Recombinant microorganism and application thereof in fermentation production of Ecodoine

Abstract

The invention relates to the technical field of microorganisms, and particularly discloses a recombinant microorganism and application thereof in fermentation production of Ecodoine. Compared with an original strain, the recombinant microorganism provided by the invention expresses an ectABC gene of halobacterium chromogenes, expresses a glucose promoting gene glf of zymomonas mobilis, reduces the expression of a ptsG gene, further overexpresses glucokinase glk, preferably overexpresses phosphoenolpyruvate carboxylase ppc, and has the advantages that the recombinant microorganism can be used for preparing the recombinant microorganism for preparing the bacillus amyloliquefaciens, the bacillus amyloliquefaciens, the bacillus amyloliquefaciens, the bacillus amyloliquefaciens and the bacillus amyloliquefaciens; more preferably, a growth period dependent promoter is used for replacing the original promoter of the isocitrate dehydrogenase gene icd. Under the condition that the growth performance of thalli is not greatly influenced, the recombinant microorganism disclosed by the invention can obviously improve the yield and the yield of the fermentation production dependent on multiple factors, so that the efficiency of industrial production dependent on multiple factors is improved, and the production cost is reduced.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, in particular to a recombinant microorganism and application thereof in fermentation production of icodone. Background Art

[0002] Ecodoin, also known as tetrahydromethylpyrimidine carboxylic acid, has a molecular formula of C 6 H 10 N 2 O 2 , with a molecular weight of 142.16, is an osmotic pressure protective substance widely found in halophilic and halophilic bacteria. Icodoin is a chemical substance with high added value, which plays an important role in biotechnology, skin care products and medicine. In the field of cosmetics, Icodoin is widely added to skin care products as a natural moisturizer and protein protector. It can play an antioxidant, moisturize the skin and slow down aging. In the field of medicine, Icodoin has been found to have potential medicinal value in the treatment of human diseases such as Alzheimer's disease, pneumonia and colitis. Due to its specific protective effect on cells, it is also used for the maintenance of transplanted organs. Icodoin can be produced by chemical synthesis, however, the cost of the complex chemical synthesis process is relatively high. Microbial fermentation has the advantages of low cost, easy access to raw materials, and easy expansion of production. It is currently an effective way to produce Icodoin industrially. It is necessary to further study methods for more effective production of Icodoin through biological fermentation. Summary of the invention

[0003] One of the objects of the present invention is to provide a new and effective method for producing icodone by fermentation.

[0004] The present invention provides a recombinant microorganism, which, compared with the starting strain, expresses Chromobacterium halobacterium ( C. salexigens )of ectABC Gene, expression of glucose-promoting gene of Zymomonas mobilis glf while reducing ptsG Gene expression, and also overexpressed glucose kinase glk.

[0005] In the recombinant microorganism of the present invention, the glucose-promoting gene expressing Zymomonas mobilis glf while reducing ptsG The gene expression method is: using the glucose-promoting gene of Zymomonas mobilis glf replace ptsG Gene; And / or, the method of overexpressing glucose kinase glk is: glk Replace the original promoter with Ptrc promoter or add glucokinase gene glk The copy number of the Ptrc promoter is shown in SEQ ID No.4.

[0006] In the recombinant microorganism of the present invention, the recombinant microorganism further overexpresses phosphoenolpyruvate carboxylase ppc compared with the starting strain.

[0007] In the recombinant microorganism of the present invention, the method of overexpressing phosphoenolpyruvate carboxylase ppc is: ppc The original promoter was replaced by P J23110 phosphoenolpyruvate carboxylase gene ppc The copy number of P J23110 The sequence of the promoter is shown as SEQ ID No.6.

[0008] In the recombinant microorganism of the present invention, compared with the starting strain, the recombinant microorganism further replaces the isocitrate dehydrogenase gene with a growth phase-dependent promoter. icd The original promoter of the growth phase-dependent promoter is shown in SEQ ID No.8 or SEQ ID No.60.

[0009] Those skilled in the art may also overexpress glucose kinase glk and / or phosphoenolpyruvate carboxylase ppc by other methods known in the art.

[0010] In the recombinant microorganism of the present invention, the ectABC The gene is shown in SEQ ID No.25, glf The gene is shown in SEQ ID No. 2, ptsG The gene is shown in SEQ ID No. 1; And / or, the starting strain is Escherichia coli.

[0011] The present invention found that in Escherichia coli, glucose is used as a raw material, through phosphoenolpyruvate (PEP) and oxaloacetate (OAA), aspartic acid as a precursor, and exogenously introduced enzyme catalysis reaction, and finally icodine can be formed. In Escherichia coli, glucose is mainly taken up by the phosphotransferase system (PTS). Although PTS is very efficient in transporting glucose, the system consumes PEP. At the same time, when glucose is transported too fast, glucose will accumulate in the form of pyruvate, and then produce by-products such as acetic acid. OAA will also participate in the tricarboxylic acid (TCA) cycle, which will cause glucose to be unable to flow completely to icodine production, and directly knocking out TCA cycle-related genes will cause the growth activity of the bacteria to be seriously reduced. Therefore, it is necessary to further study the method of producing icodine by biological fermentation.

[0012] In view of the above-mentioned problems of PEP consumption and excessive glucose transport leading to the production of byproduct acetic acid and precursor aspartic acid, the present invention has finally provided a strategy for enhancing the production of icodine through repeated experiments, including 1) expressing the glucose-promoting gene of Zymomonas mobilis in Escherichia coli glf and overexpression of glucokinase glk while reducing ptsG Preferably, it also includes 2) enhancing the expression of the gene encoding PEP to OAA phosphoenolpyruvate carboxylase ppc (Overexpression of phosphoenolpyruvate carboxylase ppc ), enhance the production pathway flux of synthetic aspartic acid; more preferably also includes 3) simultaneously controlling the growth key gene isocitrate dehydrogenase icd Expression of icd The transformation method of the present invention can improve the production efficiency of icodone and reduce the cost of industrial production of icodone.

[0013] The present invention also provides the use of the above-mentioned recombinant microorganism in fermentation production of icodone, genetic breeding of microorganisms for producing icodone, or improving the yield of biosynthesized icodone.

[0014] The present invention also provides a method for producing icodone by fermentation, which comprises the step of culturing the above-mentioned recombinant microorganism.

[0015] The present invention also provides a method for constructing a recombinant microorganism for producing icodoin, which comprises causing a starting strain to express the ectABC Gene, expression of glucose-promoting gene of Zymomonas mobilis glf while reducing ptsG gene expression, and also overexpressed the step of glucose kinase glk; Preferably, the method further comprises the step of causing the starting strain to overexpress phosphoenolpyruvate carboxylase ppc; More preferably, the isocitrate dehydrogenase gene of the starting strain is also included icd The step of replacing the original promoter with a growth phase-dependent promoter, wherein the sequence of the growth phase-dependent promoter is shown in SEQ ID No.8 or SEQ ID No.60.

[0016] In the method of the present invention, the glucose promoting gene of Zymomonas mobilis is expressed glf while reducing ptsG The gene expression method is: using the glucose-promoting gene of Zymomonas mobilis glf replace ptsG Gene; And / or, the method of overexpressing glucose kinase glk is: glk Replace the original promoter with Ptrc promoter or add glucokinase gene glk The copy number of the Ptrc promoter is shown in SEQ ID No.4; And / or, the method of overexpressing phosphoenolpyruvate carboxylase ppc is: ppc The original promoter was replaced by P J23110 phosphoenolpyruvate carboxylase gene ppc The copy number of P J23110 The sequence of the promoter is shown in SEQ ID No.6; And / or, the starting strain is Escherichia coli.

[0017] The beneficial effects of the present invention are at least: The present invention provides a recombinant microorganism that can significantly increase the yield and yield of icodine without significantly affecting the growth performance of the bacteria. The production of icodine using the recombinant microorganism can improve the industrial production efficiency and reduce the production cost of icodine. DETAILED DESCRIPTION

[0018] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0019] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available or prepared according to conventional methods in the art unless otherwise specified.

[0020] Example 1 Expression of Zymomonas mobilis in Escherichia coli glf , overexpression of glucokinase gene glk while reducing ptsG Gene expression and establishment of metabolic pathways for ectoin production In this example, the key enzyme gene of the phosphotransferase system (PTS) of Escherichia coli MG1655 ATCC 700926 was ptsG (Sequence as shown in SEQ ID No.1) replaced with the glucose-promoting gene of Zymomonas mobilis glf (sequence as shown in SEQID No.2); at the same time, the glucose kinase gene glk The original promoter (sequence shown in SEQ ID No. 3) of 100 μg / mL (NCBI sequence number 946858) was replaced with the Ptrc promoter (sequence shown in SEQ ID No. 4) to overexpress glucose kinase. glk .

[0021] 1. Using the genome of Escherichia coli MG1655 as a template, ptsG -UF(ttcagttcatgggccaacatcttcc, SEQ ID No.9) and ptsG -UR (agggctagtcgcgtgactagaccctgactgctcattccgtaagacgttggggagact, SEQ ID No.10) was used as primer for PCR to obtain the gene fragment ptsG -UP is about 1000 bp and the PCR product is purified. Zymomonas mobilis 29191, purchased from ATCC) as the template and primers glf -F (atctggctgccttagtctccccaacgtcttacggaatgagcagtcagggtctagtcac, SEQ ID No. 11) and glf -R (taaaaaaagcacccatactcaggagcactctcaattctacttctgggagcgccacatc, SEQ ID No.12) was used as primer for PCR to obtain the gene fragment glf (SEQ ID No.2) is about 1500 bp and the PCR product is purified. The genome of Escherichia coli MG1655 is used as a template and the primers ptsG -DF (tgaaatcgaggagatgtggcgctcccagaagtagaattgagagtgctcctgagtatgggt, SEQ ID No. 13) and ptsG -DR (accggttcctcatctttaagagagaca, SEQ ID No.14) was used as primer for PCR to obtain the gene fragment ptsG -DOWN is about 1100 bp and the PCR product is purified. ptsG -UP, glf , ptsG -DOWN overlap PCR was performed to obtain the target fragment.

[0022] Plasmid pTarget (see Jiang, Y., Chen, B., Duan, CL, Sun, BB, Yang,JJ, and Yang, S. (2015) Multigene editing in the Escherichia coli genomevia the CRISPR-Cas9 system. Appl Environ Microbiol 81: 2506–2514.) was used as template and primers ptsG -N20-F (cagtggcatgtttgcaaagagttttagagctagaaatagcaagttaaaataaggct, SEQ IDNo.15) and ptsG -N20-R (tctttgcaaacatgccactgactagtattatacctaggactgagctagctgtcaag, SEQ ID No.16) was amplified to obtain pTarget- ptsG .

[0023] The targeting fragment and plasmid pTarget- ptsG The plasmid pCas9 was transformed into Escherichia coli MG1655 by electroporation. The electroporation conditions were 2.5KV, 200Ω, and 25μF (the width of the electroporation cup was 2mm). The recombinant bacteria were screened and named MG1655-Δ ptsG :: glf .

[0024] 2. Using the genome of Escherichia coli MG1655 as a template, glk -UF (tctcatccagccctttaaacagcgaaa, SEQ ID No. 17) and glk -UR (tcttaaacattatacgagccggatgattaattgtcaatttcagcaccaattgcagcgatg, SEQ ID No.18) was used as primer for PCR to obtain the gene fragment glk -UP is about 1000 bp and the PCR product is purified. The genome of Escherichia coli MG1655 is used as a template and the primers glk -DF (tcgtataatgtttaagaaggagatatacatatgacaaagtatgcattagtcggtgatgtg, SEQ ID No. 19) and glk -DR (ctattcggcgcaaaatcaacgtgaccgcctt, SEQ ID No. 20) was used as primer for PCR to obtain the gene fragment glk -DOWN is about 1100 bp and the PCR product is purified. glk -UP, glk -DOWN overlap PCR was performed to obtain the target fragment.

[0025] Plasmid pTarget was used as template (Jiang, et al. 2015) and primers glk -N20-F (tttctcacactgtaaataccgttttagagctagaaatagcaagttaaaataaggct, SEQ ID No. 21) and glk -N20-R (ggtatttacagtgtgagaaaactagtattatacctaggactgagctagctgtcaag, SEQ ID No.22) was amplified to obtain pTarget- glk . Using an electroporator (Bio-Rad), the targeting fragment and plasmid pTarget- glk The plasmid pCas9 was transformed into Escherichia coli MG1655-Δ ptsG :: glf The electric shock conditions were 2.5KV, 200Ω, and 25μF (the width of the electric shock cup was 2mm). The recombinant bacteria were screened and named MG1655-Δ ptsG :: glf -P trc - glk .

[0026] 3. Halobacterium salinarum Chromohalobacter salexigens BAA-138, purchased from ATCC) as the template, and primers ectA -F(atggcccttcctgcacgctccgat, SEQ ID No.23) and ectC -R (tcaaggggcttcacgtaacgc, SEQ ID No.24) was used as primer for PCR to obtain the gene fragment ectABC (SEQ ID No. 25), the fragment was connected to the vector pTrc99a, and the obtained recombinant plasmid was named pTrc99a- ectABC . The recombinant plasmid pTrc99a- ectABC By electroporation (conditions as above), the cells were transformed into MG1655 and MG1655-Δ ptsG :: glf -Ptrc - glk The obtained recombinant strains were named MG1655 / pTrc99a- ectABC and MG1655-Δ ptsG :: glf -P trc - glk / pTrc99a- ectABC .

[0027] Example 2 Increase of Glucokinase Gene glk The number of copies In this example, Zymomonas mobilis was expressed glf Gene and reduce ptsG coli, further by adding the glucokinase gene glk Overexpression of the glucokinase gene in a copy number manner glk , and establish the metabolic pathway of ectoine production. The details are as follows: In this example, the glucokinase gene of Escherichia coli MG1655 ATCC 700926 was used to glk Replacement in pseudogene yjiT (Sequence as SEQ ID No.42) at the site to increase one copy glk Gene.

[0028] The genome of Escherichia coli MG1655 was used as template and primers yjiT -UF (gttcaagctgttcagcctgtgct, SEQ ID No. 43) and yjiT -UR (ccgcccacatcaccgactaatgcatactttgtcatcaaaacagcattacagccagcagga, SEQ ID No.44) was used as primer for PCR to obtain the gene fragment yjiT -UP is about 1000 bp and the PCR product is purified. The genome of Escherichia coli MG1655 is used as a template and the primers glk -F (cagtacttcctgctggctgtaatgctgttttgatgacaaagtatgcattagtcggtgatg, SEQ ID No. 45) and glk -R (gaaaaaatagttgttgccgcctgagtaactatacttacagaatgtgacctaaggtctggc, SEQ ID No.46) was used as primer for PCR to obtain the gene fragment glk The PCR product was purified using the genome of Escherichia coli MG1655 as template and primers yjiT -DF (ttacgccagaccttaggtcacattctgtaagtatagttatactcaggcggcaacaactattt, SEQ ID No. 47) and yjiT -DR (cgacaaaataacccgaacgcgg, SEQ ID No.48) was used as primer for PCR to obtain the gene fragment yjiT -DOWN is about 1100 bp and the PCR product is purified. yjiT -UP, glk , yjiT -DOWN overlap PCR was performed to obtain the target fragment.

[0029] Plasmid pTarget was used as template (Jiang, et al. 2015) and primers yjiT -N20-F (catcgtcgttggtgaaacgggttttagagctagaaatagcaagttaaaataaggct, SEQ ID No. 49) and yjiT -N20-R (ccgtttcaccaacgacgatgactagtattatacctaggactgagctagctgtcaag, SEQ ID No.50) was amplified to obtain pTarget- yjiT . Using an electroporator (Bio-Rad), the targeting fragment and plasmid pTarget- yjiT The plasmid pCas9 was transformed into the Escherichia coli MG1655-Δ prepared in Example 1 by electroporation. ptsG :: glf The electric shock conditions were 2.5KV, 200Ω, and 25μF (the width of the electric shock cup was 2mm). The recombinant bacteria were screened and named MG1655-Δ ptsG :: glf -Δ yjiT :: glk .

[0030] The recombinant plasmid pTrc99a- ectABC Transformed into MG1655-Δ ptsG :: glf -Δ yjiT :: glk The obtained recombinant strain was named MG1655-Δ ptsG :: glf -Δ yjiT :: glk / pTrc99a- ectABC .

[0031] Example 3 Overexpression of phosphoenolpyruvate carboxylase ppc This example further introduces the phosphoenolpyruvate carboxylase gene of Escherichia coli MG1655 ATCC 700926 ppc The original promoter (sequence shown in SEQ ID No. 5) of (NCBI sequence number 948457) was replaced by P J23110 Promoter (sequence as shown in SEQ ID No.6) to overexpress phosphoenolpyruvate carboxylase gene ppc .

[0032] The genome of Escherichia coli MG1655 was used as template and primers ppc -UF (tggaaacacggtttatcaagcccacc, SEQ ID No. 26) and ppc -UR (aaagctagcattgtacctaggactgagctagccgtaaattttataaagccacgtaaaagcggtgacgt, SEQ ID No.27) was used as primer for PCR to obtain the gene fragment ppc -UP is about 600 bp and the PCR product is purified. The genome of Escherichia coli MG1655 is used as a template and the primers ppc -DF (tcctaggtacaatgctagctttaagaaggagatatacatatgaacgaacaatattccgcattgcgt, SEQ ID No. 28) and ppc -DR (ggcttggacgcagcttacgg, SEQ ID No.29) was used as primer for PCR to obtain the gene fragment ppc -DOWN about 600bp and PCR product purification. ppc -UP, ppc -DOWN overlap PCR was performed to obtain the target fragment. Plasmid pTarget was used as template (Jiang, et al. 2015) and primers ppc -N20-F (ttcgcgccaatgcgacgtgagttttagagctagaaatagcaagttaaaataaggct, SEQ ID No. 30) and ppc -N20-R (tcacgtcgcattggcgcgaaactagtattatacctaggactgagctagctgtcaag, SEQ ID No.31) was amplified to obtain pTarget- ppc . Using an electroporator (Bio-Rad), the targeting fragment and plasmid pTarget- ppc The plasmid pCas9 was transformed into the Escherichia coli MG1655-Δ prepared in Example 1 by electroporation. ptsG :: glf -P trc - glk The electric shock conditions were 2.5KV, 200Ω, and 25μF (the width of the electric shock cup was 2mm). The recombinant bacteria were screened and named MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc .

[0033] The recombinant plasmid pTrc99a- ectABC Transformed into MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc The obtained recombinant strain was named MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc / pTrc99a- ectABC .

[0034] Example 4 Increasing phosphoenolpyruvate carboxylase ppc The number of copies This example further introduces the phosphoenolpyruvate carboxylase gene of Escherichia coli MG1655 ATCC 700926 ppc Replacement in pseudogene yjgX (Sequence as SEQ ID No.51) at the site to add a copy ppc Gene.

[0035] The genome of Escherichia coli MG1655 was used as template and primers yjgX -UF (acattagactgcttgcatcagccag, SEQ ID No.52) and yjgX -UR (acattactacgcaatgcggaatattgttcgttcattgtaggttctgaaccggttctagcg, SEQ ID No.53) was used as primer for PCR to obtain the gene fragment yjgX -UP is about 1000 bp and the PCR product is purified. The genome of Escherichia coli MG1655 is used as a template and the primers ppc -F (tcacaaccccgctagaaccggttcagaacctacaatgaacgaacaatattccgcattgcg, SEQ ID No. 54) and ppc -R (gaaatataggggcaaatccaccttgtgctgatatgttagccggtattacgcatacctgcc, SEQ ID No.55) was used as primer for PCR to obtain the gene fragment ppc The PCR product was purified using the genome of Escherichia coli MG1655 as template and primers yjgX -DF (ccgggattgcggcaggtatgcgtaataccggctaacatatcagcacaaggtggatttgcc, SEQ ID No. 56) and yjgX -DR (aggaagtcttactgctgtcgcc, SEQ ID No.57) was used as primer for PCR to obtain the gene fragment yjgX -DOWN is about 1100 bp and the PCR product is purified. yjgX -UP, ppc , yjgX -DOWN overlap PCR was performed to obtain the target fragment.

[0036] Plasmid pTarget was used as template (Jiang, et al. 2015) and primers yjgX -N20-F (catcgtcgttggtgaaacgggttttagagctagaaatagcaagttaaaataaggct, SEQ ID No. 58) and yjgX -N20-R (ccgtttcaccaacgacgatgactagtattatacctaggactgagctagctgtcaag, SEQ ID No.59) was amplified to obtain pTarget- yjgX . Using an electroporator (Bio-Rad), the targeting fragment and plasmid pTarget- yjgX The plasmid pCas9 was transformed into the Escherichia coli MG1655-Δ prepared in Example 2 by electroporation. ptsG :: glf -Δ yjiT :: glk The electric shock conditions were 2.5KV, 200Ω, and 25μF (the width of the electric shock cup was 2mm). The recombinant bacteria were screened and named MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc .

[0037] The recombinant plasmid pTrc99a- ectABC Transformed into MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc The obtained recombinant strain was named MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc / pTrc99a- ectABC .

[0038] Example 5 Replacing Escherichia coli with a growth phase-dependent promoter icd The original promoter This example further introduces the isocitrate dehydrogenase gene of Escherichia coli MG1655 ATCC 700926 icd The original promoter (sequence shown in SEQ ID No. 7) of (NCBI sequence number 945702) was replaced by P rpsL The promoter (sequence shown in SEQ ID No.8) and P rpsJ Promoter (sequence shown in SEQ ID No.60).

[0039] The genome of Escherichia coli MG1655 was used as template and primers icd -UF (gtaatcacccatcgcatagc, SEQID No.32) and icd -UR (agccaagcttgcatgcctgcaggtcaccaggttaagcgattcag, SEQ ID No.33) was used as primer for PCR to obtain the gene fragment icd -UP was about 1000 bp and the PCR product was purified. The genome of Escherichia coli MG1655 was used as a template and the primers rpsL -F (acctgcaggcatgcaagcttggcttcgtcagacttacggttaagc, SEQ ID No.34) and rpsL -R(ggatcctttctcctctttgaattctatgaggacgccgaatttta, SEQ IDNo.35); rpsJ -F (acctgcaggcatgcaagcttggctgtgtcaaaaatgcactgaacga, SEQ ID No. 36) and rpsJ -R (ggatcctttctcctctttgaattcaactacgacaagcccgcgcattata, SEQ ID No.37) was used as primer for PCR to obtain the gene fragment rpsL , rpsJ The PCR product was purified using the genome of Escherichia coli MG1655 as template and primers icd -DF(gaattcaaagaggagaaaggatccatggaaagtaaagtagttgt, SEQ IDNo.38) and icd -DR (catctcttcacgcaggaatt, SEQ ID No.39) was used as primer for PCR to obtain the gene fragment icd -DOWN about 600bp and PCR product purification. icd -UP, rpsL , icd -DOWN and icd -UP, rpsJ , icd -DOWN for overlapping PCR to obtain the target fragment rpsL - icd and rpsJ - icd .

[0040] Plasmid pTarget was used as template (Jiang, et al. 2015) and primers icd -N20-F (ataacgcgcatctttcatgagttttagagctagaaata, SEQ ID No. 40) and icd -N20-R (tcatgaaagatgcgcgttatactagtattatacctaggac, SEQ ID No.41) was amplified to obtain pTarget- icd The targeting fragment was electroporated using an electroporator (Bio-Rad). rpsL - icd / rpsJ - icd , plasmid pTarget- icd The plasmid pCas9 was transformed into the Escherichia coli MG1655-Δ prepared in Example 3 by electroporation. ptsG :: glf -P trc - glk -P J23110 - ppc and MG1655-Δ prepared in Example 4 ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc The electric shock conditions were 2.5KV, 200Ω, and 25μF (the width of the electric shock cup was 2mm). The recombinant bacteria were screened and named MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsL - icd 、MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsJ - icd 、MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsL - icd and MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsJ - icd .

[0041] The recombinant plasmid pTrc99a- ectABC The recombinant strains were transformed into the above-mentioned recombinant strains by electroporation (conditions as above), and the obtained recombinant strains were named MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsL - icd / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsJ - icd / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsL - icd / pTrc99a- ectABC and MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsJ - icd / pTrc99a- ectABC .

[0042] Example 6 Fermentation and cultivation of recombinant Escherichia coli to produce Ecodoxin The recombinant strain MG1655 / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc - glk / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -Δ yjiT :: glk / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsL - icd / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -P trc - glk -P J23110 - ppc -P rpsJ - icd / pTrc99a- ectABC 、MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsL - icd / pTrc99a- ectABC and MG1655-Δ ptsG :: glf -Δ yjiT :: glk -Δ yjgX :: ppc -P rpsJ - icd / pTrc99a- ectABC Grow overnight on Amp plates. Inoculate a single colony from the fresh plate into an LB tube containing 5 ml Amp and culture at 37°C, 200 rpm for 12 hours.

[0043] Inoculate 5% of the inoculum into a 500 ml baffled shake flask containing 50 ml of fermentation medium and culture at 37°C and 200 rpm until OD 600 was 0.6, 0.1 mM IPTG was added and cultured for 48 h.

[0044] The formula of fermentation medium per liter includes: 20g of glucose, 0.8g of magnesium sulfate heptahydrate, 4g of diammonium hydrogen phosphate, 6.67g of potassium dihydrogen phosphate, 1.35g of potassium citrate, 20.9g of 3-morpholinepropanesulfonic acid, 2.5g of yeast powder, 50mg of ferrous sulfate heptahydrate, 10mg of calcium chloride dihydrate, 11mg of zinc sulfate heptahydrate, 2.5mg of manganese sulfate tetrahydrate, 5mg of copper sulfate pentahydrate, 0.5mg of ammonium molybdate, and 0.1mg of sodium borate decahydrate.

[0045] During the fermentation process, the product concentration was detected by liquid chromatography, and the growth of the strain was tested. The results are shown in Tables 1 and 2. glf ,reduce ptsG Expression, overexpression glk And further overexpression ppc ,replace icd The recombinant bacteria obtained after the original promoter was compared with the control strain MG1655 / pTrc99a- ectABC In comparison, without affecting the bacteria, the yield and production efficiency of Icodoin have been greatly improved.

[0046] Table 1 Growth of different strains (OD 600 )

[0047] Table 2 Yield of icotinamide from different strains (g / L)

[0048] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A recombinant microorganism, characterized in that Compared with the starting strain, the recombinant microorganism expresses ectABC Gene, expression of glucose-promoting gene of Zymomonas mobilis glf while reducing ptsG Gene expression, and also overexpressed glucose kinase glk.

2. The recombinant microorganism according to claim 1, characterized in that The glucose-promoting gene expressing Zymomonas mobilis glf while reducing ptsG The gene expression method is: using the glucose-promoting gene of Zymomonas mobilis glf replace ptsG Gene; And / or, the method of overexpressing glucose kinase glk is: glk Replace the original promoter with Ptrc promoter or add glucokinase gene glk The copy number of the Ptrc promoter is shown in SEQ ID No.

4.

3. The recombinant microorganism according to claim 1, characterized in that Compared with the starting strain, the recombinant microorganism also overexpresses phosphoenolpyruvate carboxylase ppc.

4. The recombinant microorganism according to claim 3, characterized in that The method of overexpressing phosphoenolpyruvate carboxylase ppc is: ppc The original promoter was replaced by P J23110 phosphoenolpyruvate carboxylase gene ppc The copy number of P J23110 The sequence of the promoter is shown as SEQ ID No.

6.

5. The recombinant microorganism according to claim 3, characterized in that Compared with the starting strain, the recombinant microorganism also replaces the isocitrate dehydrogenase gene with a growth phase-dependent promoter. icd The original promoter of the growth phase-dependent promoter is shown in SEQ ID No.8 or SEQ ID No.

60.

6. The recombinant microorganism according to any one of claims 1 to 5, characterized in that Said ectABC The gene is shown in SEQ ID No.25, glf The gene is shown in SEQ ID No. 2, ptsG The gene is shown as SEQ ID No. 1; And / or, the starting strain is Escherichia coli.

7. Use of the recombinant microorganism described in any one of claims 1 to 6 in the fermentation production of icodine, genetic breeding of microorganisms for producing icodine, or improving the yield of icodine synthesized by biological methods.

8. A method for producing icodone by fermentation, characterized in that: The method comprises the step of culturing the recombinant microorganism according to any one of claims 1 to 6.

9. A method for constructing a recombinant microorganism for producing icodoin, characterized in that: The starting strain expresses ectABC Gene, expression of glucose-promoting gene of Zymomonas mobilis glf while reducing ptsG The expression of genes and also overexpressed the step of glucose kinase glk.

10. The method according to claim 9, characterized in that The method also includes the step of causing the starting strain to overexpress phosphoenolpyruvate carboxylase ppc; or further includes causing the starting strain to overexpress isocitrate dehydrogenase gene icd The step of replacing the original promoter with a growth phase-dependent promoter, wherein the sequence of the growth phase-dependent promoter is shown in SEQ ID No.8 or SEQ ID No.60; and / or, the glucose promoting gene of Zymomonas mobilis is expressed glf while reducing ptsG The gene expression method is: using the glucose-promoting gene of Zymomonas mobilis glf replace ptsG Gene; And / or, the method of overexpressing glucose kinase glk is: glk Replace the original promoter with Ptrc promoter or add glucokinase gene glk The copy number of the Ptrc promoter is shown in SEQ ID No.4; And / or, the starting strain is Escherichia coli.

Images