Ulva polysaccharide lyase PcPL40A and its application
By developing the Ulva polysaccharide lysase PcPL40A, the problem of difficulty in preparing Ulva oligosaccharides of different polymerization degrees in the prior art was solved, and the efficient preparation of unsaturated Ulva hexa sugar was achieved, and the application potential of Ulva polysaccharides was expanded.
Patent Information
- Application Number
- CN202510594061.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2045-05-09
AI Technical Summary
The lack of Ulva polysaccharide lyases that can efficiently prepare Ulva oligosaccharides of different degree of polymerization is limited in the prior art, and the diversity and application potential of oligosaccharide species are limited.
A Ulva polysaccharide lyase PcPL40A, whose amino acid sequence and gene sequence are shown in SEQ ID NO.1 and SEQ ID NO.2/3, are able to hydrolyze Ulva under specific conditions, mainly producing unsaturated Ulva hexaose, and achieve industrial production in E. coli through heterologous expression.
The efficient preparation of unsaturated Ulva hexa sugars has been achieved, providing a wider application prospect, and laying the foundation for the high-value utilization of Ulva polysaccharides.
Smart Images

Figure CN120098982B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of functional enzymes, and particularly relates to an ulvan lyase PcPL40A and its application. Background Art
[0002] Ulvan is a natural macromolecular linear polysaccharide extracted from the cell wall of green algae of the genus Ulva, and is one of the few natural polysaccharides with high sulfate group substitution in nature. The main monosaccharide monomers in the structural composition of ulvan are iduronic acid (IdoA), 3-sulfated rhamnose (Rha3S), xylose (Xyl), 2-sulfated xylose (Xyl2S), and glucuronic acid (GlcA). There are usually four disaccharide units in the structure of ulvan: [→4) β -d-Xyl(1→4)- α -L-Rha3S(1→], [→4) α -L-IdoA(1→4)-α-L-Rha3S(1→], [→4) β -d-GlcA(1→4)- α -L-Rha3S(1→] and [→4) β -d-Xyl2S(1→4)- α -L-Rha3S(1→]. Due to the presence of sulfate groups, ulvan has various physiological activities such as antiviral, anti-inflammatory, anticoagulant, and antioxidant. The oligosaccharides obtained by degrading ulvan have been significantly improved in terms of solubility, stability, and various physiological activities compared with ulvan polysaccharides, which is an important direction for the high-value utilization of ulvan.
[0003] Currently, methods for preparing ulvan oligosaccharides include physical methods, chemical methods, and biological methods, etc. Acid hydrolysis has advantages such as rapid reaction and a relatively high substrate concentration for treatment. However, the products are relatively complex after acid hydrolysis, and separation is rather difficult. Compared with acid hydrolysis, enzymatic hydrolysis has advantages such as mild reaction conditions, single products, and easy separation. Therefore, the enzymatic method is a green method with sustainable application prospects. It is of great significance to explore ulvan polysaccharide lyases for the directional preparation of ulvan oligosaccharides with specific structures. The degradation of ulvan by ulvan polysaccharide lyases generates unsaturated oligosaccharides. Unsaturated disaccharides are usually represented as ∆-Rha3S. The currently characterized ulvan polysaccharide lyases are distributed in the PL24, PL25, and PL28 families, and the main products of the currently characterized ulvan polysaccharide lyases are all tetrasaccharides or disaccharides. The serious lack of relevant research on ulvan polysaccharide lyases with larger products limits the types of oligosaccharides that can be prepared. Therefore, further expressing and characterizing unknown ulvan polysaccharide lyases and developing their potential for the preparation of ulvan polysaccharide lyases with different degrees of polymerization are of great significance for in-depth exploration of the structure-activity relationship of oligosaccharides. Summary of the Invention
[0004] In view of the above-mentioned prior art, the present invention provides an ulvan polysaccharide lyase PcPL40A that can degrade ulva. Its main hydrolysis product is unsaturated ulva hexasaccharide, which can efficiently prepare unsaturated ulva hexasaccharide. It is of great significance for solving the problem of preparing medium- and long-chain polymerization degree ulvan oligosaccharides and has a wide application prospect.
[0005] The present invention is achieved through the following technical solutions:
[0006] One object of the present invention is to provide an ulvan polysaccharide lyase PcPL40A, and the amino acid sequence of the ulvan polysaccharide lyase PcPL40A is as shown in SEQ ID NO.1.
[0007] Another object of the present invention is to provide an application of the ulvan polysaccharide lyase PcPL40A. The application is to use the ulvan polysaccharide lyase PcPL40A to lyse ulva to obtain unsaturated ulva disaccharide, tetrasaccharide, hexasaccharide, and / or octasaccharide. The amino acid sequence of the ulvan polysaccharide lyase PcPL40A is as shown in SEQ ID NO.1.
[0008] A third object of the present invention is to provide an application of the ulvan polysaccharide lyase PcPL40A gene. The application is to use the ulvan polysaccharide lyase PcPL40A gene to prepare an enzyme capable of lysing ulva to obtain unsaturated ulva disaccharide, tetrasaccharide, hexasaccharide, and / or octasaccharide. The ulvan polysaccharide lyase PcPL40A gene is as shown in SEQ ID NO.2 or SEQ ID NO.3, and the encoded protein of the ulvan polysaccharide lyase PcPL40A gene is as shown in SEQ ID NO.1.
[0009] As a preferred embodiment, the conditions for lysing Ulva lactuca are as follows: the enzymatic hydrolysis conditions of the ulvan lyase PcPL40A are as follows: the substrate concentration is 1 to 4 g / L, the enzyme dosage is 0.02 to 0.16 U / mL (1 U represents the amount of enzyme required to release 1 μmol of reducing sugar per minute), preferably 0.08 U / mL, the enzymatic hydrolysis temperature is 20 to 45 °C, preferably 40 °C, the pH value is 6.0 to 10.0, preferably 8.0, and the enzymatic hydrolysis time is more than 10 minutes, preferably 12 hours.
[0010] A fourth object of the present invention is to provide an enzyme preparation, the enzyme preparation contains the ulvan lyase PcPL40A, and the amino acid sequence of the ulvan lyase PcPL40A is as shown in SEQ ID NO.1.
[0011] A fifth object of the present invention is to provide the application of the enzyme preparation in hydrolyzing Ulva lactuca, and the application is to use the enzyme preparation to prepare unsaturated ulvan disaccharide, tetrasaccharide, hexasaccharide and / or octasaccharide.
[0012] Amino acid sequence of ulvan lyase PcPL40A (SEQ ID NO:1):
[0013]
[0014] Nucleotide sequence (direction 5'-3') of the gene encoding ulvan lyase PcPL40A (SEQ ID NO: 2):
[0015]
[0016] Advantages of the present invention compared with the prior art: Through experimental research, it is found that the ulvan lyase PcPL40A of the present invention can degrade ulva at 40 °C and a pH value of 8.0, and the main product composition is unsaturated hexaglucuronide of ulva, and unsaturated hexaglucuronide of ulva can be specifically prepared. The present invention constructs an expression vector containing the ulvan lyase PcPL40A gene, realizes heterologous expression in Escherichia coli, and provides a good basis for the industrial large-scale production of this enzyme. The optimal reaction temperature of the ulvan lyase PcPL40A is 40 °C. At this temperature, ulva as a substrate can maintain a solution state, which can better realize the large-scale application of this ulvan lyase. Description of the Drawings
[0017] Figure 1 It is the SDS-PAGE electrophoresis diagram of the purification of the ulvan lyase PcPL40A of the present invention. Lane M: Protein Marker, Lane P: Pure enzyme
[0018] Figure 2 It is a line graph showing the effect of temperature change on the hydrolysis activity of the ulvan lyase PcPL40A;
[0019] Figure 3 It is a line graph showing the effect of pH change on the hydrolysis activity of the ulvan lyase PcPL40A;
[0020] Figure 4 It is a line graph showing the remaining enzyme activity after incubation at different temperatures for 1 hour;
[0021] Figure 5 It is a curve graph showing the change of the remaining enzyme activity after incubation at 4, 20 and 25 °C for 72 hours;
[0022] Figure 6 It is the HPLC diagram of the product of the hydrolysis of ulva by 0.02 U / mL of the ulvan lyase PcPL40A;
[0023] Figure 7 It is the HPLC diagram of the product of the hydrolysis of ulva by 0.16 U / mL of the ulvan lyase PcPL40A;
[0024] Figure 8 It is the HPLC diagram of the separation of the product of the hydrolysis of ulva by the ulvan lyase PcPL40A;
[0025] Figure 9 It is the mass spectrometry diagram of the separated product T1 of the hydrolysis of ulva by the ulvan lyase PcPL40A;
[0026] Figure 10 It is the mass spectrometry diagram of the separated product T2 of the hydrolysis of ulva by the ulvan lyase PcPL40A;
[0027] Figure 11 It is the mass spectrometry diagram of the hydrolysis of the Ulva separation product T3 by the ulvan lyase PcPL40A;
[0028] Figure 12 It is the mass spectrometry diagram of the hydrolysis of the Ulva separation product T4 by the ulvan lyase PcPL40A;
[0029] Figure 13 It is the mass spectrometry diagram of the hydrolysis of the Ulva separation product T5 by the ulvan lyase PcPL40A. Specific embodiments
[0030] The present invention will be further described below in conjunction with embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art can understand that various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention.
[0031] The instruments, reagents, materials, etc. involved in the following embodiments, unless otherwise specified, are all conventional instruments, reagents, materials, etc. existing in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, are all conventional experimental methods, detection methods, etc. existing in the prior art. The various terms and phrases used in the present invention have the general meanings known to those skilled in the art.
[0032] The method of the present invention will be further described below through specific examples.
[0033] Example 1 Cloning of the ulvan lyase PcPL40A
[0034] The potential ulvan lyase fragment (WP_102996275.1) derived from marine bacteria mined from the NCBI database in this application Pseudotamlana carrageenivorans According to phylogenetic tree and multiple sequence comparison analysis, it may have ulvan polysaccharide lyase activity. This gene fragment has no homology with the publicly reported ulvan lyase, indicating the novelty of the sequence mined in the present invention. This gene contains 3483 bases, and the sequence is shown in SEQ ID NO.2. The encoded protein has 1160 amino acids, and the sequence is shown in SEQ ID NO.1. According to the codon preference of the host Escherichia coli, the DNA sequence of this gene except for the 60bp encoding the signal peptide fragment at the 5' end was codon-optimized, and the optimized gene sequence is shown in SEQ ID NO.3.
[0035] The nucleotide sequence of the artificially synthesized ulvan lyase PcPL40A-encoding gene is as follows (direction 5'-3') (as shown in SEQ ID NO.3):
[0036]
[0037] Synthesize the gene fragment shown in SEQ ID NO.3 artificially. Using the artificially synthesized gene fragment as a template, perform PCR amplification. The specific primers used for PCR are as follows:
[0038] Forward primer: 5’- CTGCAACATCCGGTTATTTG -3’, as shown in SEQ ID NO.4.
[0039] Reverse primer: 5’- CCCAGAAACTGATTCTGAAA -3’, as shown in SEQ ID NO.5.
[0040] Example 2 Construction of the expression vector carrying ulvan lyase PcPL40A
[0041] The target fragment amplified in Example 1 was ligated with the linearized pCold Ⅱ vector using a seamless splicing kit at 50 °C for 5 minutes and then transformed into competent Escherichia coli DH5α cells, which were spread on an LB solid resistant plate containing 100 μg / mL ampicillin. After overnight culture in a 37 °C incubator, single colonies were picked for positive clone verification. The single colonies with the correct band size were sent to a sequencing company for sequencing. After the sequencing alignment was completely correct, the recombinant plasmid was obtained and named pCold- PcPL40A and stored at -20 °C in a refrigerator for future use.
[0042] Example 3 Construction of the engineering bacteria containing ulvan lyase PcPL40A
[0043] The recombinant plasmid carrying the ulvan lyase gene obtained in Example 2 was transformed into competent Escherichia coli BL21(DE3) cells by heat shock transformation at 42 °C and spread on an LB solid resistant plate containing 100 μg / mL ampicillin. After overnight culture in a 37 °C incubator, single colonies were picked for positive clone verification. The single colonies with the correct band size were cultured overnight in liquid LB medium (containing 100 μg / mL ampicillin). The bacterial liquid was stored in 10% glycerol and stored at -80 °C for long-term use.
[0044] Example 4 Preparation and purification of ulvan lyase PcPL40A
[0045] The bacterial liquid preserved in Example 3 was cultured overnight at 37 °C in LB liquid medium (containing 100 μg / mL ampicillin) for activation, and then transferred to a 100 mL LB Erlenmeyer flask (containing 100 μg / mL ampicillin) and cultured at 37 °C and 200 rpm. When the OD600 reached about 0.6, IPTG with a final concentration of 0.1 mM was added, and the culture was transferred to 18 °C for 16 hours to express the ulva polysaccharide lyase PcPL40A.
[0046] After the fermentation was completed, the cells were collected by centrifugation at 8000 rpm for 5 minutes, washed with a certain amount of sterile water, and then the cells were collected again by centrifugation at 8000 rpm for 5 minutes. The cells were resuspended in Tris-HCl buffer at pH 8.0 and ultrasonically disrupted under ice bath conditions (320 W, on for 3 seconds, off for 3 seconds, continuously disrupted for 30 minutes). After complete disruption, the supernatant was collected by centrifugation at 8000 rpm and 4 °C for 15 minutes, which was the crude enzyme. The expressed target gene contains a His purification tag, so we used Ni-NTA affinity chromatography for purification. Imidazole with different concentration gradients (10, 20, 50, 80, 120, 200, and 500 mM) was used for elution of the target protein, and the Akta purifier was connected for purification. The SDS-PAGE results showed that a relatively single target protein band could be obtained through gradient concentration of imidazole ( Figure 1 ). The protein concentration of the purified enzyme solution was determined to be 0.02 g / L by the R250 Coomassie brilliant blue method. It was concentrated and replaced with a 50 kDa ultrafiltration tube, and ultrapure water was used as the replacement solvent to concentrate the enzyme solution to a protein concentration of 1.0 g / L to obtain the pure enzyme for the determination of enzymatic properties.
[0047] Example 5 Determination of the optimal reaction conditions of the ulva polysaccharide lyase PcPL40A
[0048] The effect of temperature on the hydrolysis activity of PcPL40A pure enzyme obtained in Example 4 was determined at different temperatures (20, 30, 40, 45, 50, 60, and 70 °C). The reaction substrate was 4 g / L ulva, and the reaction was terminated by boiling for 10 minutes after reacting at pH 7.0 for 30 minutes. The reducing sugar released by the reaction was determined by the pHBAH method, that is, 100 μL of the reaction solution was added with 300 μL of pHBAH after termination of the reaction and then boiled for 5 minutes for color development. After cooling to room temperature, 200 μL was taken to measure the absorbance at 405 nm, and the production amount of reducing sugar was calculated according to the standard curve (here, the standard curve was drawn with D-galactose as the standard substance). According to the measurement results, it can be seen that PcPL40A showed the maximum hydrolysis activity at 40 °C ( Figure 2 ). Further, the optimal pH of PcPL40A was determined at pH 3-10. As Figure 3 shown, its optimal reaction pH was 8.0.
[0049] Example 6 Determination of the specific enzyme activity of Ulva lactuca polysaccharide lyase PcPL40A
[0050] The method for determining the enzyme activity is as follows: The reaction system is 200 μL, containing 50 mM Tris-HCl buffer at pH 8.0, 4 g / L Ulva lactuca, and 1.0 mg of pure PcPL40A (prepared in Example 4). After reacting at 40 °C for 10 minutes, the reaction is terminated by boiling for 10 minutes. The reducing sugar released by the reaction is determined by the pHBAH method (see Example 5).
[0051] The enzyme activity is defined as: under the optimal reaction conditions, the amount of enzyme required to convert 1 μmol of reducing sugar in 1 minute.
[0052] After determination, the specific enzyme activity of Ulva lactuca polysaccharide lyase PcPL40A for hydrolyzing Ulva lactuca is 0.31 U / mg.
[0053] Example 7 Determination of the thermal stability of Ulva lactuca polysaccharide lyase PcPL40A
[0054] The pure PcPL40A enzyme obtained in Example 4 was incubated at 20, 30, 40, 50, 60, 70, and 80 °C for 60 minutes respectively, and then its residual enzyme activity was measured. As Figure 4 shown, the results indicate that PcPL40A still retains about 60.58% of its relative enzyme activity after incubation at 30 °C for 60 minutes.
[0055] Furthermore, the pure PcPL40A enzyme was continuously incubated at 4, 20, and 25 °C for 72 hours respectively, and the residual enzyme activity was measured by sampling over time. As Figure 5 shown, it appears that PcPL40A still retains 47.54% and 43.39% of its initial enzyme activity after incubation at 4 °C and 25 °C for 72 hours respectively.
[0056] Example 8 Determination of the hydrolysis products of PcPL40A for hydrolyzing Ulva lactuca
[0057] The pure PcPL40A enzyme obtained in Example 4 was reacted with 4 g / L Ulva lactuca at 40 °C and pH 8.0 for 12 hours, and then its hydrolysis products were determined by HPLC. Under the condition of an enzyme addition amount of 0.02 U / mL, as Figure 6 shown, no oligosaccharide products were generated at the 0-minute state. As the reaction proceeded, peaks P2 and P3 were first produced and gradually accumulated, and finally five oligosaccharide peaks, namely P1, P2, P3, P4, and P5, were generated, among which P2 and P3 were the main products. Under the condition of an enzyme addition amount of 0.16 U / mL, as Figure 7As shown, no oligosaccharide products were generated at the 0-minute state, and finally six oligosaccharide peaks, P1, P2, P3, P4, P5, and P6, were produced, among which P2 and P3 were still the main products.
[0058] Since there is a lack of commercially available Ulva oligosaccharide standard for comparison, it is impossible to determine exactly what kind of oligosaccharides the six oligosaccharide peaks, P1, P2, P3, P4, P5, and P6, are. We separated them using gel chromatography, as Figure 8 shown. A total of five tubes of oligosaccharides were obtained. T1 corresponded to P1, T2 contained both P2 and P3, T3 corresponded to P4, T4 corresponded to P5, and T5 corresponded to P6. T1, T2, T3, T4, and T5 were further detected by mass spectrometry: as Figure 9 shown, T1 was an unsaturated octasaccharide; as Figure 10 shown, T2 was an unsaturated hexasaccharide; as Figure 11 and Figure 12 shown, both T3 and T4 were unsaturated tetrasaccharides; as Figure 13 shown, T5 was an unsaturated disaccharide. This indicates that PcPL40A cleavage of Ulva produces unsaturated disaccharides, tetrasaccharides, hexasaccharides, and octasaccharides, among which the unsaturated hexasaccharide is the main product.
Claims
1. Application of ulvan polysaccharide lyase PcPL40A, characterized in that, The application is to use the ulvan polysaccharide lyase PcPL40A to lyse ulva lactuca, and obtain unsaturated ulvan disaccharide, tetrasaccharide, hexasaccharide and / or octasaccharide. The amino acid sequence of the ulvan polysaccharide lyase PcPL40A is shown in SEQ ID NO.
1.
2. Application of ulvan lyase PcPL40A gene, characterized in that, The application is to use the ulvan polysaccharide lyase PcPL40A gene to prepare an enzyme capable of lysing ulva lactuca, so as to obtain unsaturated ulvan disaccharide, tetrasaccharide, hexasaccharide and / or octasaccharide. The ulvan polysaccharide lyase PcPL40A gene is shown in SEQ ID NO.2 or SEQ ID NO.3, and the encoded protein of the ulvan polysaccharide lyase PcPL40A gene is shown in SEQ ID NO.
1.
3. The application according to claim 1 or 2, characterized in that, The conditions for lysing ulva lactuca are as follows: the enzymatic hydrolysis conditions of the ulvan polysaccharide lyase PcPL40A are: the substrate concentration is 1-4 g / L, the enzyme addition amount is 0.02-0.16 U / mL, the enzymatic hydrolysis temperature is 20-45 °C, the pH value is 6.0-10.0, and the enzymatic hydrolysis time is more than 30 minutes.
4. The application according to claim 3, characterized in that The substrate concentration is 1-4 g / L, the enzyme addition amount is 0.08 U / mL, the enzymatic hydrolysis temperature is 40 °C, the pH value is 8.0, and the enzymatic hydrolysis time is 12 hours.