Feed paenibacillus and application thereof

Abstract

The invention relates to the technical field of plant tissue culture seedling raising, in particular to paenibacillus feed and application thereof in promoting cunninghamia lanceolata test-tube plantlet height growth. The feed paenibacillus paenibacillus SY0317 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC NO: 20575, the preservation address is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing, and the preservation time is August 31, 2020. The cunninghamia lanceolata test-tube plantlet cultured by adopting the strain has high growth speed, the growth amount is increased by more than 60%, the culture time of the cunninghamia lanceolata tissue culture plantlet is shortened, large-scale production of the cunninghamia lanceolata tissue culture plantlet can be realized, and the strain has remarkable economic and social benefits.

Description

Technical Field

[0001] The invention relates to the technical field of plant tissue culture seedling raising, and in particular to a feed bacillus and application thereof in promoting the height growth of Chinese fir test tube seedlings. Background Art

[0002] Cunninghamia lanceolata Hook is a plant of the family Taxaceae. It is a unique timber species in my country and an important commercial timber species in southern my country. It has excellent characteristics such as fast growth, high yield, good wood quality and wide application, and occupies an important position in my country's forestry production. At present, the main methods of planting and raising seedlings of artificial Chinese fir forests include seed propagation, cutting propagation, tissue culture propagation, etc., but seed propagation is difficult to maintain the characteristics of the mother Chinese fir, and the quality of seedlings varies. Although cutting propagation and tissue culture propagation can stably inherit the excellent traits of the parents, the breeding speed is slow and it is difficult to meet the social demand for high-quality Chinese fir seedlings. Tissue culture technology is a rapid asexual propagation technology. The use of tissue culture to breed Chinese fir seedlings can not only maintain the excellent traits of the mother, but also increase the breeding speed of seedlings, accelerate the process of improving Chinese fir varieties, and promote the high-quality development of my country's Chinese fir industry. However, the growth of Chinese fir tissue culture test tube seedlings is slow and the culture cycle is long, which hinders the industrial production process of Chinese fir tissue culture seedlings.

[0003] CN202210263591.6 provides a growth-promoting bacteria for promoting the growth of Chinese fir, the growth-promoting bacteria including Bacillus licheniformis, Bacillus stearothermophilus licheniformis and Bacillus lysine, with a weight ratio of 3:2:1. The microbial fertilizer of the invention uses growth-promoting bacteria composed of Bacillus licheniformis, Bacillus stearothermophilus licheniformis and Bacillus lysine in combination with other raw materials. As an active agent, Bacillus can secrete a large amount of organic acid, dissolve inorganic phosphorus, and improve the absorption and utilization of phosphorus by plants. It is particularly suitable for the production of forest biological fertilizers and forest growth-promoting agents in the red soil area of ​​southeastern Guangxi, and can be further developed into microbial compound fertilizers and agents. By including a variety of nutrient elements in the prepared nutrient solution, the nutritional composition of the product is improved, and the shell powder after calcination is added to enhance the activity, and the raw materials are combined and proportioned to improve the fertilizer efficiency of the product. The growth rate is as high as 87%. However, the patent requires the mixed use of three bacteria, Bacillus licheniformis, Bacillus stearothermophilus licheniformis and Bacillus lysine, and the growth of the seedling height is not much.

[0004] The Chinese patent authorization publication number is CN 108308032 B, and the name is "Chinese fir tissue culture rapid propagation method". The process steps are to use the healthy branches of the current year at the base of the Chinese fir stump as explants, sterilize the explants, induce adventitious buds, proliferate and root the adventitious buds, and harden and transplant the seedlings. The induction culture medium is: CLA + 0.2mg·L -1 NAA; proliferation medium: CLA + mg·L-1 NAA; rooting medium: 1 / 2CLA+mg·L -1 NAA+VB12mg·L -1 The proliferation multiple is 5 to 10 times after 50 to 60 days of cultivation, and the survival rate of transplantation is as high as over 95%. The proliferation multiple of the Chinese fir test tube seedlings cultivated in this patent is relatively high, but the height growth of the test tube seedlings is still relatively slow, with a height growth of only 1.5-2.0cm.

[0005] The patent publication number is CN 106922534A, and the name is "A method for rapid propagation of Chinese fir through tissue culture". The process steps are to cut the newly grown tender shoots from the roots after ring cutting as explants, sterilize the explants, induce callus tissue, induce callus tissue differentiation to form adventitious buds, proliferate and root the adventitious buds, and harden and transplant the seedlings. The induction culture medium contains MS culture medium + 1.5 mg·L -1 KT+0.5mg·L -1 6-BA+0.1mg·L -1 IBA+200mg·L -1 Ca(NO 3 ); the composition of the proliferation medium is: MS + 1.0 mg·L -1 KT+0.2mg·L -1 6-BA+0.1mg·L -1 IBA+200mg·L -1 Ca(NO 3 ); the composition of the rooting medium is: MS + 1.0 mg·L -1 ABT+0.2mg·L -1 IBA. However, the patent is to induce the differentiation of Chinese fir callus to form adventitious buds, and the test tube seedlings have variation, obvious differentiation, and the height growth of the test tube seedlings is slow.

[0006] The patent with publication number CN 104145822B is entitled “A method for raising seedlings through tissue culture of superior clone 11C of Chinese fir”. The process steps are to inoculate the explants of superior clone 11C of Chinese fir into an induction medium, induce adventitious buds, proliferate and root the adventitious buds, and harden and transplant the seedlings. The induction medium is 1 / 2MS + 0.5-0.8mg·L -1 6-BA+0.1~0.2mg·L -1 IBA; proliferation culture medium: 1 / 2MS + 0.3-0.5mg·L -1 6-BA+0.1~0.2mg·L -1 IBA; rooting medium: 1 / 4MS+0.1~0.5mg·L -1 IBA + 0.3~0.5mg·L -1NAA. The proliferation multiples of the test tube seedlings in subculture are 2.03-3.11 times, the rooting rate of rooting culture is 62.2-100%, and the transplant survival rate is 85%. This patent mainly provides a tissue culture seedling raising method for a high-quality Chinese fir clone 11C with high rooting rate and high subculture proliferation multiples, but does not solve the problem of slow growth of test tube seedlings.

[0007] The published literature on Chinese fir tissue culture also describes the breeding of Chinese fir tissue culture seedlings by collecting different explants and sterilizing, inducing culture medium, multiplying and rooting culture, hardening and transplanting. However, the height growth of Chinese fir test tube seedlings cultured by these methods is slow. The height growth of test tube seedlings is only 1.5-2.0cm after 50-60 days of culture. The culture time is long and the problem of slow growth of test tube seedlings has not been solved. Summary of the invention

[0008] The purpose of the present invention is to provide a feed bacillus and application thereof in promoting the height growth of Chinese fir test tube seedlings, so as to solve the problem of slow height growth of existing Chinese fir test tube seedlings.

[0009] In order to solve the above technical solution, the technical solution of the present invention is as follows:

[0010] A feed Bacillus (Paenibacillus pabull) SY0317, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number: CGMCC NO: 20575. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit time is August 31, 2020.

[0011] A culture metabolic liquid is obtained by shaking culture of feed bacillus SY0317 at 28±5°C and 150-170r / min for 2-4 days, centrifuging and taking the upper solution.

[0012] The present invention also claims to protect the use of the culture metabolite solution in preparing a reagent for promoting the height growth of Chinese fir test tube seedlings.

[0013] A culture medium for promoting the height growth of Chinese fir test tube seedlings comprises 30-50 ml / L of the culture metabolite solution.

[0014] In one preferred embodiment, the culture medium uses DKW as the basic culture medium and also includes 1.0 mg / L of 6-benzylaminopurine (6-BA), 0.5 mg / L of thidiazuron (TDZ), 0.25 mg / L of indolebutyric acid (IBA), 0.5-1.0 mg / L of D-biotin, 30 g / L of sucrose and 7 g / L of agar.

[0015] A method for promoting the height growth of Chinese fir test tube seedlings comprises the following steps: cutting Chinese fir multiplication and subgeneration seedlings, inoculating them in the above culture medium for 30-60 days, and obtaining test tube seedlings.

[0016] In one preferred embodiment, the culture conditions for the proliferation of subculture seedlings of Chinese fir are as follows: the culture temperature is 25±2°C, the light intensity is 30-40 μmol·m -2 ·s -1 , light exposure time 10-14h·d -1 .

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The feed bacillus of the present invention has the functions of secreting IAA, biological nitrogen fixation, phosphorus dissolution, and producing iron carriers, and can promote the growth of test tube seedlings. We have carried out relevant experimental research, and the results show that:

[0019] (1) The experimental results of this experiment show that the feed Bacillus SY0317 can produce IAA on Gao's medium No. 1 without adding tryptophan, and the IAA produced is (11.92±1.26)μg / ml. When 5% tryptophan is added to the medium, the IAA produced by the test strain is (30.86±1.92)μg / ml, which is 2.58 times that of the medium without adding tryptophan, indicating that the test strain can effectively use exogenous tryptophan to produce IAA, thereby promoting plant growth. Therefore, the test strain has a significant growth-promoting effect.

[0020] (2) Through a large number of experiments, the increase in phosphorus solubilization of the feed bacillus of the present invention was measured to be (20.39±0.40) mg / L, indicating that the strain has the ability to degrade phosphorus and can convert phosphorus that is difficult for plants to absorb and utilize into available phosphorus that can be absorbed and utilized, thereby providing phosphorus nutrients for plants and promoting plant growth. At the same time, the pH value of the strain fermentation liquid was detected to be 5-6, which was weakly acidic, indicating that acidic substances were produced during the phosphorus solubilization process, resulting in a decrease in pH, further verifying the phosphorus solubilization ability of the strain.

[0021] (3) Through a large number of experiments, it was measured that the potassium solubilization rate of the feed Bacillus of the present invention was 14.21%, indicating that the strain has the ability to solubilize potassium and can provide quick-acting potassium for plants, ultimately promoting plant growth.

[0022] (4) The feed Bacillus of the present invention also has the functions of reducing the content of malondialdehyde (MDA) in plants, promoting the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), improving the stress resistance of plants, and increasing the content of chlorophyll, soluble sugar, and soluble protein in plants, thereby promoting plant growth.

[0023] (5) By adopting the method of the present invention, 1.5-2.0 cm tall Chinese fir seedlings were cut and inoculated into the above-mentioned growth-promoting medium for 30-60 days. The height of the seedlings grew to 2.5-3.5 cm, which was increased by more than 60%. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a graph showing the growth of Chinese fir test tube seedlings inoculated on a high growth promoting medium for 30 days;

[0025] Figure 2 This is a graph showing the growth of Chinese fir test tube seedlings inoculated on a high growth promoting medium after 50 days of cultivation.

[0026] Figure 3 It is the effect of feed Bacillus SY0317 on the content of malondialdehyde (MDA) in plants, and the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT). DETAILED DESCRIPTION

[0027] Example 1

[0028] Feed Bacillus SY0317 was isolated and purified from Chinese fir tissue culture seedlings. The specific process is as follows:

[0029] The Chinese fir tissue culture seedlings were inoculated into a subculture proliferation medium (the subculture proliferation medium was TSA medium supplemented with 5 g / L pancreatic casein, 5 g / L NaCl, 5 g / L soybean protein, 15 g / L agar powder, and a pH value of 7.1±0.2), cultured at 26°C±1°C, and the endophytic bacteria grew out. Then, the streak separation method was used to separate the endophytic bacteria on LB solid medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 18 g / L agar powder, and a pH value of 5.6-5.8) at a temperature of 26°C±1°C for 3 days, until a pure culture was obtained.

[0030] The samples were sent to the Institute of Microbiology, Chinese Academy of Sciences for testing, and the cell morphology and physical and chemical test results were as follows:

[0031] Table 1 Cell morphology and physicochemical test results

[0032]

[0033] The gyrB gene sequence was tested and the sequence was as follows:

[0034] GTGATAACGTGCTTTGGCAATATGCGAAGTCATCACCCAATTCCGGTACCCAT

[0035] TGCGGTAATGATCGRCTCTGATCTCCGCATtGCCCAAAATCCGGTCaAGACGTGCTTT

[0036] TtCCACGTTCAGAATCtTACCACGCAGCGGCAAAATCGCCTGGAAGTGACGATCTCGT

[0037] CCTTGCTTCGCTGATCCACCGGCGGAGTCACCCTCGACGATGTACAATTCACTGATT

[0038] GAAGCATCCTTGGATGAACAGTCGGCCAATTTACCTGGCAAAGAGCTGACTTCGAG

[0039] TGCACCTTTACGACGTGTCAGTTCACGGGCTTTACGTGCTGCTTCACGTGCACGGGC

[0040] AGCTTGCAGTCCTTTTTCCAAAATGCGACGGGATACGGAAGGGTTCTCTTCCAGGAA

[0041] TTCCTGCAGCTTCTCAGCAAACAGGGATTCGACAATTCCGCGCACTTCACTGTTACC

[0042] CAACTTGGTTTTCGTCTGTCCCTCAAATTGCGGTTCAGGGATCTTGACTGAGATGATC

[0043] GCTGTTAGACCTTCACGTACATCATCCCCGGACAGGTTGCCTGTGCTGTCTTTGATTA

[0044] CGCCCGCTTTGCGCGCATAATCATTGATAATCCGGGTAAGAGCGCTCTTGAAGCCAG

[0045] ATTCATGCGTTCCGCCCTCATGTGTGTTGATGTTGTTCGCAAAAGAATAAATATTCTC

[0046] GGTGTAGCTGTCATTGTATTGCAACGCCACTTCCACTTGGATGTTGTCTCTTGATCCT

[0047] TCCACGTAAATCGGGTTTTCGTGCATCACTTCACGCTTYTGGTTCAGGAAGGAGACA

[0048] TACTCGATAATACCGCCCTCATACAGGAAAGAGTTGGTTACACCTGTACGTTCATCG

[0049] GTTAAAGTCATGCCAATTCCCTTGTTCASGAACGCGAGCTCACGAATACGAGTCAGC

[0050] AAAATTTCATAGTCATACACTCTTGTTTCCGTGAAAATCTCCGGATCCCGGATGGAA

[0051] CGTAACTGTTG (SEQ ID NO. 1)

[0052] The conclusion of the test and identification is:

[0053] Under laboratory conditions, based on a comprehensive analysis of experimental data such as the cell morphology, physiological and biochemical characteristics, 16S rRNA gene sequence, and gyrB gene sequence of the tested bacteria, and with reference to the Bergey's Manual of Systematic Bacteriology and relevant research papers in the International Journal of Systematic and Evolutionary Microbiology, the tested bacteria (strain number: SY0317 (named SY001 in the report)) were identified as Paenibacillus pabuli feed Bacillus.

[0054] Related experimental studies were conducted on feed Bacillus SY0317, as follows:

[0055] (1) The feed Bacillus SY0317 was cultured on Gao's medium No. 1 without adding tryptophan, and the IAA content was detected after culturing for 3-7 days at appropriate temperature and humidity. The results showed that the IAA produced by feed Bacillus SY0317 was (11.92±1.26)μg / ml. When 5% tryptophan was added to Gao's medium No. 1 and feed Bacillus SY0317 was cultured under the same conditions, the IAA produced by feed Bacillus SY0317 was (30.86±1.92)μg / ml, which was 2.58 times that of the culture without adding tryptophan. This shows that feed Bacillus SY0317 can effectively use exogenous tryptophan to produce IAA, thereby promoting plant growth.

[0056] (2) Prepare 50 ml of modified Montana organophosphorus liquid culture medium (Shandong Top Biotechnology Co., Ltd.), add 0.5 ml of strain spore suspension with a concentration of 106 CFU / ml, and inoculate 0.5 ml of inactivated spore suspension as a control, culture at 28°C and 160 r / min for 5 days, collect the culture medium, centrifuge at 4°C and 10,000 r / min for 10 min, take 2 ml of the supernatant, and determine the organophosphorus content using the molybdenum antimony colorimetric method. Prepare a phosphorus standard (KH2PO4) solution with a concentration of 100 mg / L, dilute it to different concentrations, determine A700, and draw an organophosphorus standard curve.

[0057] At 700 nm, the standard curve of potassium dihydrogen phosphate was measured to be y=0.4540x+0.0396 (R2=0.9952). According to the standard curve, the increase in phosphorus solubilization of feed Paenibacillus SY0317 was measured to be (20.39±0.40) mg / L, indicating that feed Paenibacillus SY0317 has the ability to degrade phosphorus and can convert phosphorus that is difficult for plants to absorb and utilize into absorbable and available phosphorus, thereby providing phosphorus nutrients for plants and promoting plant growth.

[0058] (3) Replace the starch in Gao's medium No. 1 with glucose, and keep the other components unchanged. Adjust the pH value to 7.0 and take the concentration of 10 6 1 mL of the strain spore suspension with CFU / ml was inoculated into 100 ml of liquid culture medium, and an equal amount of inactivated spore suspension was inoculated as a control. The culture was shaken at 28°C and 160 r / min for 5 days, the culture fluid was collected, centrifuged at 4°C and 8000 r / min for 10 min, 10 ml of the supernatant was taken, 3 to 5 drops of methyl red reagent were added, and after sufficient shaking, the solution was allowed to stand and the color change was observed.

[0059] Organic acid test: the supernatant did not change color after adding methyl red, which proved that organic acid could not be produced in ordinary culture medium; however, in the phosphate solubilization test, the pH value of the strain fermentation liquid was detected to be 5-6, which was weakly acidic, indicating that acidic substances were produced during the phosphate solubilization process, resulting in a decrease in pH, further verifying the phosphate solubilization ability of feed Bacillus SY0317.

[0060] (4) In 100 mL of Gao's No. 1 liquid medium, the inoculation concentration was 10 6CFU / mL of the strain spore suspension 1mL, after 28 ℃, 160r / min shaking culture for 3 days, the bacterial liquid was inoculated with 4% of the potassium-solubilizing activity test medium - Aleksandrov medium with potassium feldspar as the only potassium source, and an equal amount of inactivated seed culture liquid was used as a control. The culture was shaken at 28 ℃ and 160r / min for 7 days. The culture liquid to be tested was poured into an evaporating dish, heated and concentrated to about 15ml, 4ml of hydrogen peroxide was added, and evaporation was continued with continuous stirring until the mucous substance was completely transparent. The supernatant was collected in a volumetric flask, fixed to 50ml, and the content of available potassium was measured with a flame spectrophotometer. A standard curve was prepared using KCl solutions of different concentration gradients of 0 μg / ml, 2.5 μg / ml., 5.0 μg / ml, 10.0 μg / ml, 15.0 μg / ml, 20.0 μg / ml, and 40.0 μg / ml, and then the concentration of soluble potassium in the bacterial solution was obtained from the standard curve. According to the obtained KCl standard curve y=1.3858x+46.4020 (R2=0.9901), the potassium solubilization rate of feed Paenibacillus SY0317 was 14.21%, indicating that feed Paenibacillus SY0317 has the ability to solubilize potassium, can provide quick-acting potassium for plants, and ultimately promote plant growth. Compared with the existing Bacillus that have been disclosed, there is currently no Bacillus that can have a similar effect.

[0061] Table 2 Performance study of feed Bacillus SY0317

[0062]

[0063] Example 2

[0064] After the feed Bacillus SY0317 is cultured under shaking conditions of 28±5°C and 150-170 r / min for 2-4 days, the culture is centrifuged and the upper layer solution is taken to obtain the feed Bacillus SY0317 culture metabolite liquid.

[0065] A method for promoting the growth of Chinese fir test tube seedlings, comprising cutting Chinese fir seedlings with a height of 1.5-2.0 cm for proliferation and subculture, and inoculating them in a growth promotion medium with DKW as a basic culture medium, and further comprising 1.0 mg / L 6-BA, 0.5 mg / L TDZ, 0.25 mg / L IBA, 0.5 mg / L D-biotin, 30 ml / L culture solution of feed Bacillus SY0317, 30 g / L sucrose, and 7 g / L agar. The culture temperature is (25±2)°C, and the light intensity is 30-40 μmol·m -2 ·s -1 , light exposure time 12h·d -1 The culture was carried out for 50 days. Figure 1As shown, the situation of culturing for 50 days is as follows Figure 2 As shown in the figure, the average height growth of the test tube seedlings was 2.68 cm.

[0066] At the same time, under the same other conditions, the Chinese fir test tube seedlings were inoculated on the culture medium without the addition of feed Bacillus culture extract and D-biotin and cultured for 50 days for comparison. The average height growth of the test tube seedlings was 1.62 cm.

[0067] Example 3

[0068] After the feed Bacillus SY0317 is cultured under shaking conditions of 28±5°C and 150-170 r / min for 2-4 days, the culture is centrifuged and the upper layer solution is taken to obtain the feed Bacillus SY0317 culture metabolite liquid.

[0069] A method for promoting the growth of Chinese fir test tube seedlings, comprising cutting a 1.5-2.0 cm long Chinese fir seedling for proliferation and subculture, and inoculating it in a growth promotion medium which uses DKW as a basic culture medium and also includes 1.0 mg / L 6-BA, 0.5 mg / L TDZ, 0.25 mg / L IBA, 0.8 mg / L D-biotin, 40 ml / L culture metabolite of feed Bacillus SY0317, 30 g / L sucrose, and 7 g / L agar. The culture temperature is (25±2)°C, and the light intensity is 30-40 μmol·m -2 ·s -1 , light exposure time 12h·d -1 The average height of the test tube seedlings was 3.03 cm after being cultured in an environment of 50 days.

[0070] At the same time, under the same other conditions, the Chinese fir test tube seedlings were inoculated on the culture medium without the addition of feed Bacillus culture extract and cultured for 50 days as a control. The average height growth of the test tube seedlings was 1.55 cm.

[0071] The chlorophyll content of the two plants was tested according to the national standard method, and the results are as follows:

[0072] Table 3 Effects of feed Bacillus SY0317 on plant chlorophyll, soluble sugar and soluble protein content

[0073]

[0074] Effect of strains on the content of chlorophyll, soluble sugar and soluble protein in plants. Chlorophyll is the main raw material for photosynthesis of crops. The higher the chlorophyll content, the stronger the potential photosynthetic capacity. As can be seen from the table, the chlorophyll a and chlorophyll b contents of plants treated with bacterial solution are higher than those treated with sterile water, and the difference in chlorophyll a content is extremely significant; at the same time, bacterial solution treatment can significantly increase the chlorophyll a / b value, which can effectively improve the light energy conversion rate and light energy utilization rate of plants. This shows that the strain can significantly increase the total chlorophyll content of bananas, enhance the photosynthetic capacity of plant seedlings, strengthen the accumulation of photosynthetic products in plants, and promote plant growth. In addition, after treatment with feed Bacillus SY0317, the soluble sugar and soluble protein contents in plant leaves were significantly increased compared with the sterile water control, indicating that feed Bacillus SY0317 can also significantly increase the soluble sugar and soluble protein contents of plants.

[0075] The malondialdehyde (MDA) content, superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) activities of the two plants were tested according to the national standard method. The results are as follows: Figure 3 shown.

[0076] Plants will secrete MDA under adverse environmental conditions, leading to membrane lipid peroxidation. The higher the MDA content, the greater the degree of membrane lipid peroxidation, so the MDA content can represent the degree of damage to the plant. Figure 3 As shown, the MDA content of the plants treated with bacterial solution was lower than that of the plants treated with sterile water, indicating that the feed Bacillus SY0317 can reduce the degree of membrane lipid peroxidation in plant seedlings and improve the stress resistance of plants.

[0077] SOD can remove free radicals in organisms. The more SOD content in an organism, the less aging the organism. POD plays an important role in plant respiration, photosynthesis and auxin oxidation. It is used to characterize the degree of tissue aging. The higher the POD level in a plant, the less likely the tissue is to age. CAT can promote H 2 O 2 Decompose into H 2 O and O 2 , reducing H 2 O 2 content, thereby reducing the plant's 2 O 2 As shown in the figure, the activities of POD, CAT, and SOD in plant seedlings treated with bacterial solution are higher than those in the sterile water treatment group. This shows that the strain can increase the activities of POD, CAT, and SOD in plant seedlings, prevent plant aging, tissue aging, etc. This shows that under adverse external environments, endophytic bacteria can increase the activities of POD, CAT, and SOD in plant seedlings, reduce the damage caused by stress to themselves, and improve the stress resistance of plants.

[0078] In addition, before inoculation with bacterial solution (0d), the PAL activity of plant leaves treated with bacterial solution was significantly higher than that of sterile water treatment; 0-21d after inoculation with pathogens, the PAL activity of plant leaves in all treatments showed an increasing trend, among which the growth trend of bacterial solution treatment was gentle during 0-14d and sharp during 14-21d; there were differences between bacterial solution treatment and sterile water treatment; 21-28d after inoculation with pathogens, the PAL activity of plant leaves in both treatments showed a slow downward trend. In general, the PAL activity of plant leaves treated with bacterial solution was always higher than that of sterile water treatment during the measurement period, and the bacterial solution had a significant PAL induction effect on plant leaves.

[0079] Polyphenol oxidase (PPO) is a copper-containing oxidase widely present in plant tissues. When plants are mechanically damaged or infected by pathogens, PPO catalyzes the reaction of phenol with 0 2 Oxidation forms quinones, which cause the tissue to brown, so as to repair damage, prevent or reduce infection, and improve disease resistance. From the experimental results, the trends of PPO and PAL enzyme activities are similar. Before inoculation with bacterial solution (0d), the PPO activity of plant leaves treated with bacterial solution was significantly higher than that of sterile water treatment; 0-21d after inoculation with pathogens, the PAL activity of plant leaves treated with bacterial solution showed an increasing trend, among which the growth trend of bacterial solution treatment was slow from 0-14d to 14-21d, and the growth trend was sharp; there were differences between bacterial solution treatment and sterile water treatment; 21-28d after inoculation with pathogens, the PAL activity of plant leaves treated with both showed a slow downward trend. Overall, the PPO activity of plant leaves treated with bacterial solution was always higher than that of sterile water treatment during the measurement time, and the bacterial solution had a significant induction effect on PPO in plant leaves.

[0080] In summary, it can be seen from the figure that feed Bacillus SY0317 has the effect of reducing the content of malondialdehyde (MDA) in plants, promoting the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT), and improving the stress resistance of plants, thereby promoting plant growth.

[0081] Example 4

[0082] After the feed Bacillus SY0317 is cultured under shaking conditions of 28±5°C and 150-170 r / min for 2-4 days, the culture is centrifuged and the upper layer solution is taken to obtain the feed Bacillus SY0317 culture metabolite liquid.

[0083] A method for promoting the growth of Chinese fir test tube seedlings, comprising cutting a 1.5-2.0 cm long Chinese fir seedling for proliferation and subculture, and inoculating it in a growth promotion medium which uses DKW as a basic culture medium and also includes 1.0 mg / L 6-BA, 0.5 mg / L TDZ, 0.25 mg / L IBA, 1.0 mg / L D-biotin, 50 ml / L culture metabolite of feed Bacillus SY0317, 30 g / L sucrose, and 7 g / L agar. The culture temperature is (25±2)°C, and the light intensity is 30-40 μmol·m-2 ·s -1 , light exposure time 12h·d -1 The average height of the test tube seedlings was 3.41 cm after being cultured in an environment of 50 days.

[0084] At the same time, under the same other conditions, the Chinese fir test tube seedlings were inoculated on the culture medium without the feed Bacillus SY0317 metabolic solution and D-biotin for 50 days for comparison. The average height growth of the test tube seedlings was 1.66 cm.

[0085] Therefore, the IAA produced by the feed Bacillus SY0317 of the present invention is (30.86±1.92) μg / ml, the measured increase in phosphorus solubility of the strain is (20.39±0.40) mg / L, the potassium solubility rate of the strain is 14.21%, and the content of plant chlorophyll, soluble sugar and soluble protein is increased, thereby promoting plant growth.

Claims

1. A feed bacillus (Paenibacillus pabull) SY0317, It is characterized in that The bacteria is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the accession number: CGMCC NO: 20575. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit time is August 31, 2020.

2. A culture metabolic fluid, It is characterized in that The method is to culture feed Bacillus SY0317 under conditions of 28±5°C and 150-170r / min for 2-4 days by shaking, centrifuging and taking the upper solution.

3. Use of the culture metabolite solution according to claim 2 in the preparation of a reagent for promoting the height growth of Chinese fir test tube seedlings.

4. A culture medium for promoting the height growth of Chinese fir test tube seedlings, It is characterized in that Including 30-50 ml / L of the culture metabolic fluid.

5. The culture medium according to claim 4, It is characterized in that The culture medium uses DKW as a basic culture medium and further includes 1.0 mg / L of 6-benzylaminopurine (6-BA), 0.5 mg / L of thidiazuron (TDZ), 0.25 mg / L of indolebutyric acid (IBA), 0.5-1.0 mg / L of D-biotin, 30 g / L of sucrose and 7 g / L of agar.

6. A method for promoting the growth of Chinese fir test tube seedlings. It is characterized in that The following steps are involved: Cut the Chinese fir seedlings for proliferation and subculture, inoculate them in the above culture medium for 30-60 days, and obtain test tube seedlings.

7. The method according to claim 6, It is characterized in that The culture conditions for the proliferation of subculture seedlings of Chinese fir were as follows: the culture temperature was 25±2 ℃ and the light intensity was 30~40 μmol·m -2 ·s -1 , photoperiod 10-14 h·d -1 .

Images