MRNA (messenger ribonucleic acid) for treating multiple endocrine tumor type I and application thereof

Abstract

The invention belongs to the field of biological medicines, and provides mRNA (messenger ribonucleic acid) for treating multiple endocrine tumor type I and application thereof. The mRNA provided by the invention has high specific expression level in human cells such as 293T, parathyroid gland and the like; in addition, the mRNA provided by the invention can be continuously expressed on SK-BR-3 cells for at least 7 days, and the half-life period of the protein is longer. The mRNA provided by the invention plays an anti-tumor role mainly by supplementing cell-deficient Menin protein, in an immortalized parathyroid gland cell model, the Menin protein can be expressed by transfecting the mRNA for 6 hours, and the mRNA has a good treatment potential for multiple endocrine tumor type I.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular, relates to an mRNA for treating multiple endocrine neoplasia type I and an application thereof. Background Art

[0002] Multiple endocrine neoplasia syndrome I (MEN1) is an autosomal dominant syndrome, typically characterized by parathyroid, pituitary and pancreatic neuroendocrine tumors, characterized by the presence of adenomatous lesions in at least two endocrine tissues. MEN1 is a rare disease with no cure. Traditional drug treatments all start with symptoms to relieve pain, but cannot fundamentally treat MEN1 or delay its progression. Surgical resection may carry a risk of recurrence.

[0003] Multiple endocrine neoplasia type I is associated with loss-of-function mutations in the MEN1 gene encoding the tumor suppressor protein Menin. Menin protein is expressed in all tissues of the human body, localized in the cell nucleus, and participates in epigenetic modification of genes, mainly playing a role in transcriptional regulation, genome stability, cell apoptosis, and cell cycle regulation. Currently, there are no publicly available mRNA drugs for the treatment of MEN1-deficient tumors, and further optimization and iteration are needed. Summary of the invention

[0004] The purpose of the present invention is to provide an mRNA for treating multiple endocrine neoplasia type I and its application.

[0005] To achieve the purpose of the present invention, in a first aspect, the present invention provides an mRNA for treating multiple endocrine neoplasia type I, wherein the mRNA encoding sequence is the amino acid shown in SEQ ID NO:4.

[0006] The structure of the mRNA of the present invention is: 5' cap-5' UTR-coding region sequence-3' UTR-poly A tail.

[0007] Wherein, the coding region sequence is shown in any one of SEQ ID NOs: 1-3.

[0008] Preferably, the structure of the 5′ cap is GAG(3′OMe)m7(3′OMeG)(5′)ppp(5′)(2′OMeA)pG, m7(3'OMeG)(5')ppp(5′)(2'OMeA)pG or m7G(5′)ppp(5′)G.

[0009] Furthermore, the poly A tail includes base A with a length of 80-120, and the multiple A's are continuous or have linkers of 1-12 nt inserted in the middle and are not all A's.

[0010] Preferably, the poly A tail is 100 base A, and the sequence is as shown in SEQ ID NO:5.

[0011] Preferably, the sequence of the 5′UTR is as shown in SEQ ID NO:6.

[0012] Preferably, the sequence of the 3′UTR is as shown in SEQ ID NO:10.

[0013] In a second aspect, the present invention provides a nucleic acid construct or a biological material containing the nucleic acid construct, wherein the nucleic acid construct can be transcribed to obtain the mRNA.

[0014] The biological material includes, but is not limited to, recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria or transgenic cell line.

[0015] In a third aspect, the present invention provides a method for preparing the mRNA, comprising: cloning the nucleic acid construct into an expression plasmid to obtain a recombinant plasmid; transferring the recombinant plasmid into a host cell to obtain a recombinant cell, extracting the plasmid from the amplified recombinant cell, and then performing in vitro transcription synthesis to obtain the mRNA.

[0016] In a fourth aspect, the present invention provides the use of the mRNA in the preparation of a drug or composition for treating multiple endocrine neoplasia type I.

[0017] In a fifth aspect, the present invention provides a drug complex for treating multiple endocrine neoplasia type I, wherein the mRNA is complexed with one or more lipids to prepare liposomes, lipid nanoparticles or lipid complexes.

[0018] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0019] The present invention provides an mRNA for treating multiple endocrine neoplasia type I, wherein the mRNA has a higher specific expression level in human cells such as 293T and parathyroid glands; continuous expression for at least 7 days is detected on SK-BR-3 cells, and the protein half-life is longer. The mRNA mainly exerts an anti-tumor effect by supplementing the Menin protein missing from cells. In a parathyroid cell model, the mRNA can express the Menin protein within 6 hours, and has good therapeutic potential for multiple endocrine neoplasia type I. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The figure is a schematic diagram of the structure of the mRNA encoding the Menin protein of the present invention.

[0021] Figure 2Schematic diagram of the Menin mRNA framework plasmid in Example 1 of the present invention.

[0022] Figure 3 This is a flow chart of in vitro synthesis and expression analysis of mRNA in Example 3 of the present invention.

[0023] Figure 4 Schematic diagram of agarose gel analysis of Menin mRNA in Example 3 of the present invention.

[0024] Figure 5 This is the Western blot analysis of the expression of Menin mRNA in 293T cells in Example 9 of the present invention.

[0025] Figure 6 This is a schematic diagram of the expression of Menin mRNA in SK-BR-3 cells detected by Western blot in Example 9 of the present invention.

[0026] Figure 7 This is a schematic diagram of Western blot detection of Menin mRNA expression in immortalized parathyroid cells in Example 9 of the present invention.

[0027] Figure 8 The expression level of Menin protein in 293T cells of mRNA corresponding to the 5'UTR and 3'UTR sequence optimization in Example 5 of the present invention. DETAILED DESCRIPTION

[0028] The present invention aims to provide a method for preparing mRNA for treating multiple endocrine neoplasia type I and its application.

[0029] The present invention adopts the following technical solution:

[0030] In one aspect, the present invention provides an mRNA that can encode the amino acids shown in the sequence of SEQ ID NO: 1. The mRNA is synthesized in vitro and can be used as an active ingredient for treating multiple endocrine neoplasia type I.

[0031] According to a specific embodiment of the present invention, the 5′ end of the mRNA is connected to the cap structure and the 5′ UTR; the 3′ end of the mRNA is connected to the 3′ UTR and the poly A tail.

[0032] According to a specific embodiment of the present invention, the poly A tail comprises 80-120 base A's in length.

[0033] Preferably, the number of bases in the poly A tail is 100 A (SEQ ID NO: 5).

[0034] On the other hand, the cap structure used in the present invention is GAG(3′OMe)m7(3′OMeG)(5′)ppp(5′)(2′OMeA)pG.

[0035] In another aspect, the present invention provides a DNA template, which can be transcribed to obtain the mRNA.

[0036] According to a specific embodiment of the present invention, the 5′UTR sequence is 5′-GAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC-3′ (SEQ ID NO: 6).

[0037] According to a specific embodiment of the present invention, the 3′UTR sequence is 5′-CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGT ACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC-3′ (SEQ ID NO: 10).

[0038] On the other hand, the present invention provides a method for preparing the mRNA, which comprises: cloning a DNA fragment capable of transcribing the mRNA into an expression plasmid to obtain a recombinant plasmid, and then performing in vitro transcription synthesis to obtain the mRNA.

[0039] The method of the present invention may also include conventional operations in the field, such as operations for extracting plasmids.

[0040] According to a specific embodiment of the present invention, the conditions for in vitro synthesis of the mRNA are 35-38° C. and the reaction time is 2-8 hours.

[0041] The present invention also provides a DNA template, which can be transcribed to obtain the mRNA.

[0042] On the other hand, the present invention also provides the use of the mRNA in treating multiple endocrine neoplasia type I, and the use of the mRNA in preparing a drug or composition for treating multiple endocrine neoplasia type I.

[0043] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0044] In the present invention, the coding region sequence of the mRNA is shown in any one of SEQ ID NOs: 1-3. In the present invention, "T" is used to represent uracil (U) of RNA, and in the present invention, "T" can also represent pseudouridine (ψ), and in the present invention, "T" can also represent N1-methylpseudouridine (m1ψ); specifically as follows:

[0045] In the present invention, the 5′ end of the mRNA is preferably connected to a cap structure and a 5′ UTR; and the 3′ end of the mRNA is preferably connected to a 3′ UTR and a modified poly A tail.

[0046] In the present invention, the structural diagram of the mRNA is as follows Figure 1 shown.

[0047] The present invention also provides a method for preparing the mRNA active ingredient for multiple endocrine neoplasia type I, comprising the following steps: (1) synthesizing a DNA fragment corresponding to the active ingredient mRNA in the multiple endocrine neoplasia type I, and cloning the DNA fragment into an expression plasmid to obtain a recombinant plasmid; (2) transferring the recombinant plasmid into a host cell to obtain a recombinant cell, extracting the plasmid from the amplified recombinant cell, and performing PCR amplification using the extracted plasmid as a template to obtain a DNA template for in vitro expression of mRNA; (3) constructing an RNA in vitro synthesis system including the DNA template to perform in vitro synthesis of mRNA to obtain the active ingredient mRNA, such as Figure 3 shown.

[0048] In the present invention, a DNA fragment of the mRNA is synthesized and transcribed, and the DNA fragment is cloned into an expression plasmid to obtain a recombinant plasmid. The present invention does not specifically limit the method for synthesizing the DNA fragment corresponding to the mRNA, and a conventional DNA synthesis method can be used. In the specific implementation of the present invention, the DNA fragment is commissioned to be synthesized by a biotechnology company. In the present invention, the specific sequence of the DNA fragment is determined according to the principle of complementary base pairing. In the present invention, the expression plasmid is preferably a pBR322 plasmid. In the present invention, the DNA fragment is cloned into an expression plasmid by an enzyme cutting and ligation method, such as Figure 3 As shown; in the present invention, the DNA fragment is preferably double-digested by EcoRI enzyme and HindIII enzyme to obtain a digested DNA fragment; the expression plasmid is preferably double-digested by EcoRI and HindIII enzyme to obtain a digested plasmid; and then the digested DNA fragment and the digested plasmid are connected to obtain a recombinant plasmid.

[0049] Example 1 Recombinant plasmid preparation

[0050] (1) The target fragment (the target fragment is composed of 5′ cap structure-5′ UTR (SEQ ID NO: 6)-coding region sequence shown in any one of SEQ ID NOs: 1-3-3′ UTR (SEQ ID NO: 10)-poly A tail (SEQ ID NO: 5) in series) and pBR322 plasmid are subjected to double restriction enzyme digestion reaction with EcoRI enzyme (New England Biotechnology Co., Ltd., catalog number: R0101S) and HindIII enzyme (New England Biotechnology Co., Ltd., catalog number: R0104S), respectively.

[0051] (2) In vitro ligation was performed using T4 ligase (New England Biotechnology Co., Ltd., catalog number: M0202S);

[0052] (3) Transform DH5α Escherichia coli competent cells (Novozyme, catalog number: C502-02 / 03) and culture on Amp solid medium for 16 hours;

[0053] (4) Colony PCR: select colonies containing the target band for sequencing.

[0054] (5) The colonies that were sequenced correctly were expanded and the plasmids were extracted.

[0055] (6) In the present invention, the plasmid of the correctly sequenced recombinant cells is extracted; the present invention has no particular limitation on the method for extracting the plasmid, and preferably a plasmid extraction kit (Novozymes, catalog number: DC201-01) is used.

[0056] Schematic diagram of Menin mRNA framework plasmid is shown in Figure 2 .

[0057] Example 2 Optimization of mRNA sequence

[0058] This example provides a process for mRNA sequence optimization.

[0059] This embodiment designs and optimizes the sequence of the mRNA coding region. Among them, reducing the minimum free energy (Minimum Free Energy, MFE) can improve the stability of mRNA, avoid the use of rare codons, and improve the codon adaptation index (Codon Adaptation Index, CAI) can increase the efficiency of mRNA translation. The present invention screens and optimizes 3 sequences, namely SEQ ID NO: 1-3. The MFE and CAI indexes of the designed and optimized Menin sequence are better than the NCBI public sequence (CCDS8083.1). Among them, the average MFE is -756.7kcal / mol, an increase of about 14.0%, and the average CAI is 0.91, an increase of about 8.79%.

[0060] Example 3 Plasmid DNA Linearization

[0061] In a constant temperature reactor, a plasmid DNA linearization experiment was performed. The plasmid DNA linearization experiment was performed according to the following system:

[0062] Prepare enzyme digestion reaction system:

[0063] Components Specification Dosage Plasmid DNA 10 μg rCutsmartbuffer 10× 10μL HimdⅢ endonuclease 5000U / mL 1μL Nuclease-free water Make up to 50 μL

[0064] The reaction was carried out at 37°C for 1 hour. EDTA was added to terminate the reaction.

[0065] Then, agarose gel electrophoresis analysis was performed. First, 1% agarose gel was prepared (1 g agarose was weighed and added to 100 mL TAE solution). 10 μL bromophenol blue was added to the enzyme digestion product, and the mixture was shaken and then spotted. The electrophoresed agarose gel was photographed and saved. The results were as follows: Figure 4 shown.

[0066] Example 4 Transcription Reaction

[0067] After obtaining the DNA template, the present invention constructs an RNA in vitro synthesis system including the DNA template to perform in vitro synthesis of mRNA to obtain the active ingredient mRNA. In a constant temperature reactor, an RNA in vitro synthesis experiment is performed. The RNA in vitro synthesis system is as follows:

[0068] (1) Preparation of transcription system

[0069] Components Volume per tube (μL) 10× Transcription Buffer 2 Pseudo-UTP (100 mM) 2.5 CTP (100 mM) 2 GTP (100 mM) 2 ATP(100mM) 2 GAG(100mM) 2 Linearized DNA template 1 μg T7RNApolymeraseMix 2 RNase-free water Add to 20 μL

[0070] Take a sterile and clean 1.5mL EP tube, prepare the transcription system according to the table above, blow gently to mix, then dispense 20μL of the system into 200μL reaction tubes, and react the reaction tubes at 37℃ in a PCR instrument for 2 hours.

[0071] (2) Digestion of DNA linearization template

[0072] After the reaction was completed, 1 μL DNase I was added to each tube and reacted at 37°C for 15 minutes.

[0073] (3) Purification of transcribed RNA

[0074] The transcribed RNA can be precipitated with lithium chloride solution, and then the protein and free nucleotides can be removed. The purified RNA can be stored at -80℃ for downstream experiments or electrophoresis detection.

[0075] Add 30 μL RNase-Free HO to the 20 μL reaction mixture. 2 O and 30 μL 7.5 M lithium chloride; after mixing evenly, place incubate in a -20°C refrigerator for 30 minutes, then centrifuge at 4°C, 12000g for 15 minutes to collect the precipitate.

[0076] Add 500 μL of 70% frozen ethanol to wash the RNA precipitate. After the ethanol evaporates naturally, use 100 μL of RNase-free water to dissolve the RNA precipitate in each tube. The purified RNA solution is stored at -80°C.

[0077] This embodiment provides a method for detecting the expression level of mRNA encoding Menin protein.

[0078] Example 5 Sequence Optimization of 5'UTR and 3'UTR

[0079] The present invention confirms whether the sequences after optimizing the 5'UTR and 3'UTR of mRNA have better expression efficiency of target protein through transfection at cytological level and detection of samples, and screens out the sequences with excellent expression efficiency by comparing with the control group, thereby achieving the purpose of mRNA sequence optimization.

[0080] The present invention synthesizes mRNA with optimized 5'UTR and 3'UTR sequences in vitro, detects the expression efficiency of target protein at the in vitro cytological level of Menin mRNA, and screens out 5'UTR-mRNA and 3'UTR with better expression efficiency. The mRNA corresponding to the 5'UTR sequence shown in SEQ ID NO: 6 and the 3'UTR sequence shown in SEQ ID NO: 10 has a good protein expression amount in 293T cells, which is better than other alternative sequences. The experimental results are shown in Figure 8 .

[0081] The candidate 5'UTR sequences are as follows:

[0082] GAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC (SEQ ID NO: 6)

[0083] CAGCGTCCACACAGCAAGGAATGATCGAAACCCGAATGGCCCCTGTTATA(SEQ ID NO:7)

[0084] AGTTAAGTTTGTCAGCAGGAAACTACACATCGGTCTCGCTAACCGTTTGT(SEQ ID NO:8)

[0085] AATTGGCCCTATCGTAGTGACTATCAGCGGCCATCCTCCTGAGAGTACAG(SEQ ID NO:9)

[0086] The candidate 3'UTR sequences are shown in SEQ ID NOs: 10-14, respectively.

[0087] Example 6 Cultivation of 293T, SK-BR-3, and Immortalized Parathyroid Cells

[0088] (1) 293T cell culture: 293T cells were routinely cultured using DMEM medium containing 10% FBS (Situofan Biotechnology Co., Ltd., catalog number: SH30243.FS); when the cell confluence was greater than 80%, the cells were digested with 0.1% trypsin and passaged at a ratio of 1:3, and then placed at 37°C, 5% CO 2 The incubator was cultured normally.

[0089] (2) SK-BR-3 cell culture: SK-BR-3 cells were routinely cultured using McCoy's 5A medium (Thermo Fisher Scientific, Cat. No. 16600082) containing 10% FBS. When the cell confluence was greater than 80%, the cells were digested with 0.1% trypsin and passaged at a ratio of 1:2. The cells were placed at 37°C and 5% CO. 2 The incubator was cultured normally.

[0090] (3) Immortalized parathyroid cell culture: Immortalized parathyroid cells were routinely cultured using primary epithelial cell basal medium (Cybecon, catalog number: iCell-0089a-001b) containing 2% FBS. When the cell confluence was greater than 80%, the cells were digested with 0.1% trypsin and passaged at a ratio of 1:3. The cells were placed at 37°C and 5% CO. 2 The incubator was cultured normally.

[0091] Example 7: Menin mRNA transfection cell experiment

[0092] (1) Cell counting: Take 293T cells in good growth condition, remove the culture medium, wash the cells with 10 mL PBS, add an appropriate amount of 0.25% trypsin to digest for 2 minutes, then add DMEM culture medium containing 10% FBS to neutralize the trypsin, gently pipette to mix and transfer to a 50 mL centrifuge tube, and take 0.2-0.6 mL of the cell suspension for counting.

[0093] (2) Cell inoculation: Take 1 mL of cell suspension and dilute it to 3.5×10 with DMEM medium containing 10% FBS. 5 1 / mL, pipette and mix; take 2mL of cell suspension and add it to a 6-well plate. Prepare 2 parallel wells of cells for each mRNA sample, 1 well of cells for the control sample, and 1 well for the blank control. Place the 6-well plate in a 37°C, 5% CO 2 Incubate overnight in an incubator.

[0094] (3) Cell culture medium replacement: About 24 hours after inoculation, observe the cell status in the 6-well plate. The confluence is about 90%. In a biosafety cabinet, prepare DMEM complete culture medium containing 10% FBS. Discard the culture medium in the well plate 30 minutes before transfection and add 1 mL of fresh complete culture medium to each well.

[0095] (4) Prepare the transfection system: Take 100 μL Opti-MEM (Gibco, Catalog No.: 51985091), add 10 μL Lipofectamine 2000 (Thermo Fisher Scientific, Catalog No.: 51985091), mix by gently pipetting with a pipette, and incubate for 10 minutes; take another 100 μL Opti-MEM, add 4 μg mRNA sample, mix by gently pipetting with a pipette, mix the two tubes thoroughly, and let stand for 15 minutes.

[0096] Directly and evenly add the prepared transfection system into the cultured cells and shake well to ensure that the transfection system is evenly distributed on the cells.

[0097] (5) Cell culture medium replacement: 6 hours after transfection, discard the old culture medium and replace each well with 2 mL of fresh complete culture medium.

[0098] (6) Cell sampling: harvest 24 hours after transfection. Aspirate the old culture medium and wash once with 1 mL PBS. Aspirate the PBS and continue to blow down the cells with 1 mL PBS. Collect them in a 1.5 mL centrifuge tube and centrifuge at 300g for 5 minutes. Aspirate the supernatant as much as possible after centrifugation, and use the precipitated cells for Western blot detection.

[0099] (7) The mRNA transfection experiments of SK-BR-3 cells and immortalized parathyroid cells were the same as above.

[0100] Example 8 Experimental group cell sample preparation and protein concentration test

[0101] 1. Add 100 μL of 4°C pre-cooled RIPA lysis buffer (Shanghai Biotech Biotechnology Co., Ltd., Catalog No.: P0013B) to the previously collected cell pellet, resuspend the cell pellet, and place on ice at 4°C for 30 minutes;

[0102] 2. Place the cell sample on an ice box and perform ultrasonic disruption (Ningbo Xinzhi Biotechnology Co., Ltd., catalog number: Jy92-IIN) for 1 minute, power 10W, and the cycle mode is 3 seconds of ultrasonication followed by a 6-second pause;

[0103] 3. After ultrasound, centrifuge at 4°C, 12,000 g for 5 minutes and collect the supernatant.

[0104] 4. Bradford method was used to measure the protein concentration of the supernatant. Bradford protein concentration determination kit (Shanghai Biotech Co., Ltd., catalog number: P0006) was used. The operation steps are as follows:

[0105] 5. Prepare 0, 0.125, 0.25, 0.5, 0.75, 1, and 1.5 mg / mL protein standards. Take 5 μL of sample into the sample wells of a 96-well plate.

[0106] 6. Add 250 μL of G250 staining solution to each well.

[0107] 7. Incubate for 2 minutes and read the plate at 595 nm using a microplate reader.

[0108] 8. Average the absorbance values ​​minus the blank control. Plot the absorbance value of the standard minus the blank control against the concentration and substitute it into the sample absorbance value for calculation.

[0109] Example 9: Western blot detection of protein expression

[0110] (1) Gel preparation: Use distilled water to check for leaks on the gel plate in advance, and prepare 10% separation gel and 4% concentrated gel according to the gel preparation system in Table 1. Pour the separation gel, seal the line with isopropanol, and pour the concentrated gel after the separation gel solidifies, then insert the comb. After the upper concentrated gel solidifies, put it into the electrophoresis tank and add sufficient electrophoresis buffer.

[0111] Table 1 Gel preparation system

[0112]

[0113] (2) Loading: Pull out the comb vertically from the gel plate and load the samples in order. The protein loading amount ranges from 10 to 50 μg, and the sample volume for a 15-well plate is 10 to 20 μL.

[0114] (3) Electrophoresis: Use 60V constant voltage electrophoresis for the upper 4% concentrated gel, maintain the current at 20-40mM, use 90V constant voltage electrophoresis when bromophenol blue enters the lower 10% separation gel, and stop electrophoresis after the target protein is fully separated. The anode electrophoresis buffer can be recycled, and the cathode electrophoresis buffer is prepared on the spot. The formula is shown in Table 2.

[0115] Table 2 SDS-PAGE electrophoresis buffer (10×)

[0116]

[0117] (4) Transfer: The formula of transfer solution is shown in Table 3. The transfer solution was precooled in a 4°C environment. The nitrocellulose membrane was soaked and balanced in advance and stacked in the order of black transfer plate-sponge-filter paper-gel-nitrocellulose membrane-filter paper-white transfer plate. The transfer condition was a constant voltage of 100 V and the transfer time was 2 h.

[0118] Table 3 Tris-glycine transfer solution formula (10×)

[0119]

[0120] (5) Blocking: The membrane was placed in 5% skimmed milk powder (prepared in TBST) for 1 hour.

[0121] (6) Incubation with primary antibodies: Place the membrane in GAPDH antibody (Thermo Fisher Scientific, Catalog No. PA1-987) and Menin antibody (Thermo Fisher Scientific, Catalog No. PA5-79663) diluents at an antibody dilution ratio of 1:1000 and incubate overnight in a 4°C refrigerator. Wash three times with TBST, 10 minutes each time.

[0122] (7) Incubation with secondary antibody: Add secondary antibody IgG-HRP (Thermo Fisher Scientific, Catalog No.: 31460) at a dilution ratio of 1:10000; incubate at room temperature for 1 hour. Wash three times with TBST, 10 minutes each time.

[0123] (8) Exposure: The membrane was immersed in ECL chemiluminescent reagent (Thermo Fisher Scientific, Cat. No. 34577) for 2 minutes, and then exposed to the gel imager and the image was collected. Figure 5 to Figure 7 As shown (the corresponding coding region sequence is shown in SEQ ID NO: 1).

[0124] (9) Result analysis: Compared with the Blank group, high-level expression of Menin protein was detected in 293T cells and immortalized parathyroid cells transfected with Menin mRNA. In addition, Menin mRNA was detected in the tool cells SK-BR-3 for at least 7 days.

[0125] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. An mRNA for treating multiple endocrine neoplasia type I, characterized in that: The mRNA encoding sequence is the amino acid shown in SEQ ID NO:

4.

2. The mRNA according to claim 1, characterized in that The structure of the mRNA is: 5′ cap-5′ UTR-coding region sequence-3′ UTR-poly A tail; The coding region sequence is shown in any one of SEQ ID NOs: 1-3.

3. The mRNA according to claim 1, characterized in that The structure of the 5' cap is GAG(3'OMe)m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG or m7G(5')ppp(5')G.

4. The mRNA according to claim 1, characterized in that The poly A tail includes base A with a length of 80-120, and the multiple A's are continuous or inserted with 1-12 nt linkers that are not all A's; Preferably, the sequence of the poly A tail is as shown in SEQ ID NO:

5.

5. The mRNA according to any one of claims 1 to 4, characterized in that The sequence of the 5′UTR is shown in SEQ ID NO:

6.

6. The mRNA according to any one of claims 1 to 4, characterized in that The sequence of the 3′UTR is shown in SEQ ID NO:

10.

7. A nucleic acid construct or a biological material containing the nucleic acid construct, characterized in that: The nucleic acid construct is transcribed to obtain the mRNA according to any one of claims 1 to 6; The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, virus vector, engineering bacteria or transgenic cell line.

8. The method for preparing the mRNA according to any one of claims 1 to 6, comprising: Cloning the nucleic acid construct of claim 7 into an expression plasmid to obtain a recombinant plasmid; The recombinant plasmid is transferred into a host cell to obtain a recombinant cell, the plasmid is extracted from the amplified recombinant cell, and then the mRNA is synthesized by in vitro transcription.

9. Use of the mRNA according to any one of claims 1 to 6 in the preparation of a medicament or composition for treating multiple endocrine neoplasia type I.

10. A drug complex for treating multiple endocrine neoplasia type I, characterized in that: The mRNA according to any one of claims 1 to 6 is complexed with one or more lipids to prepare liposomes, lipid nanoparticles or lipid complexes.

Images