A porcine IPO4 gene knockout cell line and its construction method and application

By constructing the porcine kidney cell line PK15-KO-IPO4 and knocking out the IPO4 gene using CRISPR/Cas9 technology, the problem of the unknown function of IPO4 in PCV2 virus replication was solved, significant inhibition of viral replication was achieved, new ideas for drug development were provided, and a stable cell model for inhibiting PCV2 virus replication was constructed.

CN120098934BActive Publication Date: 2025-09-19INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE JIANGXI ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510267432.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-09-19
Estimated Expiration
2045-03-07

AI Technical Summary

Technical Problem

In the existing technology, there is little research on the function of the nuclear transport protein IPO4 of porcine circovirus type II (PCV2) in viral replication, and there is a lack of effective drug targets and mechanism research, resulting in insufficient research and development of antiviral drugs.

Method used

The porcine kidney cell line PK15-KO-IPO4 was constructed, and the IPO4 gene was knocked out using CRISPR/Cas9 technology. An sgRNA targeting IPO4 was designed and a CRISPR/Cas9 vector was constructed. The IPO4 gene knockout cell line was screened and its inhibitory effect on PCV2 virus replication was verified.

Benefits of technology

It significantly inhibits PCV2 virus replication, provides new drug targets and ideas, and provides model cells for the development of drugs to prevent and treat PCV2. The cell line stably silences the IPO4 gene within 30 generations and maintains high cell viability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120098934B_ABST
    Figure CN120098934B_ABST
Patent Text Reader

Abstract

The present invention discloses a porcine IPO4 gene knockout cell line, a construction method and an application thereof, and belongs to the field of genetic engineering technology. The porcine IPO4 gene knockout cell line of the present invention is named porcine kidney cell PK15-KO-IPO4, and is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: C202541 and a deposit date of January 7, 2025. The present invention verifies that after the IPO4 gene is knocked out, the cells can significantly inhibit the replication of the PCV2 virus, revealing the association between the IPO4 gene and the replication of the PCV2 virus, and providing new targets and ideas for the research and development of drugs for the prevention and treatment of PCV2. The cell line constructed by the present invention can stably silence the IPO4 gene and significantly inhibit the replication of the PCV2 virus. It can be used as a cell line for the research and development of drugs for the prevention and treatment of PCV2 and for studying the replication mechanism of porcine circovirus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a porcine IPO4 gene knockout cell line and a construction method and application thereof. Background Art

[0002] Porcine circovirus type II (PCV2) is a pathogen characterized by multisystemic worrisome failure (PMWS). It is now widespread and prevalent in all pig-raising countries. It is an immunosuppressive disease that severely compromises pig production and causes significant losses to my country's pig industry. Despite the discovery and research of PCV2, nearly 40 years have passed, and our understanding of its virological characteristics and pathogenicity remains incomplete, with many unresolved questions. Currently, virus-targeted nuclear transporters are a key target for antiviral drug development. Synthetic peptides or peptidomimetics that mimic viral binding to transporters can effectively inhibit viral replication, achieving antiviral effects. PCV2 replicates intranuclearly, and the entry of the virus and viral proteins into the cell nucleus is a critical step in viral replication. However, limited research has been conducted on the regulation of PCV2 replication by nuclear transporters, and the function of the transporter protein IPO4 in PCV2 replication has not yet been reported. Summary of the Invention

[0003] The present invention aims to provide a porcine IPO4 gene knockout cell line, its construction method, and its application to address the aforementioned problems of the prior art. This invention demonstrates that knockout of the IPO4 gene significantly inhibits PCV2 replication in cells, revealing the link between the IPO4 gene and PCV2 replication. This provides a new target and approach for the development of drugs to prevent and treat PCV2. The cell line constructed in this invention stably silences the IPO4 gene and significantly inhibits PCV2 replication, making it suitable for the development of drugs to prevent and treat PCV2 and for studying the replication mechanism of porcine circovirus.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides an IPO4 gene knockout pig kidney cell (Sus scrofa) PK15-KO-IPO4, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: C202541 and a deposit date of January 7, 2025.

[0006] The present invention also provides a method for constructing the above-mentioned pig kidney cell PK15-KO-IPO4, comprising the following steps:

[0007] (1) Designing sgRNA targeting the IPO4 gene and obtaining double-stranded sgRNA-oligo after annealing;

[0008] (2) connecting the double-stranded sgRNA-oligo to the CRISPR / Cas9 vector to obtain the IPO4 gene knockout vector;

[0009] (3) transfecting the IPO4 gene knockout vector into pig kidney PK15 cells, and obtaining the pig kidney cell PK15-KO-IPO4 through screening and subcloning;

[0010] The sgRNA is IPO4-sgRNA, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0011] Optionally, the CRISPR / Cas9 vector includes a PX459 plasmid.

[0012] Furthermore, the connection method is to insert the double-stranded sgRNA-oligo into the BbsI restriction site of the PX459 plasmid.

[0013] Optionally, the screening method is to use a culture medium containing purine toxin to screen positive cells for IPO4 gene knockout.

[0014] The present invention also provides a use of the porcine kidney cell PK15-KO-IPO4 or the porcine kidney cell PK15-KO-IPO4 constructed by the above construction method in preparing a drug for inhibiting porcine circovirus replication.

[0015] The present invention also provides a use of the pig kidney cell PK15-KO-IPO4 or the pig kidney cell PK15-KO-IPO4 constructed by the above construction method in screening drugs for inhibiting porcine circovirus replication.

[0016] The present invention also provides an application of the porcine kidney cell PK15-KO-IPO4 or the porcine kidney cell PK15-KO-IPO4 constructed by the above construction method in studying the replication mechanism of porcine circovirus.

[0017] The present invention also provides the use of a reagent for inhibiting or silencing IPO4 gene expression in the preparation of a drug for inhibiting porcine circovirus replication.

[0018] Optionally, the reagent includes an sgRNA that targets and knocks out the IPO4 gene; the sgRNA is IPO4-sgRNA, and the nucleotide sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0019] The present invention also provides an sgRNA for targeted knockout of the IPO4 gene, wherein the sgRNA is IPO4-sgRNA, and the nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0020] The present invention discloses the following technical effects:

[0021] This study designed a sgRNA targeting the porcine IPO4 gene and constructed an IPO4 knockout cell line. Western blotting assays for IPOP4 protein and PCV2 Cap protein confirmed that knockout of the IPO4 gene significantly inhibited PCV2 replication and Cap protein expression in the cells. This study reveals the link between the IPO4 gene and PCV2 replication, providing new targets and insights for the development of drugs to prevent and treat PCV2.

[0022] The IPO4 gene knockout cell line constructed by the present invention is suitable for growth in a DMEM high-glucose culture medium containing 10% fetal bovine serum, with a cell doubling time of 36 hours. The IPO4 gene can still be stably silenced after cell passage to the 30th generation, and no IPO4 protein is expressed. The cell line can significantly inhibit the replication of the PCV2 virus and can be used as a model cell for the development of drugs for the prevention and treatment of PCV2, and as a cell line for studying the replication mechanism of porcine circovirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 This is the sequencing result of the PX459-IPO4-KO knockout plasmid;

[0025] Figure 2 Figure 2 is the Western blotting detection result of IPO4 protein in PK15-IPO4-KO cells and PK15-WT cells;

[0026] Figure 3 Figure 2 is the sequencing results of IPO4 gene in PK15-IPO4-KO cells and PK15-WT cells;

[0027] Figure 4 Figure 2 shows the results of Western blotting detection of IPO4 protein in PK15-IPO4-KO cells at passages 5, 10, 15, 20, and 30, and in PK15-WT cells at passage 30;

[0028] Figure 5 Figure 2 shows the cell viability assay results of PK15-IPO4-KO cells and PK15-WT cells;

[0029] Figure 6 Figure 2 is the Western blotting detection result of Cap protein in PK15-IPO4-KO cells and PK15-WT cells infected with PCV2;

[0030] Figure 7 The PCV2 replication status after PK15-IPO4-KO cells and PK15-WT cells were infected with PCV2. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] The experimental materials and sources used in the examples of the present invention are as follows:

[0037] DMEM high-glucose medium and 0.25% trypsin were purchased from Sewell Biotechnology; fetal bovine serum was purchased from Sigma; sgRNA sequences and identification primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.; IPO4 monoclonal antibody was purchased from abcam; β-actin monoclonal antibody was purchased from Hangzhou Huaan Biotechnology Co., Ltd.; PCV2 Cap protein monoclonal antibody was purchased from Hangzhou Dayao Biotechnology Co., Ltd.; HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-mouse IgG were purchased from KPL; Lipo2000 transfection reagent was purchased from Novezan Biotechnology Co., Ltd.; Bbs1 restriction endonuclease was purchased from New England Biolabs; PMD19-T vector was purchased from Takara; plasmid extraction kit and blood / cell / tissue genomic DNA extraction kit were purchased from Zhejiang Easyside Biotechnology Co., Ltd.; PX459 plasmid, PK15 cell line, and PCV2 strain were all preserved by the Jiangxi Provincial Animal Husbandry and Veterinary Research Institute.

[0038] The experimental methods in the examples of the present invention are conventional methods unless otherwise specified; the experimental materials used in the examples, in addition to the sources mentioned above, can also be purchased from conventional biochemical reagent companies unless otherwise specified.

[0039] Example 1 Construction and Identification of the Porcine IPO4 Gene Knockout Plasmid PX459-IPO4-KO Plasmid

[0040] 1. Primer design and synthesis

[0041] Using the Ensembl porcine IPO4 reference nucleic acid sequence (IPO4: ENSSSSCG0000000200) as a template, the sgRNA sequence GGCACCAACATCCGCGCAAG (SEQ ID NO. 1) was designed using the CRISPR guide RNA online design tool (http: / / crispor.tefor.net / ). A CACCG sticky end was added to the 5' end of the forward sequence, an AAAC sticky end was added to the 5' end of the reverse sequence, and a C base was added to the 3' end. A primer pair was designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The sequences are as follows:

[0042] IPO4-sgRNA-F: 5'-CACCGGGCACCAACATCCGCGCAAG-3' (SEQ ID NO. 2);

[0043] IPO4-sgRNA-R: 5'-AAACCTTGCGCGGATGTTGGTGCCC-3' (SEQ ID NO. 3).

[0044] 2. Construction and identification of knockout plasmid (PX459-IPO4-KO)

[0045] The primers in the primer pair were diluted to 50 μM respectively, and 10 μL of each was mixed and annealed. The annealing conditions were: directly placed in boiled water, and the sample was taken out after natural cooling to room temperature to form a double-stranded sgRNA-oligo. At the same time, the PX459 plasmid was digested with the endonuclease BbsI at 37°C for 1 hour, and the digestion product was recovered using a PCR recovery kit. The enzyme-purified PX459 was ligated with the double-stranded sgRNA-oligo overnight. The ligation product was transformed into DH5a competent cells, cultured at 37°C overnight, and then the cloned plaques were picked and sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The sequencing results are as follows Figure 1 After the successful clone was selected and expanded, the plasmid was extracted and named PX459-IPO4-KO.

[0046] Example 2 Screening and identification of PK15 cell lines with IPO4 gene knockout

[0047] 1. Construction and screening of IPO4 knockout PK15 cell lines

[0048] After PK15 cells have recovered and stably passaged for 3-4 generations, they are plated into six-well plates. When the cell confluency reaches 70%-90%, the successfully constructed PX459-IPO4-KO plasmid is transfected into PK15 cells using lipo2000 transfection reagent. At the same time, the PX459 empty vector is transfected as a negative control group. The specific transfection steps are as follows:

[0049] (1) Add 200 μL of DMEM serum-free medium to a 1.5 mL sterile centrifuge tube and add 10 μL of Lipomaster 2000 Reagent. Mix gently with a pipette.

[0050] (2) Add 200 μL of DMEM serum-free medium to a 1.5 mL sterile centrifuge tube, add 5 μg of plasmid, mix gently, and let the mixture stand for 5 minutes;

[0051] (3) Add the plasmid / DMEM dropwise to the Lipomaster 2000 Reagent / DMEM solution, mix gently with a pipette, and let it stand at room temperature for 15 minutes before transfection. During transfection, add the Lipomaster 2000 Reagent / DNA complex mixture dropwise to the culture medium, gently shake the culture dish to evenly disperse it, and finally culture the cells in a 37°C, 5% CO2 incubator. Six hours after transfection, switch to fresh culture medium and continue culturing for 48 hours. The medium was then changed to medium containing 5 μg / mL puromycin and cultured for a further 96 h, with the medium containing puromycin changed every 48 h. At this point, most of the untransfected negative cells had died, and the remaining positive cells were cultured in medium containing 20% ​​serum and without puromycin for a further 72-96 h. After the positive cells had significantly proliferated, the cells were digested and an appropriate amount of cells were diluted serially in the first column of a 96-well cell culture plate. Approximately 80 well-growing cells were aspirated from one well and thoroughly suspended and mixed in 18 mL of DMEM medium containing 20% ​​serum. 200 μL / well was then added to the remaining wells of the 96-well cell culture plate. The 96-well plate was then incubated in a cell culture incubator. After 5 days, wells containing single cells were observed under an inverted microscope and marked. Once the cells reached approximately 50% growth, they were expanded to 48-well, 24-well, and 6-well plates. The knockout cell line was designated PK15-IPO4-KO, and the negative control cells were designated PK15-WT.

[0052] 2. Identification of IPO4 gene knockout cell lines

[0053] Western blotting was used to detect IPO4 gene knockout cell lines. PK15-IPO4-KO and PK15-WT cells were collected separately, lysed with RIPA lysis buffer, added with 5× protein loading buffer, and boiled in a 100°C water bath for 10 minutes. Centrifuged at 12,000 rpm for 10 minutes, and the supernatant was used to determine the protein concentration by BCA. The amount of sample loaded in each well was kept consistent for SDS-PAGE electrophoresis. After the electrophoresis, the protein was transferred to the NC membrane and blocked with 5% skim milk at 37°C for 30 minutes. The primary antibodies were IPO4 rabbit monoclonal antibody and β-Actin mouse monoclonal antibody, respectively, and incubated at 4°C overnight. The secondary antibodies were HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-mouse IgG, respectively, and incubated at room temperature for 1 hour. During this period, PBST was used to wash 5 times for 5 minutes each time, and finally the ECL ultrasensitive chemiluminescence kit was used for development. The results are shown as follows. Figure 2 As shown, IPO4 protein could not be detected in the IPO4 gene knockout cell line, while IPO4 protein bands were present in the control group.

[0054] The knockout effect of IPO4 was further confirmed by gene sequencing. PK15-IPO4-KO and PK15-WT cells were collected and total DNA was extracted from each cell line using a DNA extraction kit. PCR amplification was performed using primers for IPO4 gene detection. The total reaction volume (50 μL) consisted of 25 μL of 2× Rapid Taq Master Mix, 100 ng of DNA template, and 10 pmol each of the IPO4 gene DNA detection primers: PK15-IPO4-F (5'-GGTGGGCTCTCCTGGGCTCCTCTTCTATTC-3', SEQ ID NO. 4) and PK15-IPO4-R (5'-AGTCACAAGGCTTCAGTGCTCTCCTCTGGT-3', SEQ ID NO. 5). The volume was filled to 50 μL with ddH2O. The reaction procedure was as follows: 95°C for 2 min; 94°C for 30 sec; 54°C for 30 sec; 72°C for 30 sec; 72°C for 5 min; and storage at 16°C. Take 10μL of PCR product for agarose gel electrophoresis identification. Purify and recover the PCR product of the identified amplified sample. After recovery, connect it to the PMD-19T vector, the total system is 10μL: pMD19-T Vector 0.5μL; Solution I 5μL; PCR recovery product 4.5μL; react at 16℃ overnight. Add 10μL of ligation product to DH5a competent cells and place it on ice for 20min; heat at 42℃ for 90sec, and then place it on ice for 2min. Evenly spread the suspension on an agar plate medium containing ampicillin resistance and culture for 12h. After a single colony is formed, select 3 white colonies for each sample and sequence them using pMD19-T Vector universal primers. Sequence comparison of wild type and IPO4 gene knockout cell lines is shown as follows. Figure 3 As shown, the PK15-IPO4-KO strain has a four-base deletion between the fourth and fifth bases of the PAM motif at the Cas9-predicted cleavage site, resulting in a shift in the IPO4 base sequence and an inability to encode the correct IPO4 amino acid sequence, indicating that the IPO4 gene has been successfully knocked out.

[0055] Example 3 Stability detection of PK15 cell line with IPO4 gene knockout

[0056] PK15-IPO4-KO and PK15-WT cells were continuously subcultured, and PK15-KO-IPO4 cells cultured to passages 5, 10, 15, 20, and 30, as well as PK15-WT cells at passage 30, were collected and Western Blotted for IPO4 protein. The detection process was as described in Example 2. The results are shown in FIG. Figure 4As shown, no IPO4 protein was detected in the PK15-KO-IPO4 cell line during 30 consecutive passages, while the IPO4 protein expression in the control group PK15-WT cell line was normal.

[0057] Example 4 Detection of PK15 Cell Viability by IPO4 Gene Knockout

[0058] PK15-IPO4-KO and PK15-WT cell lines were passaged separately, and approximately 2×10 5 The number of cells was 100 μL cell suspension per well. 4-6 replicates were made for the same sample. Culture medium was also added as a background control group. After 24 hours of cell inoculation, 10 μL CCK-8 solution was added to each well. The cells were placed in a cell culture incubator and continued to incubate for 2 hours. During this period, the cells were taken out and the absorbance was measured on a microplate reader at 450 nm. The readings were taken at a certain time for analysis. Cell viability (%) = (KO group OD - background control group OD) / (WT group OD - background control group OD) × 100. The results are shown in the figure. Figure 5 As shown, there was no significant difference in cell viability between the PK15-KO-IPO4 cell line and the wild-type PK15-WT cell line.

[0059] Example 5 Effect of IPO4 gene knockout cell line PK15-KO-IPO4 on PCV2 replication

[0060] 1. IPO4 gene knockout cell line infected with PCV2 to detect viral protein expression levels

[0061] PK15-WT cells and PK15-IPO4-KO cells were passaged separately and counted using a cell counting plate. Equal amounts of cells were plated onto 12-well culture dishes and cultured for 12-18 hours. When the cell confluence reached approximately 70-80%, PCV2 strains were inoculated at MOIs of 1, 10, and 25. After 2 hours of infection, the supernatant was discarded and replaced with a maintenance solution containing 2% of the same volume. The cells were cultured in an incubator at 37°C and 5% CO2 for 24 and 36 hours. The cells were then collected and the level of PCV2 Cap protein was detected by Western blotting. The detection process was similar to that in Example 2. The results are shown in FIG. Figure 6 As shown, it can be seen that the expression level of PCV2 Cap protein in IPO4 gene knockout PK15 cells was significantly reduced compared with the control group PK15-WT cells.

[0062] 2. Effect of PCV2 infection in IPO4 knockout cell lines on PCV2 virus replication

[0063] PK15-WT cells and PK15-IPO4-KO cells were passaged separately, counted using a cell counting plate, and equal amounts of cells were plated onto 12-well culture dishes and cultured for 12-18 hours. When the cell confluence was approximately 70-80%, the PCV2 strain was inoculated at an MOI of 1. After 2 hours of infection, the supernatant was discarded and replaced with the same volume of 2% maintenance solution. The cells were then placed in an incubator at 37°C, 5% CO2 and cultured for 36 hours. Wash once with PBS, then fix with 4% paraformaldehyde at room temperature for 20 minutes, permeabilize with 0.02% TritonX-100 permeabilization solution for 5 minutes, then add 5% skim milk to block for 30 minutes at 37℃, and rinse three times with PBS; use Cap mouse monoclonal antibody (1:500) and IPO4 rabbit monoclonal antibody (1:100) for the primary antibody at 37℃ for 1.5 hours, and rinse three times with PBS; use FITC-labeled goat anti-mouse (1:200) and A546-labeled donkey anti-rabbit (1:200) for the secondary antibody at 37℃ for 1 hour, rinse three times with PBS, and finally add DAPI staining solution to observe the fluorescence results under a fluorescence microscope. The results are as follows Figure 7 As shown, it can be seen that the replication of PCV2 virus in IPO4 gene knockout PK15 cells was reduced compared with the control PK15-WT cells.

[0064] These results demonstrate that knocking out the IPO4 gene effectively inhibits PCV2 replication. The knockout cell line PK15-KO-IPO4 can be used to study the mechanisms of PCV2 replication and provides new insights into drug development for the prevention or treatment of PCV2. The knockout cell line PK15-KO-IPO4 was deposited with the China Center for Type Culture Collection, Wuhan University, Wuhan, China, on January 7, 2025. The deposited name is porcine kidney cell PK15-KO-IPO4.

[0065] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of an agent for inhibiting or silencing IPO4 gene expression in the preparation of a drug for inhibiting porcine circovirus replication, characterized in that: The porcine circovirus is porcine circovirus type II; The reagent type for inhibiting or silencing IPO4 gene expression is sgRNA.

2. The use according to claim 1, characterized in that The reagent is an sgRNA that targets and knocks out the IPO4 gene; the sgRNA is IPO4-sgRNA, and the nucleotide sequence is shown in SEQ ID NO.1.