Membrane protein Sec63 gene and application of dsRNA thereof in pest control
By using the peregrine membrane protein Sec63 gene and its dsRNA, specific primers were designed for PCR amplification and dsRNA synthesis, specific silencing of the peregrine Sec63 gene was successfully achieved, the problem of target screening bottlenecks in pest control was solved, and new pest control effects were achieved.
Patent Information
- Application Number
- CN202510263732.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-06
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-03-06
AI Technical Summary
Existing nucleic acid biopesticides have bottlenecks in screening of efficient specific anti-worm dsRNA targets, and there is a lack of safe and specific targets in pest control.
By using the macaque membrane protein Sec63 gene and its dsRNA, specific upstream and downstream primers were designed for PCR amplification, and dsRNA was synthesized and applied to silence the expression of macaque Sec63 gene, thereby inhibiting the pest molting process.
The specific silencing of the Sec63 gene of the periartum was achieved, resulting in difficulty in molting and death of the periartum, providing a new specific molecular target and pest control technical approach.
Smart Images

Figure CN120099015A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology and agricultural pest control, and specifically relates to the application of membrane protein Sec63 gene and dsRNA thereof in pest control. Background Art
[0002] Nucleic acid biological pesticides use the dsRNA of pests or pathogens themselves to achieve silencing of target gene transcription levels, thereby inhibiting the growth and development of pests or pathogens and achieving the purpose of preventing and controlling pests and diseases. Compared with traditional pesticides, nucleic acid biological pesticides have the advantages of strong insecticide specificity, wide target selection range, and green safety. However, the research and development of nucleic acid biological pesticides urgently needs to break through the bottleneck of high-efficiency and specific insect-resistant dsRNA target screening. The epidermis is the first line of defense for pests against adverse external environments and pathogens. During the individual development of insects, the old epidermis is constantly shed and a new epidermis is formed. Molting is a biological phenomenon unique to arthropods, while humans and higher mammals lack this biological characteristic. Therefore, the epidermis has attracted much attention as a safe target for pest control.
[0003] Locusta migratoria is an intercontinental agricultural pest. It is characterized by its explosiveness, swarming and migratory nature. Once it occurs, it not only affects a wide area, but also comes with great force and causes serious damage. Sec63 is a locust membrane protein. Currently, there is no report on RNA interference technology for pest control through the membrane protein Sec63 gene. Summary of the invention
[0004] In view of this, the purpose of the present invention is to overcome the deficiencies of the above-mentioned prior art and provide the application of membrane protein Sec63 gene and its dsRNA in pest control.
[0005] To achieve the above object, the technical solution of the present invention is as follows:
[0006] The first aspect of the present invention is a locust membrane protein Sec63 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1. The sequence is obtained by searching the locust transcriptome database, the open reading frame of the sequence is 2277 bp, and encodes 785 amino acids.
[0007] The second aspect of the present invention is a locust membrane protein Sec63 gene fragment, the nucleotide sequence of which is shown in SEQ ID NO:2.
[0008] The third aspect of the present invention is a dsRNA of the locust membrane protein Sec63 gene, which is synthesized using the locust membrane protein Sec63 gene fragment described in the second aspect.
[0009] The fourth aspect of the present invention is a method for synthesizing dsRNA of the locust membrane protein Sec63 gene described in the third aspect, comprising the following steps: designing an upstream primer as shown in SEQ ID NO: 3 and a downstream primer as shown in SEQ ID NO: 4 according to the sequence SEQ ID NO: 1, and then obtaining a product as shown in SEQ ID NO: 2 by PCR amplification, which is purified and transcribed to synthesize dsRNA.
[0010] The fifth aspect of the present invention is the use of the dsRNA of the locust membrane protein Sec63 gene described in the third aspect in pest control.
[0011] Furthermore, the dsRNA is prepared into a sprayable insecticide or bait, or the dsRNA is transferred into plants that are fed by pests.
[0012] Furthermore, the pest is a migratory locust.
[0013] Compared with the prior art, the present invention has the following beneficial effects:
[0014] After the dsRNA of the locust membrane protein Sec63 gene of the present invention is injected into the body cavity of the locust, the mRNA expression of the locust membrane protein Sec63 gene can be specifically silenced, and the locust will have difficulty in molting and die, providing a new specific molecular target for pest control based on RNA interference and a new technical approach for pest control. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 : Effect of injection of dsRNA synthesized by SEQ ID NO: 2 on the mRNA expression of Sec63 gene in 3rd instar migratory locusts (**P<0.005).
[0016] Figure 2 : Effect of injection of dsRNA synthesized by SEQ ID NO: 2 on the phenotype of 3rd instar migratory locusts (the left side is the control injected with dsGFP, and the right side is injected with dsRNA synthesized by SEQ ID NO: 2, i.e., dsLmSec63).
[0017] Figure 3 : Effect of injection of dsRNA synthesized by SEQ ID NO: 2 on the mRNA expression of Sec63 gene in 5th instar migratory locusts (***P<0.001).
[0018] Figure 4 : Effect of injection of dsRNA synthesized by SEQ ID NO: 2 on the phenotype of 5th instar migratory locusts (the left side is the control injected with dsGFP, and the right side is injected with dsRNA synthesized by SEQ ID NO: 2, i.e., dsLmSec63). DETAILED DESCRIPTION
[0019] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.
[0020] Example 1: Obtaining the full-length cDNA sequence and gene fragments of the locust membrane protein Sec63 gene
[0021] Based on the transcriptome database of locusts, the cDNA sequence of the locust membrane protein Sec63 gene was searched using bioinformatics methods to obtain the full-length cDNA sequence of the locust membrane protein Sec63 gene. The upstream and downstream primers were designed using primer premier 5.0 software to verify the full-length cDNA sequence and sent to Shanghai Bioengineering Co., Ltd. for synthesis. Four healthy, uniform-sized, half-male and half-female 5-year-old locust nymphs were selected and frozen in liquid nitrogen. RNA was extracted according to the TaKaRa RNAiso Plus kit, and the HiScript III qRT SuperMix (Nanjing Novogene Biotechnology Co., Ltd.) instruction manual was used to reverse transcribe the extracted RNA into the first-strand cDNA. Using this cDNA as a template, combined with the designed upstream and downstream primers, the full-length cDNA sequence of the Sec63 gene was amplified by PCR. The obtained product was purified, cloned and transformed into Escherichia coli, and sent to Shanghai Bioengineering Co., Ltd. for sequencing, and its sequence is SEQ ID NO: 1.
[0022] Example 2: Synthesis of dsRNA of locust membrane protein Sec63 gene
[0023] 1) Design of dsRNA primers for locust membrane protein Sec63 gene
[0024] Based on the sequence SEQ ID NO: 1 of the locust membrane protein Sec63 gene obtained in Example 1, dsRNA primers were designed using primerpremier5.0 software, the primer sequences were SEQ ID NO: 3 and SEQ ID NO: 4, and both the upstream and downstream primers carried T7 promoter sequences. All primers were synthesized by Shanghai Bioengineering Co., Ltd.
[0025] 2) Synthesis of dsRNA of locust membrane protein Sec63 gene
[0026] PCR amplification was performed using the upstream and downstream primers of SEQ ID NO: 3 and SEQ ID NO: 4 with the cDNA template of Example 1. The amplified PCR product, whose sequence is SEQ ID NO: 2, was purified by FastPure Gel DNA Extraction MiniKit (Vazyme) and then purified by T7 RiboMAX TM Express RNAi System (Promega) kit instructions: In vitro transcription was used to synthesize dsRNA (i.e., dsLmSec63). Quantification was performed using NANODROP 2000 (Thermo scientific) to a final concentration of 2 μg / μL. The dsRNA was stored in a -80°C ultra-low temperature freezer for future use.
[0027] Example 3: Experiment on killing 3rd instar locusts with dsRNA of locust membrane protein Sec63 gene
[0028] 1) Injection of dsRNA of locust membrane protein Sec63 gene
[0029] The nymphs of uniform size and consistent health status on the first day of the third instar were selected for injection of the dsRNA synthesized in Example 2. A 25 μl microsyringe was used for injection. Do not use too much force during injection. Follow the direction of blood flow and the junction of the 2nd and 3rd abdominal segments of the lateral abdomen as the injection point, avoiding the valve. The amount of dsRNA injected was 3 μg, and a control group of dsGFP (3 μg) was set up, with 10 insects in each group, 3 biological replicates, and a total of 30 insects. After the injection, the insects were raised in a 1L beaker in an artificial climate box (light: dark time = 14h:10h, temperature 30±2°C, humidity 60%), given fresh wheat seedlings and appropriate light, and sprayed with water to maintain humidity.
[0030] 2) Detection of silencing gene of membrane protein Sec63 in third-instar locusts
[0031] Nymphs injected with dsGFP and dsLmSec63 were collected 24 hours after injection for total RNA extraction. Four biological replicates were collected for each of the control and dsLmSec63 injection groups, with three test worms in each biological replicate. The RNA was reverse transcribed into first-strand cDNA, and the relative expression levels of the target gene (LmSec63) and housekeeping gene (β-actin) were detected by RT-qPCR, so as to calculate their silencing efficiency. The results showed that compared with the control group, the expression of LmSec63 gene in the test worms injected with dsLmSec63 was significantly reduced ( Figure 1 ).
[0032] 3) Observation of the phenotype of third-instar migratory locusts after dsRNA injection
[0033] After the 3rd instar nymphs were injected with dsRNA, the dsGFP control group began to molt 5 days later and all successfully molted to the 4th instar. After molting to the 4th instar, the morphology and vitality of the insects were normal. 24 out of 30 nymphs in the dsLmSec63 treatment group could not complete the molt and eventually died. The phenotype was as follows Figure 2 As shown: the old epidermis of the head and thorax can crack but the old and new epidermis cannot be separated, eventually leading to death.
[0034] Example 4: Experiment on killing 5th instar locusts with dsRNA of locust membrane protein Sec63 gene
[0035] 1) Injection of dsRNA of locust membrane protein Sec63 gene
[0036] The nymphs of uniform size and consistent health status on the third day of the fifth instar were selected for injection of the dsRNA synthesized in Example 2. A 25 μl microsyringe was used for injection. Do not use too much force during injection. Follow the direction of blood flow and the junction of the 2nd and 3rd abdominal segments of the lateral abdomen as the injection point, avoiding the valve. The amount of dsRNA injected was 10 μg, and a control group of dsGFP (10 μg) was set up, with 10 insects in each group, 3 biological replicates, and a total of 30 insects. After the injection, the insects were raised in an artificial climate box with a 1L beaker (light: dark time = 14h:10h, temperature 30±2°C, humidity 60%), given fresh wheat seedlings and appropriate light, and sprayed with water to maintain humidity.
[0037] 2) Detection of silencing gene of membrane protein Sec63 in 5th instar locust
[0038] Nymphs injected with dsGFP and dsLmSec63 were collected 24 hours after injection for total RNA extraction. Four biological replicates were collected for each of the control and dsLmSec63 injection groups, with three test worms in each biological replicate. The RNA was reverse transcribed into first-strand cDNA, and the relative expression levels of the target gene (LmSec63) and housekeeping gene (β-actin) were detected by RT-qPCR, so as to calculate their silencing efficiency. The results showed that compared with the control group, the expression of LmSec63 gene in the test worms injected with dsLmSec63 was significantly reduced ( Figure 3 ).
[0039] 3) Observation of the phenotype of the fifth-instar migratory locust after injection of dsRNA
[0040] After the 5th instar nymphs were injected with dsRNA, the dsGFP control group began to molt 7 days later and all successfully molted into adults. After molting into adults, the insect body morphology and vitality were normal. 25 out of 30 nymphs in the dsLmSec63 treatment group could not complete the molt and eventually died. The phenotype was as follows Figure 4 As shown: the old epidermis of the head and thorax can crack but the old and new epidermis cannot be separated, eventually leading to death.
[0041] The above description is only for better explaining the embodiments of the present invention, and is not intended to limit the present invention. Any modification or equivalent substitution that does not depart from the spirit and scope of the present invention shall fall within the scope of the present invention.
[0042] SEQ ID NO: 1
[0043]
[0044] SEQ ID NO:2
[0045] MGGQKFQYDESGGTFFYFLLSFLALLLIPGTYYWWPRKRREDPAKYEKECHCDDCKKKKLILQANEPWKGTKQMLTKLLIISGWLILALLAYKVSQFDYEYANFDPYEILGIPLGASQADIRKQYRKLSLILHPDKETGNEKAFMKLTKAYQALTDEEARRNWEKYGNPDGPGAMSFGIALPSWIVEKENSVWVLGLYALVFMVALPTVVGMWWYKSIRYSGDQVLLNTTQMYYYFFHKTPSMALKRVIMILAASLEFEKKHNSEIVERPTDNEEVPHLIKQISNLSEKNRERPLCFLYSLKARAIIHAHLSRIPLNPETLDKDRQYIVKKCPYLIQEMVNCVSQLILLAYARRIPRLPNIETIENCMKLCPMIVQAMWEYKSPLLQLPYVTDDNLKYFVNKKRYIKTIQQFAQLKHEDRRSILRNLSDEQYNDVMKVAGKMPYVEFKVKSEVIDDENPTVYTAGAIVTVTVTLIRHDMSILFGDDTKAAQNAPPQETVEDLAEKEKEQPAKKEEQAKKPVWQKQQKKGKKTNKKSSRSQKASSRSTPAKKADEKPQATNETQDVPTKKATAESGDESDTSDDEVERSDDEENENSQGDKKGSSVEEDDVEWEKFRARLHKREKVLEGRSKQSHSVHCPFFPEDKQEYWWVYISDRKSHTLLTSPYHVTDLVEEEEVQLKFTAPRWPGIYTFTVCLRSDSYLGFDQMQDIKLDVKEAPEIPTEHPQWEMSDEEEDEQEAEGSDVSEFTTDEDVEDDQD
[0046] SEQ ID NO:3
[0047] TGGATTGTATGCTCTTGTT
[0048] SEQ ID NO:4
[0049] TGAGACAATAGAAAACTGC
[0050] SEQ ID NO:5
[0051] TGGATTGTATGCTCTTGTTTTCATGGTTGCTTTGCCCACTGTTGTGGGAATGTGGTGGTACAAGTCTATTCGATATTCTGGAGACCAGGTTCTGCTTAATACTACACAGATGTATTACTATTTCTTTCA CAAAACACCTTCAATGGCTCTAAAAGAGTAATTATGATCCTTGCAGCCTCTCTGGAGTTTGAGAAGAAGCACAACAGTGAGATTGTTGAGAGACCTACTGACAATGAAGAAGTTCCTCATCTCATTAAA CAGATATCAAACCTCAGTGAGAAGAATCGTGAGCGGCCTCTGTGCTTCCTGTATTCTTTGAAGGCACGTGCTATCATTCATGCGCATCTGTCTCGAATTCCACTCAACCCAGAAACCTTGGACAAGGAT CGGCAGTACATAGTTAAAAAATGCCCATATCTTATTCAAGAAATGGTCAACTGCGTGTCCCAGCTCATTCTTCTGGCATATGCCAGGCGAATACCGAGACTGCCAAATATTGAGACAATAGAAAACTGC。
Claims
1. A locust membrane protein Sec63 gene, characterized in that: The nucleotide sequence is shown in SEQ ID NO:
1.
2. A locust membrane protein Sec63 gene fragment, characterized in that: The nucleotide sequence is shown in SEQ ID NO:
2.
3. A dsRNA of the locust membrane protein Sec63 gene, characterized in that: The method is synthesized using the locust membrane protein Sec63 gene fragment described in claim 2.
4. The method for synthesizing dsRNA of the locust membrane protein Sec63 gene according to claim 3, characterized in that: The method comprises the following steps: designing an upstream primer as shown in SEQ ID NO: 3 and a downstream primer as shown in SEQ ID NO: 4 according to the sequence SEQ ID NO: 1, and then obtaining a product as shown in SEQ ID NO: 2 by PCR amplification, which is purified and transcribed to synthesize dsRNA.
5. Use of the dsRNA of the locust membrane protein Sec63 gene according to claim 3 in pest control.
6. The use of dsRNA of the locust membrane protein Sec63 gene according to claim 5, characterized in that: The dsRNA is prepared into a sprayable insecticide or bait, or the dsRNA is transferred into plants that the pests feed on.
7. The use of dsRNA of the locust membrane protein Sec63 gene according to claim 5, characterized in that: The pest is locust.
Citation Information
Patent Citations
Compositions for mosquito control and uses of same
CN108064133A
Primers for synthesizing full-length cDNA and their use
US20070105122A1