoter activity, and the Promoter vector is used to verify enhancer activity. When constructing the vector, the target fragment is a fragment containing different SNP sites, and the template is the DNA of Nanjiang yellow sheep of different genotypes. The linearization restriction sites of the two vectors are Kpn I and Xho I, and the resistance in LB medium is Amp. The dual fluorescence vector used for m6A modification site verification is psiCHECK2, which is synthesized by Qingke Bio. The dual fluorescence vector used for IRES activity verification is Luc2-IRES-Reporter (Jisai Bio).
[0073] 6) Translation function verification vector (circMYO9B-FLAG)
[0074] circMYO9B-FLAG is GATTACAAGGACGACGATGACAAG (SEQ ID NO.9) inserted before the stop codon of the predicted open reading frame sequence, and the sequence encodes the amino acid sequence DYKDDDDK (SEQ ID NO.10). The effect of m6A modification on translation was purchased from Guangzhou Jisai Biotechnology.
[0075] In an embodiment of the present invention, the cell transfection reagent is used 3000, the specific experimental operation was carried out strictly according to the instructions, the plasmid used for transfection was diluted with P3000 and Lip3000 respectively and incubated for 5 minutes, and then the two dilutions were mixed and incubated for 15 minutes before adding to the cell culture medium for transfection. The time of post-transfection treatment of cells was adjusted according to the experimental requirements. RNA extraction was performed using the Trizol method 48 hours after transfection, and the dual luciferase reporter assay was performed 36-72 hours after transfection.
[0076] In the embodiment of the present invention, the cell proliferation ability was detected using a cell proliferation kit CCK-8. The test was carried out according to the instructions, the cells were plated in a 96-well cell culture plate, and the cells were treated according to the test requirements. 10ul CCK-8 reagent was added to each well, and the absorbance was measured at 450nm using an ELISA instrument after incubation at 37°C in the dark for 1-4h. The results were plotted with the culture time as the ordinate and the OD value as the ordinate to draw a cell growth curve.
[0077] In an embodiment of the present invention, the primer information for RT-qPCR is shown in Table 1:
[0078] Table 2 Quantitative primer information
[0079]
[0080] Note: GAPDH is the internal reference gene.
[0081] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0082] Furthermore, the present invention divides the research contents corresponding to the above experimental process into the following five embodiments, and performs detailed result analysis in combination with the above experimental process.
[0083] Example 1
[0084] This example investigates the effect of goat IGF2BP1 gene on the proliferation and differentiation of MuSCs, as follows:
[0085] The goat tissues used in the experiment were collected from Chengdu Ma sheep, including the heart, liver, spleen, lung, kidney and longissimus dorsi muscle at 1 day after birth and the longissimus dorsi muscle at 45 days of embryonic period. All samples were stored at -80℃ after collection, and all operations were strictly in accordance with the Sichuan Agricultural University Experimental Animal Operation Specifications (Sichuan Agricultural University
[2014] No. 18). The method for isolating goat skeletal muscle satellite cells (MuSCs) used in the experiment is as follows: the collected longissimus dorsi muscle tissue blocks of newborn lambs were cut into pieces, and then digested for the first time with 0.1% type I collagenase and 0.1% type IⅠ collagenase, and then digested for the second time with 0.25% trypsin, and finally separated and purified MuSCs by centrifugation and differential adhesion method. The isolated goat skeletal muscle satellite (MuSCs) cells were identified, and the results of immunofluorescence tests of Pax7 and MYHC proteins showed that the isolated cells had a high Pax7 positive rate, and the cells could produce myotubes ( Figure 1 (A), indicating that it meets the characteristics of MuSCs and can be used for subsequent experiments. Successfully identified MuSCs cells were stored in liquid nitrogen for future use.
[0086] In order to confirm the role of IGF2BP1 in goat muscle development, IGF2BP1 in MuSCs at different stages (proliferation and differentiation) was overexpressed and interfered. Among them, overexpression was performed by RT-qPCR, and the primers used were shown in Table 1. ChamQ SYBR qPCR Master Mix (Vazyme) was used for RT-qPCR experiments. The reaction used a 10ul system, ChamQSYBR qPCR Master Mix 5ul, upstream primer 0.4ul, downstream primer 0.4ul, cDNA 0.8ul, ddH 2 O 3.4ul. Amplification program: 95℃2min; 95℃5s, Tm 10s, 39cycles, 65℃~95℃, 0.5℃ / 30s. The results were based on 2 -ΔΔCt Methods The relative expression levels of genes were calculated. RT-qPCR results showed that overexpression of IGF2BP1 (pEGFP-IGF2BP1) during the proliferation period significantly increased the expression of MuSCs marker gene Pax7 and proliferation marker genes PCNA and mki67 (p<0.01)( Figure 1 (middle B).
[0087] The interfering siRNA was designed and synthesized by Ruibo Biotechnology, and the sequence is as follows: siIGF2BP1: CTTTATGCAGGCTCCAGAG (SEQ ID NO.34). RNA was extracted using the conventional Trizol method, and RNAiso Plus (Takara) lysis buffer was used, and RNA reverse transcription kit (Vazyme) was used for RNA reverse transcription. The experimental results showed that interfering IGF2BP1 (siIGF2BP1) reduced the expression of PCAN and mki67 (p < 0.01) ( Figure 1 Middle C). During the differentiation period, overexpression of IGF2BP1 increased the expression of MYOD and MYHC, but the difference was not significant (p>0.05) ( Figure 1 Interference with IGF2BP1 (siIGF2BP1) led to a significant decrease in the expression of the muscle differentiation marker genes MYOD and MYOG (p<0.05 or p<0.01) ( Figure 1 Middle E). In summary, IGF2BP1 can promote the proliferation and differentiation of goat MuSCs.
[0088] Example 2
[0089] This example investigates the role of IGF2BP1 in recognizing m6A-circMYO9B and promoting the proliferation of MuSCs
[0090] IGF2BP1 was overexpressed in goat MuSCs. After RNA-seq data analysis, 49 circRNAs were differentially expressed. Through the prediction of their m6A modification, coding potential and IGF2BP1 binding, one of the new circRNAs, circMYO9B, had three characteristics: Figure 2 (A), suggesting that it is an m6A-circRNA that can bind to IGF2BP1. Therefore, the related functions were further analyzed in goat muscle cells.
[0091] (1) Effect of circMYO9B on the proliferation of goat MuSCs
[0092] RT-qPCR was used to detect the expression patterns of IGF2BP1 and circMYO9B during the proliferation and differentiation of MuSCs. The results showed that the expression patterns of IGF2BP1 and circMYO9B were consistent, and the expression levels of both gradually decreased during the proliferation period, and were higher in the early differentiation period (DM-1) and the late differentiation period (DM-7). Figure 2 D and E). Spearman correlation coefficient analysis showed that ρ = 0.6161, p = 0.0065, indicating that IGF2BP1 and circMYO9B were positively correlated. Sanger sequencing results showed that circMYO9B originated from exons 6, 7, and 8 of the MYO9B gene, with a total length of 342 bp ( Figure 2The heart, liver, spleen, lung, kidney and longissimus dorsi muscle tissues of Chengdu Ma sheep were selected for RT-qPCR detection 1 day after birth. The results showed that circMYO9B was expressed at a high level in spleen and lung, a medium level in liver and kidney, and a low level in heart and longissimus dorsi muscle ( Figure 2 Middle C).
[0093] circMYO9B was overexpressed during the proliferation stage of MuSCs to explore the effect of circMYO9B on the proliferation of goat MuSCs. RT-qPCR results showed that overexpression of circMYO9B (pCD5-circMYO9B) could significantly increase the expression of circMYO9B ( Figure 2 Middle F). Overexpression of circMYO9B (pCD5-circMYO9B) can significantly increase the expression of MuSCs marker gene Pax7 (p<0.05) and proliferation marker gene PCNA (p<0.01) ( Figure 2 Middle G). The results of CCK-8 assay showed that compared with the NC group (pCD5-ciR), overexpression of circMYO9B (pCD5-circMYO9B) significantly increased the number of cells at 48H and 72H of MuSCs proliferation period (p<0.05) ( Figure 2 These results indicate that circMYO9B can promote the proliferation of goat MuSCs.
[0094] (2) circMYO9B m6A modification level
[0095] The m6A modification sites of circMYO9B were predicted by the online website SRAMP, and it was found that there were six sites of circMYO9B that might undergo m6A modification, namely circMYO9B-17, circMYO9B-77, circMYO9B-89, circMYO9B-202, circMYO9B-230 and circMYO9B-278, of which two sites had higher confidence, circMYO9B-17, circMYO9B-77 ( Figure 3 Subsequently, the longissimus dorsi muscle of Chengdu Ma sheep at embryonic stage 45D was used as the material to enrich the RNA fragments containing m6A modification by MeRIP-PCR. The results showed that compared with the control group (IgG), the circMYO9B fragment was significantly enriched on the m6A antibody (p<0.05), indicating that circMYO9B was modified by m6A methylation ( Figure 3 (middle B).
[0096] Among them, MeRIP-PCR was performed according to the instructions using Magna MeRIP TMm6A RNA was enriched using m6A Kit (Sigma-Aldrich). The enriched RNA was purified using RNeasy mini kit (Qiagen, Hilden, Germany), and finally, circMYO9B m6A levels were quantified by RT-qPCR. The m6A modification level was quantified by using EpiQuik m6A RNA methylation quantification kit (Epigentek, NY, USA) to detect the overall m6A level of total RNA. The experimental steps were carried out according to the instructions. After the reaction was terminated, the OD value at 450nm was read using VARIOSKAN LUX (Thermo-Fisher Scientific), and the m6A modification level in the well was calculated using the OD value using the standard curve.
[0097] The methyltransferase METTL3 and demethylase FTO in MuSCs were overexpressed or interfered to clarify the effect of m6A modification on circMYO9B. RT-qPCR was used for overexpression, and the primers used were shown in Table 1. The operation was the same as in Example 1. The interference siRNA was designed and synthesized by Ruibo Bio, and the sequence is shown in Table 3 below. The results showed that overexpression of METTL3 (pEGFP-METTL3) could significantly increase the expression level of circMYO9B (p<0.01) ( Figure 3 Middle C), after interfering with MTEEL3 (siMETTL3), the enrichment of circMYO9B on m6A antibody showed a decreasing trend, but the difference was not significant (p>0.05) ( Figure 3 Interference with FTO (siFTO) can significantly increase the expression level of circMYO9B (p<0.05) ( Figure 3 D), and MeRIP-PCR detection showed that the enrichment of circMYO9B on mAb was significantly increased (p<0.05) ( Figure 3 (F), indicating that interfering with FTO can increase the methylation level of circMYO9B.
[0098] Table 3 siMETTL3, siFTO, siCtrl sequences
[0099]
[0100] Note: SiCtrl is a negative control, a control group without target interfering substances, used to exclude non-specific effects.
[0101] In addition, MuSCs cells were cultured and maintained in appropriate culture medium to 60%-80% confluence. Then, FB23-2 was dissolved in DMSO, diluted to the desired working concentration (e.g., 5 μM), and added to the cell culture for 24 to 48 hours. After treatment, total RNA was extracted by TRIzol reagent, and the m6A modification level was detected using MeRIP-qPCR, and the m6A-modified circMYO9B was enriched by specific antibodies, followed by qPCR quantitative analysis. In addition, the expression of FTO and related proteins (such as IGF2BP1) was analyzed by Western blot to verify the inhibitory effect of FB23-2 on FTO. All experiments were set up with a solvent control group (only DMSO was added), and at least three biological replicates were performed to ensure the reliability of the data. Finally, the differences in circMYO9B m6A modification levels between the FB23-2-treated group and the control group were compared by statistical analysis. The results showed that the m6A modification level of circMYO9B was detected using the FTO demethylase activity inhibitor (FB23-2). After adding FB23-2 to MuSCs, the overall m6A modification level was significantly increased (p<0.01), consistent with the interference FTO group (siFTO) ( Figure 3 G and H), and the enrichment of circMYO9B fragments on mAb was significantly increased (p < 0.05) ( Figure 3 I), indicating that the regulation of FTO on circMYO9B depends on its demethylase activity. Then, the wild-type (WT) and mutant (MUT) fragments containing the m6A modification site (Table 4) were inserted into the dual luciferase reporter vector (psiCHECK-2) ( Figure 3 Middle J). After interfering with FTO, the dual luciferase reporter vector was transfected into MuSCs. The results showed that interfering with FTO (siFTO) significantly increased the luciferase activity of the wild-type vector (WT) (p<0.05), but had no significant effect on the fluorescence activity of the mutant vector (MUT) (p>0.05) ( Figure 3 Middle K), indicating that after the circMYO9B fragment lost the m6A modification, the regulatory effect of FTO on it disappeared.
[0102] In summary, the expression level of circMYO9B is related to its m6A modification, and FTO regulates the expression of circMYO9B through the m6A pathway.
[0103] Table 4 Wild-type (WT) and mutant (MUT) fragments
[0104]
[0105] (3) IGF2BP1 recognizes circMYO9B through m6A to maintain its stability
[0106] To predict the interaction between circMYO9B and IGF2BP1, we used the RBPsuite online tool and selected a specific model for analysis. The results showed that when the predicted binding score of an RNA sequence was greater than 0.5, it indicated that the sequence may have a strong binding potential with the target RBP ( Figure 4 Middle A). The results of MeRIP-qPCR test showed that the circMYO9B fragment was significantly enriched on the IGF2BP1 antibody (p<0.01) ( Figure 4 B), indicating that IGF2BP1 can bind to circMYO9B; then, IGF2BP1 in MuSCs was overexpressed and interfered, respectively, using the same method as in Example 1, and transfected with a dual luciferase reporter vector (psiCHECK2) containing an m6A modification site. The results showed that overexpression of IGF2BP1 (pEGFP-IGF2BP1) significantly increased the fluorescence activity of the wild type (WT) (p<0.05), but did not affect the fluorescence activity of the mutant (MUT) ( Figure 4 Correspondingly, interference with IGF2BP1 (siIGF2BP1) significantly reduced the fluorescence activity of the wild type (WT) (p<0.01), but had no effect on the fluorescence activity of the mutant (MUT) ( Figure 4 In summary, IGF2BP1 is a methyl reader protein that can recognize circMYO9B and regulate the expression of circMYO9B through the m6A pathway.
[0107] In this regard, IGF2BP1 was overexpressed and interfered in MuSCs, respectively, using the same method as in Example 1, and actinomycin D (ACTD) was used to treat the cells (0H, 1H, 2H and 4H). The results showed that the expression level of circMYO9B in the IGF2BP1 overexpression group (pEGFP-IGF2BP1) was higher than that in the control group (pEGFP-N1) ( Figure 4 E), but the difference was not significant. The expression level of circMYO9B in the IGF2BP1 interference group (siIGF2BP1) was significantly lower than that in the control group (siCrtl) at 3H, 4H and 6H (p<0.01) ( Figure 4 (F), indicating that interfering with IGF2BP1 significantly reduced the stability of circMYO9B.
[0108] IGF2BP1 recognizes circMYO9B through the m6A pathway, so the m6A modification level of circMYO9B should affect its stability. The m6A modification level of circMYO9B in MuSCs was increased by interfering with FTO and adding the FTO inhibitor FB23-2, and actinomycin D (ACTD) was used to study the changes in the mRNA level of circMYO9B at different time points. The experimental design included multiple treatment groups: FTO interference group, FB23-2 treatment group and control group. First, by interfering with FTO by siRNA and adding the FB23-2 inhibitor, the demethylation activity of FTO was increased, thereby increasing the m6A modification level of circMYO9B. Then, MuSCs were treated with ACTD, and cell samples were collected at different time points (0 hours, 1 hour, 2 hours and 4 hours). ACTD promotes the degradation of circMYO9B by inhibiting transcription, helping us observe the stability of circMYO9B.
[0109] Subsequently, the expression level of circMYO9B at each time point was quantitatively determined by qRT-PCR technology, and the degradation rate of circMYO9B between different experimental groups was analyzed. By comparing the differences between the FTO interference group, the FB23-2 treatment group and the control group, we can further reveal how the m6A modification level of circMYO9B affects its stability. The results showed that the expression level of circMYO9B in the FTO interference group (siFTO) was higher than that in the control group (siCtrl) ( Figure 4 The expression level of circMYO9B in the FTO demethylase activity inhibitor group (FB23-2) was significantly lower than that in the control group (siCrtl) at 1 h (p<0.05) ( Figure 4 Middle H).
[0110] IGF2BP1 may affect the development of muscle cells by recognizing m6A-modified circMYO9B and stabilizing its expression. At the same time, FTO, as an m6A demethylase, can regulate this process by removing m6A modifications ( Figure 5 ). In summary, the increase in the level of m6A modification increases the stability of circMYO9B. From a mechanistic perspective, IGF2BP1 maintains the stability of circMYO9B by recognizing the m6A modification of circMYO9B.
[0111] (4) circMYO9B functions through encoding proteins
[0112] circMYO9B has coding potential and may promote goat muscle cell proliferation by encoding proteins. To verify its coding potential, the ORF Finder NCBI online website was used to predict its open reading frame, and the results showed that circMYO9B contained an open reading frame (ORF) ( Figure 6 The open reading frame starts translation from the 19th base (ATG) of the full length of circMYO9B and terminates translation at the end of the full length, containing 107 amino acids. In order to prove that circMYO9B contains an IRES site required for the initiation of independent coding RNA translation, IRESfinder prediction revealed that there may be three fragments in circMYO9B with IRES activity ( Figure 6 A, and Table 5).
[0113] Table 5 Three active IRES fragments
[0114]
[0115]
[0116] The three fragments and the full-length sequence of circMYO9B were inserted into the Luc2-IRES-Reporter vector to construct a dual luciferase reporter vector ( Figure 6 C) and stained it into MuScs. The results showed that the luciferase activity of the dual fluorescent vector (Luc2-IRES-0) containing the full-length sequence of circMYO9B and the dual fluorescent vector (Luc2-IRES-1) containing the first fragment was significantly increased (p<0.05 or p<0.01), while the luciferase activity of the dual fluorescent vectors (Luc2-IRES-2 and Luc2-IRES-3) containing the other two fragments did not change compared with the control group (Luc2-IRES-Reporter). The results show that circMYO9B contains a sequence with IRES activity and is located in Fragement 1.
[0117] To identify potential circMYO9B proteins, we inserted a FLAG sequence before the stop codon of the predicted open reading frame of circMYO9B and constructed an overexpression vector (circMYO9B-FLAG) with this sequence ( Figure 6 Middle D). After transfection of circMYO9B-FLAG in goat MuSCs, FLAG immunofluorescence assay was performed, and red fluorescence was observed in the FLAG group ( Figure 6 Middle E), indicating that the cells contain FLAG-tagged protein, that is, circMYO9B can encode protein.
[0118] In order to explore the effect of m6A modification of circMYO9B on its translation, a circRNA translation vector was used, which contains CMV promoter and SV40 PA signal, and these two elements work together to drive the efficient expression of the target gene. Then, the linear DNA molecule is treated with specific restriction sites to connect its two ends to form a stable circular structure.
[0119] To investigate the potential effects of m6A methylation on circRNA properties, four DNA sequence variants (e.g. Figure 6 (F) Sequence 0 represents the unchanged original sequence, while sequences 1 to 4 introduce point mutations at key positions to simulate the m6A methylation status or explore its effect on circRNA function.
[0120] The m6A modification sites of circMYO9B were predicted by the online website SRAMP, and six sites where m6A modification may occur were found, namely circMYO9B-17, circMYO9B-77, circMYO9B-89, circMYO9B-202, circMYO9B-230 and circMYO9B-278. The two m6A modification sites with the highest confidence were circMYO9B-17 and circMYO9B-77. Figure 7 In the figure, the blue part indicates the m6A modification site. The A under the arrow indicates the sequence number.
[0121] In addition, PCR technology was used to verify the correctness of circRNA construction. By designing specific primers, specific regions of circRNA can be amplified to ensure the success of the cyclization process and the accurate formation of circRNA. The process of circular RNA construction from vector construction to sequence variation analysis and final verification is systematically demonstrated, providing a molecular biological method for studying the role of m6A methylation in circRNA ( Figure 6 F), the two most confident m6A motifs of circMYO9B, circMYO9B-17 and circMYO9B-77, were inserted into the vector and transfected into MuSCs. The results showed that when there was only one m6A modification (m6A-1), the coding signal of GFP in the vector was significantly enhanced (p<0.05); when the first m6A modification was directly removed (m6A-2), its coding signal was significantly reduced (p<0.05); when there were two m6A modifications (m6A-3), its coding signal was significantly increased compared with the unmodified fragment (m6A-0) (p<0.05), but the difference was not significant with the fragment with one modification (m6A-1); when the modification site was mutated instead of directly removed (m6A-4), its coding signal was consistent with the unmodified fragment (m6A-0) ( Figure 6 These results indicate that the m6A modification on circMYO9B can significantly enhance its coding signal. After the m6A modification is removed, its coding signal decreases, and the effect of m6A modification on the coding signal is independent of the amount of modification.
[0122] In summary, circMYO9B has coding potential, can be translated through the IRES pathway, and its translation process is regulated by m6A modification. However, the protein produced by its translation needs further identification, and the function of this protein also needs further study.
[0123] Although the embodiments of the present invention have been shown and described, it is understood that a person of ordinary skill in the art may make various changes, modifications, substitutions and variations to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the attached claims and their equivalents. The above-described embodiments only express several implementation methods of the present invention, and their descriptions are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that a person of ordinary skill in the art may make several variations and improvements without departing from the concept of the present invention, and these all belong to the scope of protection of the present invention. Therefore, the scope of protection of the patent of the present invention shall be based on the attached claims.
Claims
1. Application of IGF2BP1 gene in the preparation of products for promoting proliferation and differentiation of goat skeletal muscle satellite cells or products for promoting muscle development in goats.
2. The use according to claim 1, characterized in that: The IGF2BP1 gene promotes the proliferation and differentiation of goat skeletal muscle satellite cells or promotes goat muscle development by recognizing circMYO9B in goat skeletal muscle satellite cells.
3. Use of reagents that enhance or promote IGF2BP1 gene expression in the preparation of products that promote the proliferation and differentiation of goat skeletal muscle satellite cells or products that promote goat muscle development.
4. Application of reagents that enhance or promote the expression of circMYO9B gene in the preparation of products that promote the proliferation and differentiation of goat skeletal muscle satellite cells or products that promote goat muscle development.
5. Application of circMYO9B gene in the preparation of products for promoting proliferation and differentiation of goat skeletal muscle satellite cells or products for promoting muscle development in goats.
6. The use according to claim 5, characterized in that: The upstream regulatory genes of the circMYO9B gene are METTL3 and FTO; the circMYO9B gene has an m6A methylation modification site, and the m6A methylation modification level of the circMYO9B gene is promoted by overexpressing the METTL3 gene and / or interfering with the FTO gene, thereby promoting the proliferation and differentiation of goat skeletal muscle satellite cells, or promoting goat muscle development; preferably, the m6A methylation modification sites are circMYO9B-17 and circMYO9B-77.
7. The use according to claim 6, characterized in that: The method of overexpressing the METTL3 gene includes: designing primers and amplifying the target gene, and then connecting it with an overexpression vector and transforming it; and / or, interfering with the FTO gene includes designing interfering siRNA or using a demethylase activity inhibitor.
8. Use of METTL3 gene and / or FTO gene in the preparation of products for promoting proliferation and differentiation of goat skeletal muscle satellite cells or products for promoting muscle development in goats.
9. Use of an agent for enhancing or promoting the expression of the METTL3 gene in the preparation of a product for promoting the proliferation and differentiation of goat skeletal muscle satellite cells or a product for promoting goat muscle development.
10. Use of an agent for reducing or inhibiting the expression of the FTO gene in the preparation of a product for promoting the proliferation and differentiation of goat skeletal muscle satellite cells or a product for promoting goat muscle development.
Citation Information
Patent Citations
Method of cloning goat IGFBP3 gene cDNA coding sequence
CN104293766A
CircRNA related to sheep skeletal muscle development and application thereof
CN113308553A
CircRNA related to goat myoblast proliferation and differentiation and application thereof
CN114292850A
Application of MYO9B inhibitor in preparation of medicine for preventing and / or treating individual fibrosis diseases
CN116036280A