ImGS light respiratory metabolism modification branch and application thereof in C3 plants

Abstract

The invention discloses an imGS light respiratory metabolism modification branch and an application of the imGS light respiratory metabolism modification branch in C3 plants, and two fusion proteins forming the imGS light respiratory metabolism modification branch comprise GDCHTP-GSMT and GDCHTP-SDMT. The branch is further introduced into a C3 plant, and the transgenic imGS light respiratory metabolism branch plant shows that the betaine content, the photosynthetic rate and the grain number per spike are improved. The method has great application value and significance in deeply illuminating the high photosynthetic efficiency mechanism of the rice, reducing the photorespiration carbon loss of the rice, improving the stress resistance and the stress photosynthetic capacity of the rice and the like, and in practical application, the metabolic branch can be transferred into different C3 plants to cultivate ideal varieties with higher yield; the imGS branch has wide application and market prospects in the agricultural field.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and more specifically, relates to an imGS photorespiration metabolic transformation branch and its application in C3 plants. Background Art

[0002] Photorespiration is the process by which plants absorb oxygen, consume organic matter and release carbon dioxide under light. It is the second largest metabolic flow in plants. Both photorespiration and photosynthesis originate from the catalytic action of 1,5-bisphosphate ribulose carboxylase (Rubisco). The latter catalyzes one molecule of RuBP to synthesize two molecules of 3-phosphoglyceric acid under the carboxylation activity of Rubisco; while the former catalyzes two molecules of 1,5-bisphosphate ribulose (RuBP) to generate two molecules of 3-phosphoglyceric acid and two molecules of phosphoglycolic acid under the oxygenation activity of Rubisco. The two molecules of phosphoglycolic acid undergo a series of catalytic reactions and finally generate one molecule of 3-phosphoglyceric acid and CO. 2 , the generated CO 2 It will be released into the atmosphere, causing a large amount of carbon loss. Existing studies have shown that photorespiration of C3 plants such as rice can consume 20-30% of the photosynthetic products of the plants themselves under normal conditions. Under adverse conditions such as high temperature and drought, this consumption can even reach 50%, greatly reducing the net photosynthetic efficiency and yield of the plants.

[0003] Based on the above reasons, scientists have proposed an optimization strategy to construct a photorespiratory metabolic branch in C3 plants to reduce photorespiratory carbon loss and thus improve photosynthetic efficiency. The researchers first successfully constructed a pathway similar to that of cyanobacteria C in Arabidopsis thaliana chloroplasts. 2 The glycolate metabolic branch of the cycle diverts photorespiratory glycolate and converts it directly to glycerate and CO in chloroplasts. 2 It then flows back into photosynthesis, successfully increasing the biomass and yield of Arabidopsis thaliana. Later, some scientists introduced this branch into flax mustard, effectively increasing its grain yield. In the past decade, researchers have successively created photorespiratory branches such as rice GOC, which have increased the photosynthesis and yield of crops to varying degrees. At the same time, it has further confirmed that reducing photorespiratory metabolism by constructing photorespiratory branches can effectively improve plant photosynthetic efficiency.

[0004] The carbon loss caused by photorespiration mainly comes from the photorespiratory glycine decarboxylation reaction in mitochondria. 2It is difficult for the plant to re-fix it in time, resulting in a large loss of photosynthetic carbon; and the photorespiratory glycine in the mitochondria can rarely be diverted to other metabolic processes, and most of it can only be metabolized through the decarboxylation reaction of photorespiration. The existing photorespiratory branches that can effectively improve the photosynthetic efficiency of C3 plants all start from the diversion of photorespiratory glycolate, and there is no report on the photorespiratory branch that can optimize and transform other metabolic links of photorespiration and effectively improve the photosynthetic efficiency of C3 plants.

[0005] Faced with an increasingly severe living environment, a common defense mechanism in plants to cope with abiotic stress is to produce and accumulate osmotic substances, including amino acids (mainly proline), amines (such as glycine betaine and polyamines) and sugars (such as trehalose and sugar alcohols), all of which are easily soluble in water and non-toxic at high concentrations. Among them, glycine betaine, whether applied in vitro or synthesized in vivo, can significantly improve the resistance of crops to adversities such as drought and salt stress. It is now known that the in vivo synthesis of glycine betaine mainly includes the choline oxidation pathway and the glycine methylation pathway. The latter uses glycine as a substrate and uses glycine sarcosine methyltransferase (GSMT) and sarcosine dimethylglycine methyltransferase (SDMT) to methylate glycine twice to obtain glycine betaine. Previously, researchers have attempted to introduce GSMT and SDMT into the plant cytoplasm and synthesize betaine using cytoplasmic glycine, which has successfully improved the plant's resistance to various abiotic stresses (Song J, Zhang R, Yue D, et al. Co-expression of ApGSMT2g and ApDMT2g in cotton enhances salt tolerance and increases seed cotton yield in saline fields [J]. Plant Science, 2018, 274: 369-382). The synthesis pathway uses the glycine pool in the cytoplasm and does not include photorespiratory glycine in mitochondria. Therefore, it is of great significance to transform the photorespiration branch, divert glycine in photorespiration for betaine synthesis, and provide a photorespiration metabolic transformation branch that can improve plant stress resistance and effectively improve plant photosynthetic efficiency. Summary of the invention

[0006] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide an imGS photorespiration metabolic transformation branch and its application in C3 plants.

[0007] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0008] The present invention firstly provides an imGS photorespiration metabolic transformation branch, which comprises GSMT and SDMT proteins.

[0009] Furthermore, the two fusion proteins constituting the imGS photorespiration metabolic transformation branch include GDCH TP -GSMT and GDCH TP -SDMT.

[0010] The imGS is based on the glycine metabolism link of photorespiration in mitochondria for branch modification. In order to locate the above two proteins in plant mitochondria, the rice mitochondrial signal peptide GDCH is fused to the N-terminus of the above proteins. TP , thus forming GDCH TP -GSMT and GDCH TP -SDMT fusion protein. The imGS photorespiration metabolic transformation branch can divert photorespiration glycine for the synthesis of betaine, which can not only improve the stress resistance of plants but also effectively reduce the loss of photorespiration carbon and improve the net photosynthetic efficiency of plants. At the same time, the branch is a light-induced photorespiration metabolic transformation branch. The rate of photorespiration is often the highest under adverse conditions such as high light and high temperature. The photorespiration branch is driven by an inducible promoter so that the enzyme of the photorespiration branch is appropriately expressed under different conditions, thereby reasonably diverting the photorespiration metabolism and improving the efficiency of the photorespiration branch.

[0011] Furthermore, the GDCH TP -GSMT fusion protein has an amino acid sequence as shown in SEQ ID No.3, or a sequence in which one or more amino acids are replaced, deleted or added and has the same function as the sequence shown in SEQ ID No.3; said GDCH TP The amino acid sequence of the SDMT fusion protein is as shown in SEQ ID No.6, or a sequence in which one or more amino acids are replaced, deleted or added and the function is the same as that of the sequence shown in SEQ ID No.6.

[0012] Furthermore, the GDCH TP The nucleotide sequence of the gene encoding the GDCH-GSMT fusion protein is preferably as shown in SEQ ID No. 1. Or it can hybridize with SEQ ID No. 1 under stringent conditions and encode the above-mentioned GDCH TP -GSMT fusion protein DNA molecule, the stringent conditions may be hybridization at 65°C in a 6×SSC, 0.5% SDS solution, followed by washing the hybridization membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS, or having more than 90% homology (preferably more than 95% homology) with the sequence of SEQ ID No.1 and encoding the above-mentioned GDCH TP -GSMT fusion protein DNA molecule; the GDCH TPThe nucleotide sequence of the gene encoding the GDCH-SDMT fusion protein is preferably as shown in SEQ ID No. 4. Or it can hybridize with SEQ ID No. 4 under stringent conditions and encode the above-mentioned GDCH TP -SDMT fusion protein DNA molecule, the stringent conditions may be hybridization in a 6×SSC, 0.5% SDS solution at 65°C, followed by washing the hybridization membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS, or having more than 90% homology (preferably more than 95% homology) with the sequence of SEQ ID No. 4, and encoding the above-mentioned GDCH TP -SDMT fusion protein DNA molecule.

[0013] Furthermore, the GDCH TP -GSMT fusion protein encoding gene expression cassette is Prca-GDCH TP -GSMT-T nos The nucleotide sequence of the expression cassette gene is preferably as shown in SEQ ID No. 2, or a DNA molecule that can hybridize with SEQ ID No. 2 under stringent conditions, wherein the stringent conditions can be hybridization in a solution of 6×SSC, 0.5% SDS at 65° C., and then washing the hybridization membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS, or a sequence that has more than 90% homology (preferably more than 95% homology) with the sequence of SEQ ID No. 2; the GDCH TP -The expression cassette of the gene encoding the SDMT fusion protein is Pcab-GDCH TP -SDMT-T 35S The nucleotide sequence of the expression cassette gene is preferably as shown in SEQ ID No.5, or a DNA molecule that can hybridize with SEQ ID No.5 under stringent conditions, wherein the stringent conditions can be hybridization in a solution of 6×SSC, 0.5% SDS at 65°C, and then washing the hybridization membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS, or a sequence that has more than 90% homology (preferably more than 95% homology) with the sequence of SEQ ID No.5.

[0014] The present invention also provides an expression vector capable of introducing the imGS photorespiration metabolic transformation branch into plants, which is composed of the above-mentioned GDCH TP -GSMT and GDCH TP The gene expression cassette encoding the -SDMT fusion protein is constructed by inserting into the multiple cloning site of a plant expression vector or by recombination.

[0015] Furthermore, the expression vector can be processed to facilitate identification and screening of transgenic plant cells or plants. The processing can be to express enzymes that can produce color changes or genes of luminescent compounds, antibiotic resistance markers or chemical resistance marker genes in plants.

[0016] Preferably, the gene of the luminescent compound includes GUS gene, luciferase gene and the like.

[0017] Preferably, the antibiotic resistance markers include gentamicin marker, kanamycin marker, hygromycin marker and the like.

[0018] Preferably, the chemical resistance marker gene includes a herbicide resistance gene and the like.

[0019] Preferably, the expression vector is pOx or other derived plant expression vectors.

[0020] Preferably, the plant expression vector comprises pCAMBIA3301, pCAMBIA1300, pCAMBIA2301 or pBI12.

[0021] The present invention introduces the imGS photorespiration metabolic transformation branch into rice to obtain transgenic rice with obvious phenotypes. Compared with the wild type, the transgenic rice shows increased betaine content, photosynthetic rate and number of grains per ear.

[0022] Therefore, the present invention provides the use of the imGS photorespiration metabolic modification branch in preparing transgenic plants with enhanced stress resistance, increased photosynthetic rate and increased yield.

[0023] The present invention also provides a method for preparing transgenic plants, which comprises transforming an expression vector carrying the imGS photorespiration metabolic transformation branch into plant cells or tissues, and then cultivating the transformed cells or tissues into plants.

[0024] Furthermore, the transformation can be carried out into plant cells or tissues through conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc.

[0025] Furthermore, the transformed plant may be rice or other crops.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention provides an imGS photorespiration metabolic transformation branch and its application in C3 plants, and two fusion proteins constituting the imGS photorespiration metabolic transformation branch include GDCH TP -GSMT and GDCH TP-SDMT. The branch is further introduced into C3 plants, and the plants transformed with imGS photorespiration metabolic branch show increased betaine content, photosynthetic rate and number of grains per ear. In practical applications, the metabolic branch can be transferred into different C3 plants to cultivate ideal varieties with enhanced stress resistance and higher yield. The present invention has great application value and significance in further clarifying the mechanism of high photosynthesis efficiency of rice, reducing carbon loss in rice photorespiration, and improving rice stress resistance and photosynthetic capacity under adverse conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the core part of the pOx carrier; 35S is the cauliflower mosaic virus 35S enhanced promoter; T 35S is the 35S terminator of cauliflower mosaic virus; Pubi is the promoter of maize ubiquitin gene; Tnos is the nos terminator; MCS is the multiple cloning site; HPT is the hygromycin resistance gene; LB is the left border; and RB is the right border.

[0029] Figure 2 is the core part of the imGS-pOX vector; 35S is the cauliflower mosaic virus 35S enhanced promoter; T 35S is the cauliflower mosaic virus 35S terminator; Pcab is the chlorophyll a / b binding protein gene promoter; Prca is the Rubisco activating enzyme gene promoter; Tnos is the nos terminator; HPT is the hygromycin resistance gene; LB is the left border; RB is the right border.

[0030] Figure 3 Western Blotting detection of imGS-pOx transgenic plants; WT is the wild type; GS14, GS20 and GS24 are GS-pOx transgenic lines.

[0031] Figure 4 Phenotypic observation of imGS-pOx transgenic plants at the grain filling stage; WT is the wild type; GS14, GS20 and GS24 are GS-pOx transgenic lines.

[0032] Figure 5 The figure shows the determination of betaine content in imGS-pOx transgenic plants; WT is the wild type; GS14, GS20 and GS24 are GS-pOx transgenic lines.

[0033] Figure 6 The net photosynthetic rate of imGS-pOx transgenic plants was measured; WT is the wild type; GS14, GS20 and GS24 are GS-pOx transgenic lines.

[0034] Figure 7The figure shows the determination of grain number per ear in imGS-pOx transgenic plants; WT is the wild type; GS14, GS20 and GS24 are GS-pOx transgenic lines. DETAILED DESCRIPTION

[0035] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0036] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0037] The primer synthesis and sequencing work used in the present invention were completed by Sangon Biotechnology (Shanghai) Co., Ltd.

[0038] Example 1 GDCH TP -GSMT and GDCH TP -Acquisition of SDMT fusion protein expression gene

[0039] (1)GDCH TP -Obtaining the GSMT fusion protein expression gene

[0040] According to the information provided by NCBI (http: / / www.ncbi.nlm.nih.gov / ) on ApGSMT and GDCH TP The primers were designed based on the cDNA sequence. The primer sequences are as follows:

[0041] ApGSMT-F:5'-TCAATCTCCAGATACTTCATGGCCATCAAAGAGAAG-3'

[0042] ApGSMT-R:5'-CTA CTTGTCGTCGTCGTCCTTGTAGTC GTCCTTCTTGGCCACGTG-3' (the underlined part is the FLAG tag sequence).

[0043] GDCH TP -1F:5'-ATGGCTCTGAGGCTGTGGGCTAGC-3'

[0044] GDCH TP -1R:5'-CTTCCTTTGATGGCCATGAAGTATCTGGAGATTGA-3'

[0045] The plasmid containing the ApGSMT gene synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. was used as a template. Primers ApGSMT-F and ApGSMT-R, primer GDCH TP -1F and GDCHTP -1R was used to guide the amplification of ApGSMT and GDCH using conventional methods. TP After the reaction, the PCR amplification product was subjected to 1% agarose gel electrophoresis to recover and purify ApGSMT (about 800 bp) and GDCH TP The recovered fragments were connected with recombinase and used as templates in the presence of primers GDCH TP -1F and ApGSMT-R were used to guide the second round of PCR amplification. After the reaction was completed, the amplified product was subjected to 1% agarose gel electrophoresis to recover and purify GDCH TP -ApGSMT DNA fragment (about 900 bp) was cloned into the pMD18-T vector (purchased from TAKARA) to obtain pMD18-GDCH TP -ApGSMT vector was sent to Guangzhou Ruibo Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the sequence of the DNA fragment was as shown in SEQ ID No.1; and the protein shown in SEQ ID No.3 in the coding sequence table was obtained.

[0046] (2)GDCH TP -Obtaining the ApSDMT fusion protein expression gene

[0047] According to the information provided by NCBI (http: / / www.ncbi.nlm.nih.gov / ) on ApSDMT and GDCH TP The primers were designed based on the cDNA sequence. The primer sequences are as follows:

[0048] ApSDMT-F:5'-TCAATCTCCAGATACTTCATGACAAAGGCCGATGCC-3'

[0049] ApSDMT-R:5'-CTA GGCGTAATCCGGGACGTCGTACGGATA CGGCTTGTGGAACTTG-3' (the underlined part is the HA tag sequence).

[0050] GDCH TP -2R:5'-GGCATCGGCCTTTGTCATGAAGTATCTGGAGATTGA-3'

[0051] The plasmid containing the ApSDMT gene synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. was used as a template. Primers ApSDMT-F and ApSDMT-R, primer GDCH TP -1F and GDCH TP -2R was used to guide the amplification of ApSDMT and GDCH using conventional methods. TPAfter the reaction, the PCR amplification products were subjected to 1% agarose gel electrophoresis to recover and purify ApSDMT (about 850 bp) and GDCH TP The recovered fragments were connected with recombinase and used as templates in the presence of primers GDCH TP -1F and ApSDMT-R were used to guide the second round of PCR amplification. After the reaction was completed, the amplified product was subjected to 1% agarose gel electrophoresis to recover and purify GDCH TP -ApSDMT DNA fragment (about 950 bp), the fragment was cloned into the pMD18-T vector (purchased from TAKARA) to obtain pMD18-GDCH TP -ApSDMT vector was sent to Guangzhou Ruibo Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the sequence of the DNA fragment was shown in SEQ ID No.4; and the protein shown in SEQ ID No.6 in the coding sequence table.

[0052] Example 2 Obtaining the imGS-pOx vector for transforming the imGS photorespiration metabolic branch

[0053] (1)GDCH TP -ApGSMT fusion protein expression cassette Prca-GDCH TP - Acquisition of ApGSMT-Tnos

[0054] According to the gDNA sequence of Prca and GDCH provided by NCBI (http: / / www.ncbi.nlm.nih.gov / ), TP -ApGSMT fusion protein expression gene sequence (SEQ ID No.1) to design primers, the primer sequences are as follows:

[0055] Prca-F:5'-GTCGTGCCCCTC TCTAGA CACTCCACAAATATACAAG-3' (the underline indicates the restriction endonuclease Xba I recognition site)

[0056] Prca-R:5'-AGCCCACAGCCTCAGAGCCATCTTAATTTGCTGAAAGTCGAT-3'

[0057] GDCH TP -ApGSMT-F:5'-ATCGACTTTCAGCAAATTAAGATGGCTCTGAGGCTGTGGGCT-3'

[0058] GDCH TP -ApGSMT-R:5'-TTCACACTTGTA GGATCC TACTTGTCGTCGTCGTCCTTG-3' (the underline is the restriction endonuclease BamHI recognition site)

[0059] The gDNA of the leaves of the two-week-old seedlings of the japonica rice variety Zhonghua No. 11 and the pMD18-GDCH TP -ApGSMT vector was used as template, primers Prca-F and Prca-R, primer GDCH TP -ApGSMT-F and GDCH TP -ApGSMT-R was used to guide the amplification of Prca and GDCH using conventional methods. TP After the reaction, the PCR amplification product was subjected to 1% agarose gel electrophoresis to recover and purify Prca (about 1500 bp) and GDCH TP -ApGSMT (about 900 bp) DNA fragment; the above-recovered fragment was connected with recombinase and used as a template to generate a new PCR product under the conditions of primers Prca-F and GDCH TP -ApGSMT-R was used to guide the second round of PCR amplification. After the reaction was completed, the amplified product was subjected to 1% agarose gel electrophoresis to recover and purify Prca-GDCH TP -ApGSMT DNA fragment (about 2400 bp), clone the fragment into pOx vector ( Figure 1 ) between the Xba I and BamH I restriction sites of the multiple cloning site to obtain the vector pOx-Prca-GDCH TP -ApGSMT-Tnos. The DNA fragment was sent to Guangzhou Ruibo Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the sequence of the DNA fragment was as shown in SEQ ID No.2.

[0060] (2)GDCH TP -ApSDMT fusion protein expression cassette Pcab-GDCH TP - Acquisition of ApSDMT-T35S

[0061] According to the gDNA sequence of Pcab promoter, GDCH TP -ApSDMT fusion protein expression gene sequence (SEQ ID No.4) and the T35S terminator sequence on the pOx vector to design primers. The primer sequences are as follows:

[0062] Pcab-F:5'-ATGATTACGAATTC GAGCTC AGACATCACTTCTGATTGGG-3' (the underline indicates the restriction endonuclease Sac I recognition site)

[0063] Pcab-R:5'-AGCCCACAGCCTCAGAGCCATTGATGCAGTGAGCTGTGAGAG-3'

[0064] GDCH TP -ApSDMT-F:5'-CTCTCACAGCTCACTGCATCAATGGCTCTGAGGCTGTGGGCT-3'

[0065] GDCH TP -ApSDMT-R:5'-GATTTTTGCGGACGTCGACTAGGCGTAATCCGGGACGTCG-3'

[0066] T35S-F:5'-CGACGTCCCGGATTACGCCTAGTCGACGTCCGCAAAAATC-3'

[0067] T35S-R:5'-GTATATTTGTGGAGTG TCTAGA GTCACTGGATTTTGGTTT-3' (the underline indicates the restriction endonuclease Xba I recognition site)

[0068] The two-week-old seedling leaf gDNA of the japonica rice variety Zhonghua No. 11 and the pMD18-GDCH TP -ApSDM vector and pOx vector were used as templates, primers Pcab-F and Pcab-R, primer GDCH TP -ApSDMT-F and GDCH TP -ApSDMT-R, primers T35S-F and T35S-R were used to amplify Pcab promoter, GDCH TP -ApSDMT and T35S terminator genes. After the reaction, the PCR amplification products were subjected to 1% agarose gel electrophoresis to recover and purify the Pcab promoter (about 850 bp), GDCH TP -ApGSMT (about 950 bp) and T35S terminator (about 200 bp); GDCH TP -ApSDMT and T35S terminator fragments were ligated with recombinase and used as template in the presence of primer GDCH TP -ApSDMT-F and T35S-R were used to guide the second round of PCR amplification. After the reaction was completed, the amplified product was subjected to 1% agarose gel electrophoresis to recover and purify GDCH TP -ApSDMT-T35S DNA fragment (about 1150 bp); Pcab and GDCHTP -ApSDMT-T35S fragment was connected with recombinase and used as a template to carry out the third round of PCR amplification under the guidance of primers Pcab-F and T35S-R. After the reaction was completed, the amplified product was subjected to 1% agarose gel electrophoresis to recover and purify Pcab-GDCH TP -ApSDMT-T35S DNA fragment (about 2000 bp), clone the fragment into the vector pOx-Prca-GDCH TP -ApGSMT-Tnos multiple cloning site between the Sac I and Xba I restriction sites to obtain the vector pOx-Pcab-GDCH TP -ApSDMT-T35S-Prca-GDCH TP -ApGSMT-Tnos (GS-pOx for short) Figure 2 ). The DNA fragment was sent to Guangzhou Ruibo Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the sequence of the DNA fragment was as shown in SEQ ID No.5.

[0069] Example 3 Obtaining imGS-pOx and phenotypic analysis

[0070] The imGS photorespiration metabolic branch transformation vector imGS-pOx was transformed into callus tissue of mature embryos of japonica rice variety Zhonghua No. 11 by Agrobacterium-mediated method, as described in the following literature (Hiei et al, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J. 1994, 6: 271-282). After pre-differentiation and differentiation, 24 transformed plants were obtained. The hygromycin resistance gene HPT was identified by PCR, and all were positive. The PCR primer sequences are as follows:

[0071] HPT-F: 5'-CTGAACTCACCGCGACGTCTGTC-3'

[0072] HPT-R: 5'-TAGCGCGTCTGCTGCTCCATACA-3'

[0073] PCR amplification conditions were: 95°C for 2 min; 95°C for 15 sec, 58°C for 15 sec, 72°C for 15 sec, 35 cycles; 72°C for 5 min.

[0074] After positive transgenic plants were identified by PCR, genomic DNA from leaves of T1 transgenic plants was extracted for Southern Blot detection of the copy number of the inserted gene. Single-copy transgenic plants were selected and seeds were collected from individual plants. More than 100 seeds were germinated and screened with hygromycin. If there was no death, it indicated that the seeds were homozygous. After germination of homozygous transgenic seeds and wild-type rice Zhonghua 11 seeds, Kimura B nutrient solution (pH adjusted to 4.8) was used to culture rice to the 4-leaf stage, and then total protein from rice leaves was extracted to detect total protein concentration. Western Blot was used to detect gene expression at the protein level. Figure 3 It can be seen that GDCH in the leaves of transgenic plants TP -ApSDMT, GDCH TP -ApGSMT Both genes are expressed.

[0075] The specific formula of Kimura B nutrient solution is: (NH 4 ) 2 SO 4 (0.365mM), KH 2 PO 4 (0.182mM),KNO 3 (0.183mM),K 2 SO 4 (0.086mM),Ca(NO 3 ) 2 (0.366 mM), MgSO 4 (0.548mM),EDTA-FeIII(0.020mM),MnCl 2 .4H 2 O(0.091×10-3mM), ZnSO 4 .7H 2 O(0.77×10 -3 mM),CuSO 4 .5H 2 O(0.32×10 -3 mM),H 3 BO 3 (0.0462mM), (NH 4 ) 6 Mo 7 O 24 .4H 2 O(0.145×10 -3 mM).

[0076] Through the above experiments, we successfully introduced the imGS photorespiration metabolic transformation branch into rice and obtained transgenic rice lines imGS14, imGS20 and imGS24 ( Figure 4 ), compared with the wild type, the betaine content of the transgenic lines ( Figure 5 ), photosynthetic efficiency ( Figure 6 )、Number of grains per ear( Figure 7 ) increased significantly.

Claims

1. An imGS photorespiration metabolic transformation branch, It is characterized in that The branch includes the GSMT and SDMT proteins.

2. According to the branch circuit of claim 1, It is characterized in that The GSMT protein and SDMT protein N-terminal fused rice mitochondrial signal peptide GDCH TP , forming GDCH TP -GSMT fusion protein and GDCH TP -SDMT fusion protein.

3. According to the branch circuit of claim 2, It is characterized in that The GDCH TP -GSMT fusion protein amino acid sequence is shown in SEQ ID No.3, the GDCH TP The amino acid sequence of the -SDMT fusion protein is shown in SEQ ID No.

6.

4. According to the branch circuit of claim 2, It is characterized in that The GDCH TP -GSMT fusion protein GDCH TP -GSMT fusion protein encoding gene nucleotide sequence is shown in SEQ ID No.1, the GDCH TP The nucleotide sequence of the gene encoding the -SDMT fusion protein is shown in SEQ ID No.

4.

5. According to the branch circuit of claim 4, It is characterized in that The GDCH TP -GSMT fusion protein encoding gene expression cassette is Prca-GDCH TP -GSMT-T nos , the GDCH TP -SDMT fusion protein encoding gene expression cassette is Pcab-GDCH TP -SDMT-T 35S .

6. The branch according to claim 5, It is characterized in that The GDCH TP -GSMT fusion protein encoding gene expression cassette nucleotide sequence is shown in SEQ ID No.2, the GDCH TP The nucleotide sequence of the gene expression cassette encoding the -SDMT fusion protein is shown in SEQ ID No.

5.

7. An expression vector capable of introducing the imGS photorespiration metabolic transformation pathway into plants, It is characterized in that The GDCH as claimed in claim 5 or 6 TP -GSMT and GDCH TP The gene expression cassette encoding the -SDMT fusion protein is constructed by inserting into the multiple cloning site of a plant expression vector or by recombination.

8. The expression vector according to claim 7, It is characterized in that The expression vector also contains any one of a gene expressing an enzyme that can produce a color change or a luminescent compound in the plant, an antibiotic resistance marker, or a chemical resistance marker gene.

9. Use of the imGS photorespiration metabolic modification branch according to any one of claims 1 to 6 or the expression vector according to claim 7 or 8 in preparing transgenic plants with enhanced stress resistance, increased photosynthetic rate and yield.

10. A method for preparing a transgenic plant, It is characterized in that The method comprises transforming the expression vector according to claim 7 or 8 into plant cells or tissues, and then cultivating the transformed cells or tissues into plants.

Images