Preparation method and application of CAR-T cell for overexpressing C1QBP

Abstract

The invention provides a preparation method and application of CAR-T cells for overexpressing C1QBP, and relates to the field of cell engineering. According to the CAR-T cell overexpressing the C1QBP, the energy metabolism of the cell is optimized by improving the oxidative phosphorylation of mitochondria, the formation of memory-like T cells is promoted, and the anti-tumor activity and long-term durability of the CAR-T cell are enhanced. The cells can survive in a tumor microenvironment for a long time, and the anti-tumor effect of the cells is more durable than that of traditional CAR-T cells. Therefore, a new direction is provided for research and development of cellular immunotherapy.

Description

Technical Field

[0001] The present invention relates to the field of cell engineering, and in particular to a preparation method and application of CAR-T cells overexpressing C1QBP. Background Art

[0002] CAR-T (Chimeric Antigen Receptor T-cell) therapy is an innovative immunotherapy that has made significant progress in the treatment of certain hematological malignancies. This therapy transforms the patient's autologous T cells into CAR-T cells expressing tumor-specific antigen receptors through genetic engineering, which can efficiently recognize and kill tumor cells. Clinical studies have shown that CAR-T therapy can achieve significant therapeutic responses in some patients when treating hematological tumors such as acute lymphoblastic leukemia (ALL) and diffuse large B-cell lymphoma (DLBCL), and some patients achieve sustained complete remission after treatment. However, despite the good initial response, the durability of CAR-T therapy remains a major challenge. Data show that approximately 30-40% of patients experience tumor recurrence within 1 year after treatment, and recurrence is usually associated with a decrease in the persistence and loss of function of CAR-T cells in the body. Immune escape from the tumor microenvironment, the decline of CAR-T cells, and their loss of function in sustained immune responses are important factors leading to treatment failure. Therefore, improving the long-term survival and sustained anti-tumor ability of CAR-T cells, especially in the treatment of solid tumors, has become a key direction of current research.

[0003] C1QBP (Complement Component 1, Q Subcomponent Binding Protein), also known as gC1qR (glycoprotein C1qreceptor), is a multifunctional glycoprotein widely present in various cell types. C1QBP was originally discovered to regulate immune responses by binding to the C1q subunit of the complement system. In addition to its role in the complement system, C1QBP is also involved in cell signaling, metabolic regulation, immune tolerance, cell survival, and regulation of inflammatory responses. It has important functions both inside and outside cells and is widely distributed in a variety of tissues and organs, including immune cells, endothelial cells, muscle cells, and nerve cells. As a membrane receptor, C1QBP is able to interact with cell surface receptors and molecules on the mitochondrial membrane. This makes it not only involved in the signaling of immune cells, but also closely related to the metabolic function of mitochondria. C1QBP regulates the oxidative phosphorylation function of mitochondria by interacting with mitochondria, supporting the long-term survival of cells under high energy demands.

[0004] C1QBP overexpression has not been used in human CAR-T cells, so whether it can effectively solve the current problem of insufficient persistence of CAR-T cells still needs further study. Although C1QBP has been shown to play an important role in regulating cell metabolism, enhancing immune response and supporting long-term cell survival, the strategy of using C1QBP overexpression in CAR-T cells has not been verified. At present, although CAR-T therapy has significant efficacy in early tumor treatment, many patients are at risk of tumor recurrence due to the functional decline of CAR-T cells and their immune escape in the tumor microenvironment. C1QBP may improve the long-term survival and immune memory of CAR-T cells by enhancing the mitochondrial function and metabolic adaptability of T cells, thereby achieving a lasting anti-tumor effect. Therefore, CAR-T cells with overexpression of C1QBP are expected to provide a new direction for solving the persistence problem. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention provides a method for preparing CAR-T cells overexpressing C1QBP and applications thereof. CAR-T cells overexpressing C1QBP can enhance the formation of memory-like T cells and persistent immune response, thereby improving the therapeutic efficacy and prolonging the therapeutic effect. Overexpressing C1QBP can enhance the survival, proliferation and anti-tumor efficacy of CAR-T cells by regulating mitochondrial metabolism.

[0006] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0007] A method for preparing a CAR-T cell overexpressing C1QBP, the method comprising the following steps:

[0008] S1. Design C1QBP gene sequence and tNGFR gene sequence;

[0009] S2. Preparation of CAR gene sequence bacterial solution: inserting C1QBP and tNGFR gene sequence fragments into the lentiviral vector pCDH-CD19-CAR, and selecting and constructing the CAR sequence bacterial solution through sequencing identification;

[0010] S3. Preparation of lentivirus containing C1QBP and tNGFR genes: plasmid extraction was performed on the above CAR sequence bacterial solution, and then lentivirus packaging was used. The pCDH-CD19-CAR vector containing C1QBP and tNGFR genes and auxiliary plasmids pMD2.G and pSPAX2 were co-transfected into HEK293T cells to obtain lentivirus containing C1QBP and tNGFR genes;

[0011] S4. Preparation of CAR-T cells overexpressing C1QBP: Isolate T cells required for preparing CAR-T cells from peripheral blood, co-transduce lentivirus containing C1QBP and tNGFR genes with T cells to prepare CAR-T cells overexpressing C1QBP;

[0012] S5. Expansion and culture: The above-mentioned C1QBP-overexpressing CAR-T cells are expanded in a culture medium containing cytokines to promote the proliferation of CAR-T cells and the formation of a memory-like phenotype.

[0013] Preferably, in step S1, the C1QBP gene sequence is shown as SEQ ID NO.1, and the tNGFR gene sequence is shown as SEQ ID NO.2.

[0014] Preferably, the CAR gene in step S2 contains at least an antibody single-chain variable fragment scFv portion that recognizes tumor cell surface antigens.

[0015] Preferably, the specific operations in step S2 include the following steps:

[0016] S2-1, seamless cloning: using homologous recombinase, CAR gene sequence fragment, double distilled water, and linearized pCDH-CD19-CAR vector cut by Not I restriction endonuclease, a seamless cloning product was obtained after reaction;

[0017] S2-2, transformation and plating: the seamless cloned products and competent cells were cultured in LB liquid medium without antibiotics, and then spread on the surface of LB plates containing antibiotics and cultured upside down;

[0018] S2-3. Bacteria picking and sequencing: Randomly pick a number of bacterial plaques on the LB plate, place them in LB liquid culture medium containing ampicillin resistance, and then sequence them. The sequencing results will be compared with the CAR gene sequence. The bacterial solution with the correct comparison is the CAR gene sequence bacterial solution.

[0019] Preferably, the reaction system in step S2-1 is a 10 μL system: 2 μL of homologous recombinase, 50 ng of CAR gene sequence fragment, 100 ng of linearized pCDH-CD19-CAR vector, and the rest is made up with 10 μL of double distilled water. The temperature is controlled at 50° C. and the reaction time is 60 min.

[0020] Preferably, polybrene is used as a transfection agent during the co-transduction in step S4.

[0021] Preferably, the cytokines in step S5 are any one or more combinations of L-2, IL-15 and IL-7.

[0022] CAR-T cells overexpressing C1QBP are used to prepare anti-tumor agents.

[0023] Preferably, the tumor is diffuse large B-cell lymphoma.

[0024] The present invention provides a preparation method and application of CAR-T cells overexpressing C1QBP, which have the following advantages over the prior art:

[0025] (1) In the present invention, C1QBP regulates the metabolism of CAR-T cells and enhances CAR-T function by enhancing mitochondrial function and promoting oxidative phosphorylation. Memory-like CAR-T cells mainly rely on oxidative phosphorylation to provide a continuous energy supply. C1QBP enhances the metabolic adaptability of CAR-T cells by promoting mitochondrial ATP production and maintaining mitochondrial membrane potential. In the immune response, C1QBP helps CAR-T cells avoid excessive reliance on glycolysis, thereby promoting their transformation into memory-like CAR-T cells and ensuring their long-term survival and rapid response capabilities. This mechanism provides energy support for the formation of memory CAR-T cells and helps to enhance the long-term anti-tumor ability of the immune system. Therefore, it provides a new direction for the research and development of cellular immunotherapy;

[0026] (2) The comparative advantage of overexpressing C1QBP over other CAR-T cells is that it can enhance the formation of memory-like T cells and lasting immune response. Its unique immune regulation mechanism and metabolic modification pathway can improve the efficacy and prolong the treatment effect;

[0027] (3) Overexpression of C1QBP can enhance the survival, proliferation and anti-tumor efficacy of CAR-T cells by regulating mitochondrial metabolism. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Schematic diagram of the vector construction of CAR overexpressing C1QBP in Example 1 of the present invention, the preparation of CAR-T after overexpression, and the verification effect at the protein level; wherein A shows a schematic diagram of a second-generation CAR (tNGFR CD19 CAR) targeting hCD19 expressing human tNGFR (truncated nerve growth factor receptor molecule) as a control and a second-generation CAR (C1QBP CD19 CAR) targeting hCD19 expressing human C1QBP, both of which are modified and inserted after the P2A element; B is the transduction of tNGFR CD19 CAR or C1QBP CD19 CAR constructs by lentiviral vectors, and the expression level of CAR is analyzed by flow cytometry; C is the verification of the overexpression effect at the protein level;

[0029] Figure 2Schematic diagram of the anti-tumor ability of CAR-T cells overexpressing C1QBP in Example 2 of the present invention; wherein AB represents the changes in the functions of CD3+CAR-T cells, CE represents the analysis of cell survival and death by flow cytometry; FH represents the secretion of key immune cytokines such as IFN-γ and TNF-α in the cytotoxic supernatant detected by Elisa;

[0030] Figure 3 Schematic diagram of changes in cell population and proportion of CAR-T cells overexpressing C1QBP under repeated stimulation of tumor cells Raji in Example 3 of the present invention; wherein AB represents changes in CAR-T cell population and CD8+CAR-T cell proportion after the first tumor stimulation, TEM (CD45RO+CD62L-); TCM (CD45RO+CD62L+); TEFF (CD45RO-CD62L-); TN (CD45RO-CD62L+); CJ represents changes in CAR-T cell population and CD8+CAR-T cell proportion after the second to fifth tumor cell Raji stimulation;

[0031] Figure 4 Schematic diagram of the expression of CD3+ and CD8+CAR-T cell exhaustion markers in CAR-T cells overexpressing C1QBP under repeated stimulation of tumor cells Raji in Example 4 of the present invention; AB is the expression of LAG-3 in CD3+ and CD8+CAR-T after repeated stimulation of CAR-T cells by tumors; CD is the expression of PD-1 in CD3+ and CD8+CAR-T after repeated stimulation of CAR-T cells by tumors; EF is the expression of TIM-3 in CD3+ and CD8+CAR-T after repeated stimulation of CAR-T cells by tumors; GH is the expression of CD39 in CD3+ and CD8+CAR-T after repeated stimulation of CAR-T cells by tumors;

[0032] Figure 5Schematic diagram of the characteristics of proliferation and generation of more memory-like phenotypes of CAR-T cells overexpressing C1QBP in Example 5 of the present invention; AC is the proliferation of CD3+ and CD8+ CAR-T cells cultured in complete medium containing 200U / mL interleukin-2 (IL-2) for 7 days after CAR-T cells were stained with Cell Trace Violet; D is the cell count of CD3+ and CD8+ CAR-T cells cultured for 7 days as above; E is the CAR-T cells cultured in complete medium containing 20ng / mL interleukin 15 (IL-15) and 10ng / mL interleukin 7 (IL-7) for 5 days, after which IL-15 / 1L-7 was withdrawn and tumor necrosis factor α was used simultaneously. Flow cytometry was used to detect the changes in the proportion of TEM and TCM populations in CD3+CAR-T cells 24 hours after tumor cell Raji stimulation; F is CAR-T cells were cultured in complete medium containing 20 ng / mL interleukin 15 (IL-15) and 10 ng / mL interleukin 7 (IL-7) for 10 days, and then IL-15 / 1L-7 was withdrawn and tumor cell Raji was used to stimulate the cells for 24 hours, and then flow cytometry was used to detect the changes in the proportion of TEM and TCM populations in CD3+CAR-T cells;

[0033] Figure 6 The trajectories of mitochondrial membrane potential (TMRM), ROS (MitoSOX) expression and oxygen consumption rate (OCR) of CAR-T cells overexpressing C1QBP in Example 6 of the present invention; AB uses flow cytometry to detect the expression levels of mitochondrial ROS of CD3+ and CD8+CAR-T, respectively; CD uses flow cytometry to detect the expression levels of mitochondrial membrane potential (TMRM) of CD3+ and CD8+CAR-T, respectively; EF uses Seahorse XF-96 Cell Energy Metabolism Analyzer (Seahorse Bioscience) to measure oxygen consumption rate (OCR) and statistical results, respectively;

[0034] Figure 7 The CAR-T cells overexpressing C1QBP in Example 7 of the present invention have a stronger anti-tumor effect in vivo; A is a flow chart of the in vivo experiment; BC are the tumor bioluminescence images and quantitative values ​​of the in vivo experiment; D is the weight change of the mice during the in vivo experiment; E is the survival curve of the mice in the in vivo experiment. DETAILED DESCRIPTION

[0035] In order to explain the present invention more clearly, the following will further illustrate it through implementation cases and drawings.

[0036] Method for forming human strong functional memory-like CAR-T cells (CAR-T cells overexpressing C1QBP):

[0037] (1) Isolation of peripheral blood mononuclear cells (PBMC): Peripheral blood mononuclear cells (PBMC) were isolated from the peripheral blood of volunteers.

[0038] (2) Construction of CAR-T cell vector: Constructing a chimeric antigen receptor (CAR) gene vector containing an overexpressed C1QBP gene, wherein: the CAR gene at least comprises an antibody single-chain variable fragment (scFv) portion that recognizes tumor cell surface antigens. The CAR gene includes a sequence that overexpresses the C1QBP gene, and the C1QBP gene can promote T cell mitochondrial oxidative phosphorylation activity and enhance T cell survival and memory function.

[0039] (3) Preparation of CAR-T cells: The constructed CAR vector is introduced into T cells through a virus-mediated transduction method to obtain CAR-T cells overexpressing C1QBP.

[0040] (4) Expansion and culture: The transduced CAR-T cells are expanded in a culture medium containing cytokines (such as IL-2, IL-15, and IL-7) to promote the proliferation of CAR-T cells and the formation of a memory-like phenotype.

[0041] (5) CAR-T cell toxicity: Three CD19-positive B-cell lymphoma cell lines, Raji cells, Daudi cells, and SU-DHL-4, were used. CAR-T cells killed tumor cells at different effector-target ratios, and flow cytometry was used to detect the tumor cell lysis rate.

[0042] (6) Identification of memory-like phenotype: Analyze the memory-like phenotype of the CAR-T cells by flow cytometry, including but not limited to detecting the expression of memory cell markers such as CD45RO+ and CD62L+.

[0043] (7) Evaluation of anti-tumor activity: The killing effect and anti-tumor effect of the CAR-T cells on tumor cells were evaluated through in vitro experiments and animal experiments.

[0044] Among them, the CAR gene includes an antibody single-chain variable fragment (scFv) that specifically binds to the CD19 antigen, and the antibody single-chain variable fragment is derived from human CD19.

[0045] The CAR gene overexpressing C1QBP was transduced into T cells by lentiviral vector.

[0046] The cytokines include a combination of IL-2, IL-15 and IL-7, and the cytokine combination is used to maintain the proliferation, activity and memory phenotype of CAR-T cells.

[0047] The CAR-T cells are co-cultured with tumor cells in vitro to observe the cytotoxicity of the CAR-T cells and evaluate their anti-tumor effects.

[0048] The CAR-T cells were used for in vivo experiments in an immunodeficient mouse model to monitor tumor growth and evaluate the durable anti-tumor effect of CAR-T cells.

[0049] The CAR-T cells can significantly enhance the ability to clear tumor cells and maintain long-term anti-tumor activity in vivo.

[0050] The CAR-T cells maintain long-term survival in the body, have characteristics similar to memory T cells, and can exert lasting effects in continuous anti-tumor treatment.

[0051] The following examples used GraphPad Prism 9.0 (La Jolla, CA) statistical software to process the data. The experimental results are expressed as mean ± standard deviation. Statistical significance was evaluated by Student's t test for comparison between two groups, or by one-way analysis of variance (one-way ANOVA) for comparison between multiple groups. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a very significant difference, and P < 0.001 (***) indicates a very significant difference.

[0052] Embodiment 1:

[0053] Vector construction of CAR overexpressing C1QBP, preparation of CAR-T after overexpression, and WB identification results:

[0054] 1. Design of CAR overexpressing C1QBP and tNGFR against human CD19:

[0055] C1QBP and tNGFR gene sequences were synthesized by General Biotechnology (Anhui) Co., Ltd. C1QBP gene sequence (SEQ ID NO.1):

[0056] ATGCTGCCTCTGCTGCGCTGCGTGCCCCGTGTGCTGGGCTCCTCCGTCGCCGGCCTCCGCGCTGCCGCGCCCGCCTCGCCTTTCCGGCAGCTCCTGCAGCCGGCACCCCGGCTGTGCACCCGGCCCTTCGGGCTGCTCAGCGTGCGCGCAGGTTCCGAGCGGCGGCCGGGCCTCCTGCGGCCTCGCGGACCCTGCGCCTGTGGCTGTGGCTGCGGCTCGCTGCACACCGACGGAGACAAAGCTTTTGTTGATTTCCTGAGTGATGAAATTAAGGAGGAAAGAAAAATTCAGAAGCATAAAACCCTCCCTAAGATGTCTGGAGGTTGGGAGCTGGAACTGAATGGGACAGAAGCGAAATTAGTGCGGAAAGTTGCCGGGGAAAAAATCACGGTCACTTTCAACATTAACAACAGCATCCCACCAACATTTGATGGTGAGGAGGAACCCTCGCAAGGGCAGAAGGTTGAAGAACAGGAGCCTGAACTGACATCAACTCCCAATTTCGTGGTTGAAGTTATAAAGAATGATGATGGCAAGAAGGCCCTTGTGTTGGACTGTCATTATCCAGAGGATGAGGTTGGACAAGAAGACGAGGCTGAGAGTGACATCTTCTCTATCAGGGAAGTTAGCTTTCAGTCCACTGGCGAGTCTGAATGGAAGGATACTAATTATACACTCAACACAGATTCCTTGGACTGGGCCTTATATGACCACCTAATGGATTTCCTTGCCGACCGAGGGGTGGACAACACTTTTGCAGATGAGCTGGTGGAGCTCAGCACAGCCCTGGAGCACCAGGAGTACATTACTTTTCTTGAAGACCTCAAGAGTTTTGTCAAGAGCCAGTAG

[0057] tNGFR gene sequence (SEQ ID NO.2):

[0058] ATGGGCGCTGGTGCAACTGGACGGGCCATGGATGGACCACGGCTTTTGCTCCTGTTGTTGTTGGGCGTCAGCCTTGGAGGGGCTAAAGAGGCCTGCCCGACCGGTTTGTACACACACTCCGGCGAGTGTTGTAAGGCGTGTAATCTTGGCGAAGGGGTCGCCCAACCGTGTGGCGCCAACCAGACGGTTTGTGAGCCTTGCTTGGATAGCGTCACGTTTTCCGACGTCGTTTCAGCCACCGAACCATGCAAACCTTGTACGGAATGCGTGGGTCTGCAGAGCATGAGCGCACCGTGCGTAGAGGCGGACGATGCGGTATGCCGATGTGCCTACGGCTACTACCAAGACGAGACGACAGGGAGGTGTGAGGCATGCAGAGTATGTGAGGCCGGGTCTGGACTCGTATTTTCCTGTCAAGACAAACAAAACACAGTATGTGAGGAGTGCCCGGATGGGACTTATTCCGATGAAGCGAATCATGTGGACCCGTGCTTGCCATGTACGGTCTGTGAGGATACCGAAAGACAGCTCCGAGAATGCACCCGCTGGGCTGACGCGGAATGCGAAGAAATCCCAGGTCGATGGATCACCCGCTCAACCCCCCCCGAAGGGTCAGATTCTACGGCGCCCTCTACTCAGGAGCCAGAAGCTCCACCCGAACAAGACCTGATCGCTTCTACGGTGGCAGGTGTCGTTACAACAGTCATGGGTTCCTCACAACCTGTGGTTACGCGGGGGACAACTGACAATTTGATTCCAGTATATTGTAGCATTCTGGCCGCGGTCGTGGTAGGGCTTGTCGCGTATATAGCGTTCAAAAGGTGGAACAGC

[0059] 2. Preparation of CAR gene sequence bacterial liquid:

[0060] The C1QBP and tNGFR gene sequence fragments were inserted into the lentiviral vector pCDH-CD19-CAR by seamless cloning technology, and the correctly constructed CAR sequence bacterial liquid was selected by sequencing identification:

[0061] Seamless cloning: using homologous recombinase, CAR gene sequence fragment, double distilled water, and linearized pCDH-CD19-CAR vector cut by Not I restriction endonuclease, the reaction system is 10 μL system: 2 μL homologous recombinase, 50 ng CAR gene sequence fragment, 100 ng linearized pCDH-CD19-CAR vector, and 10 μL of double distilled water to make up the rest, the temperature is controlled at 50°C, the reaction time is 60 min, and seamless cloning products are obtained;

[0062] Transformation and plating: Take out competent cells (DH5α) from -80℃, immediately place on ice to thaw, take 5μL of seamless clone product, add to the pre-thawed competent cells, mix gently, and place on ice for 30min. Heat shock at 42℃ for 90s, do not shake the test tube, and immediately stop the ice bath for 5min.

[0063] Add 200 μL of LB liquid medium without antibiotics to each tube, shake at 37°C, 150 rpm for 30 minutes. Spread 100 μL of bacterial liquid on the surface of LB plate containing corresponding antibiotics (Amp) with sterile glass beads, incubate upright at 37°C for 30 minutes, and then invert and culture overnight.

[0064] Bacteria picking and sequencing: Randomly pick several plaques from the LB plate and place them in a shaking tube containing 5 mL of ampicillin-resistant LB liquid culture medium. Control the temperature at 37°C and 200 rpm and shake the tube for 10-12 hours. When the bacterial solution becomes turbid, take 100 μL of each plate for sequencing. Compare the sequencing results with the CAR gene sequence, and obtain the bacterial solution with the correct alignment to obtain the bacterial solution with the CAR gene sequence.

[0065] 3. Preparation of lentivirus containing C1QBP and tNGFR genes:

[0066] After plasmid extraction, lentivirus packaging was used and the pCDH-CD19-CAR vector containing C1QBP and tNGFR genes and auxiliary plasmids pMD2.G and pSPAX2 were co-transfected into HEK293T cells to obtain viral particles.

[0067] Plasmid extraction: Take out 100 μL of bacterial solution containing the target sequence, put it into 200 mL of LB liquid culture medium, control it at 37°C and 200 rpm, shake the bacteria on a shaker, and extract the pCDH-CD19-CAR vector containing the target sequence after 12 hours, including pMD2.G and pSPAX2;

[0068] Virus packaging: One day before transfection, passage 293T cells at 2:5 into 10 cm dishes and incubate at 37°C, 5% CO 2Culture in an incubator. When the cell density reaches 80% to 90%, it can be used for transfection. Replace the cell culture medium with 6 mL of preheated complete culture medium 1-2 h before transfection. Add 300 μL jetPRIME buffer and the corresponding mass of plasmid (pMD2g: ​​psPAX2: PCDH-CAR-CD19 = 1:3:4, a total of 12 μg) to a sterile 1.5 mL EP tube A, mix well after adding, then add 25 μL of jetPRIME and shake gently, incubate at room temperature for 10 min. Transfer the mixture to the culture medium of 293T cells, mix well, and incubate at 37°C, 5% CO 2 Culture in a cell culture incubator, and replace with 10 mL of preheated complete medium after 8 h. Virus supernatant was collected at 48 h and 72 h. The collected supernatant was filtered through a 0.45 μm (PES) membrane filter to remove cell residues.

[0069] 4. Preparation of human anti-CD19 CAR-T cells:

[0070] Antibody plating: Anti-human CD3 / CD28 antibody plating. Add antibodies to PBS to a final concentration of 5μg / mL anti-human CD3 and 2.5μg / mL anti-human CD28, add 500μL to each well of a 12-well plate, seal with tape and place in a 4°C refrigerator overnight.

[0071] PBMC isolation and plating: Peripheral blood mononuclear cells (PBMCs) were isolated from peripheral blood by density gradient centrifugation using Ficoll. Fresh blood was diluted with phosphate-buffered saline (PBS), plated on Ficoll, and centrifuged at 500 × g for 30 min at room temperature. The mononuclear cell layer was collected, washed with 1 × PBS, and the cell number was determined using a Countstar automated cell counter (Shanghai, China). PBMCs (1 × 10 6 Cells / well) were seeded and transduced 24 h later.

[0072] PBMC infection and culture: Activated T cells were co-transduced with lentivirus in the presence of 8 μg / mL polybrene and an MOI of 10. To increase transduction efficiency, the plates were centrifuged at 800 × g for 1.5 h at 37 °C, and the medium was replaced 6-8 h after infection. Transduced lymphocytes were maintained in medium supplemented with IL-2 (200 IU). On day 4 after transduction, CAR expression was quantified by flow cytometry using GFP+ as a reporter gene.

[0073] 5. Western Blotting (WB) to detect the expression of C1QBP translation protein level

[0074] Glue preparation: prepare the lower layer of glue (10%), pour it into the glass plate, flatten it with isopropyl alcohol, and wait for it to solidify. Prepare the upper layer of glue, pour it on the solidified lower layer of glue, install the comb, and wait for it to solidify naturally.

[0075] Electrophoresis: Fix the gel plate, add electrophoresis solution, remove the comb, add standard marker and sample. Set 90V electrophoresis for 30min, 120V electrophoresis for 60min.

[0076] Transfer: Prepare the transfer cassette, build a sandwich structure, add the wet PVDF membrane, and install the transfer tank. Set 200mA, transfer for 60min, and cool to ice bath.

[0077] Blocking: Wash the PVDF membrane after transfer, place it in blocking solution, and block it on a shaker for 20 minutes.

[0078] Incubation with primary antibody: After washing the membrane, add pre-warmed primary antibody solution and incubate overnight at 4°C.

[0079] Incubation with secondary antibody: After washing the membrane, add secondary antibody solution and incubate on a shaker for 1 hour.

[0080] Development: Mix the developer solution and apply it to the membrane for development until the bands are visible.

[0081] 6. Experimental results:

[0082] like Figure 1 The experimental results showed that the preparation of CAR-T cells overexpressing C1QBP was completed. At the same time, WB results showed that the preparation of CAR-T cells overexpressing C1QBP was completed and overexpressed at the protein level.

[0083] Embodiment 2:

[0084] CAR-T cells overexpressing C1QBP have stronger anti-tumor ability detection:

[0085] 1. Tumor cell Raji stimulates CAR-T cells:

[0086] CAR-T cells (2×10 4 ) and Raji (2×10 4 ) were co-cultured in a 96-well "U"-shaped plate at a ratio of (E:T=1:1) for 12 h.

[0087] 2. Flow cytometry to detect CAR-T cell effector function:

[0088] The cells were collected, washed with 1 mL of PBS, and then incubated with dead / live cell dye (Zombie Dyes) to exclude dead cells. After this step, the cells were stained with all relevant antibodies (APC / Cy7 anti-human CD3 (cloneUCHT1; 300470); PE / Cyanine7 anti-human CD8 (clone SK1; 344712); APC anti-humanIFN-γ (clone 4S.B3; 502512); PE anti-human TNF-α (clone MAb11; 502909);) at room temperature for 0.5 h. The cells were then washed with PBS and finally remixed with 200 μL PBS. Data were analyzed using FlowJo software.

[0089] 3. Cytotoxicity of CAR-T cells:

[0090] Cell staining and plating: Raji cells, Daudi cells, and SU-DHL-4 cells were suspended in PBS and the cell concentration was adjusted to 1×10 6 cells / mL. Prepare CTV working solution as needed. The final working concentration of CTV is 5 μM, dissolved in sterile PBS. Add the CTV working solution to the cell suspension to ensure uniform distribution of the dye. Stain the cells with 5 μM CTV dye and incubate for 20 min. After staining, add cold PBS or culture medium and remove the CTV solution by centrifugation. Wash the cells 2-3 times to remove unbound CTV. Co-culture for 24 h using different effector-target ratios (0.25:1, 0.5:1, 1:1).

[0091] Flow cytometry to detect the survival and mortality of target cells:

[0092] After the co-culture, 7-AAD (420404, BioLegend, USA) was added and the samples were analyzed by flow cytometry. Cytotoxicity was calculated by the following formula:

[0093] (Percentage of 7-AAD+ in the experimental group - percentage of 7-AAD+ in the control group) / (100% - percentage of 7-AAD+ in the control group).

[0094] 4.ELISA detection of CAR-T cell cytokines:

[0095] Sample preparation: Collect supernatant: After 24 h of cell culture, collect the culture supernatant for ELISA analysis.

[0096] Add sample: Add the collected CAR-T cell supernatant to the ELISA plate, 100 μL per well. The appropriate dilution factor can be selected according to the expected concentration range.

[0097] Incubation: Incubate at room temperature for 1-2 hours to allow cytokines to bind to the capture antibody.

[0098] Washing: After incubation, wash the plate with PBST to remove unbound sample.

[0099] Add detection antibody: Add detection antibody that binds to the target cytokine, i.e., HRP (horseradish peroxidase) labeled antibody, 100 μL per well. Incubate for 1 hour.

[0100] Wash: Wash the plate again with PBST to remove unbound detection antibody.

[0101] Substrate reaction: Add substrate solution (TMB, tetramethylbenzidine), the substrate will bind to HRP to produce a visible color reaction, usually incubated at room temperature for 20 minutes.

[0102] Stop the reaction: Add stop solution (sulfuric acid) to terminate the reaction.

[0103] Absorbance measurement: Use an ELISA reader to measure the absorbance value (OD value) of each well at a wavelength of 450 nm.

[0104] Data analysis: Calculate the concentration of cytokines based on the standard curve. The standard curve is made by using standards of known concentrations.

[0105] 3. Experimental results:

[0106] like Figure 2 As shown: C1QBP-overexpressing CAR-T cells enhance immune response and promote tumor cell death by increasing the secretion of key immune cytokines such as IFN-γ and TNF-α. Elisa results show that C1QBP-overexpressing CAR-T cells can effectively identify and kill tumor cells, while inhibiting the immune escape ability of tumor cells. The experimental results show that C1QBP-overexpressing CAR-T cells have significantly enhanced effects in targeted killing of tumor cells, and have anti-tumor potential superior to ordinary CAR-T cells.

[0107] That is, C1QBP-overexpressing CAR-T cells can significantly improve the killing ability of CD19-positive tumor cells in diffuse large B-cell lymphoma (DLBCL), and compared with traditional CAR-T cells, they show stronger immune response and more effective tumor clearance potential.

[0108] Embodiment 3:

[0109] Changes in cell populations and proportions of CAR-T cells overexpressing C1QBP under repeated stimulation of tumor cells Raji:

[0110] 1. Tumor cells Raji repeatedly stimulate:

[0111] CAR-T cells (1×10 4 ) and Raji (1×10 4 ) were co-cultured in a 96-well "U"-shaped plate at a ratio of (E:T=1:1). The stimulation cycle was set to one round of stimulation every 2 days, and flow cytometry was used to analyze the proportion and number of cell populations after each stimulation.

[0112] 2. Flow cytometry detection of cell populations and proportions:

[0113] The cells were collected, washed with 1 mL of PBS, and then incubated with dead / live cell dye (Zombie Dyes) to exclude dead cells. After this step, the cells were stained with all relevant antibodies (APC / Cy7 anti-human CD3 (cloneUCHT1; 300470); PE / Cyanine7 anti-human CD8 (clone SK1; 344712); PE anti-humanCD62L (clone DREG-56; 304806); APC anti-human CD45RO (clone UCHL1; 304210)) at room temperature for 0.5 hours. The cells were then washed with PBS and finally remixed with 200 μL PBS. Data were analyzed using FlowJo software.

[0114] 3. Experimental results:

[0115] like Figure 3 As shown: CAR-T cells overexpressing C1QBP show more TCM formation in the cell population compared with ordinary CAR-T cells under repeated stimulation of tumor cells Raji. At the same time, the proportion of CD8+CAR-T increases continuously during repeated stimulation. That is, the overexpression of C1QBP can promote the differentiation of CAR-T cells into central memory T cells (TCM), and memory-like T cells have self-renewal ability and strong anti-tumor effects, can survive in the body for a long time and maintain a sustained immune response. In addition, the overexpression of C1QBP can also increase the proportion of CD8+T cells. This is because CD8+T cells are the main cell type that directly kills tumor cells in the immune response, and increasing their proportion helps to enhance the killing efficiency of CAR-T cells.

[0116] Embodiment 4:

[0117] Expression of CD3+ and CD8+ CAR-T cell exhaustion markers in CAR-T cells overexpressing C1QBP under repeated stimulation of tumor cells Raji:

[0118] 1. Tumor cells Raji repeatedly stimulate:

[0119] CAR-T cells (1×10 4 ) and Raji (1×10 4 ) were co-cultured in a 96-well "U"-shaped plate at a ratio of (E:T=1:1). The stimulation cycle was set to be stimulated once every 2 days, and flow cytometry was used to analyze the proportion and number of cell populations after each stimulation.

[0120] 2. Flow cytometry detection of cell populations and proportions:

[0121] The cells were collected, washed with 1 ml PBS, and then incubated with dead / live cell dye (Zombie Dyes) to exclude dead cells. After this step, the cells were incubated with all relevant antibodies (APC / Cy7 anti-human CD3 (cloneUCHT1; 300470); PerCP / Cyanine5.5 anti-human CD8 (clone RPA-T8; 301032); PE anti-human LAG-3 (clone 11C3C65; 369306); APCanti-human CD39 (clone A1; 328210); Brilliant Violet 605 TM anti-human CD366(Tim-3)(clone F38-2E2; 345017); BrilliantViolet 421 TM Anti-human CD279 (PD-1) (clone EH12.2H7; 329920)) was stained at room temperature for 0.5 h. The cells were then washed with PBS and remixed with 200 μL PBS. Data were analyzed using FlowJo software.

[0122] 3. Experimental results:

[0123] like Figure 4As shown: CAR-T cells overexpressing C1QBP show lower expression of exhaustion markers compared with ordinary CAR-T cells under repeated stimulation of tumor cells Raji. Under repeated tumor stimulation, CAR-T cells overexpressing C1QBP can maintain high proliferation and efficacy under continuous antigen stimulation, reducing the occurrence of immune exhaustion. Traditional CAR-T cells often show high levels of immune exhaustion markers (such as PD-1, LAG-3, TIM-3 and CD39) under repeated stimulation, which is closely related to their functional failure.

[0124] Therefore, CAR-T cells overexpressing C1QBP reduced the expression of immune exhaustion markers under repeated stimulation, helping CAR-T cells maintain anti-tumor effects for a longer period of time and showing stronger durability under repeated tumor stimulation.

[0125] Embodiment 5:

[0126] CAR-T cells overexpressing C1QBP proliferate and develop more memory-like phenotypes:

[0127] 1. CAR-T proliferation detection experimental process:

[0128] Cell staining: CAR-T cells were suspended in PBS and the cell concentration was adjusted to 1×10 6 cells / mL. Prepare CTV working solution as needed. Typically, the final working concentration of CTV is 5μM, dissolved in sterile PBS. Add the CTV working solution to the cell suspension to ensure even distribution of the dye. Stain the cells with 5μM CTV dye and incubate for 25 minutes. After staining, add cold PBS or culture medium and remove the CTV solution by centrifugation. Wash the cells 2-3 times to remove unbound CTV. Finally, culture in complete culture medium with 200U / mL of interleukin-2 (IL-2) for 7 days.

[0129] Flow cytometry proliferation assay: cells were collected, washed with 1 mL PBS, and then incubated with dead / live cell dye (Zombie Dyes) to exclude dead cells. After this step, cells were stained with all relevant antibodies (APC / Cy7anti-human CD3 (clone UCHT1; 300470); PerCP / Cyanine5.5 anti-human CD8 (clone RPA-T8; 301032) at room temperature for 0.5 h. Cells were then washed with PBS and remixed with 200 μL PBS. Data were analyzed using FlowJo software.

[0130] 2. Detection of cell populations after IL-7 / IL-15 stimulation:

[0131] Experimental process: CAR-T cells were cultured in complete culture medium containing 20 ng / mL interleukin 15 (IL-15) and 10 ng / mL interleukin 7 (IL-7) for 5 and 10 days, and IL-15 / 1L-7 was withdrawn and tumor cells Raji were used for stimulation for 24 hours, and flow cytometry was used to detect changes in the proportion of TEM and TCM populations in CD3+ CAR-T.

[0132] Flow cytometry detection of cell populations: Collect cells, wash them with 1 ml PBS, and then incubate them with dead / live cell dye (Zombie Dyes) to exclude dead cells. After this step, cells were stained with all relevant antibodies (APC / Cy7anti-human CD3 (clone UCHT1; 300470); PE / Cyanine7 anti-human CD8 (clone SK1; 344712); PE anti-human CD62L (clone DREG-56; 304806); APC anti-human CD45RO) clone UCHL1; 304210)) at room temperature for 0.5 h. Then wash the cells with PBS and finally remix with 200 μL PBS. Data were analyzed using FlowJo software.

[0133] 3. Experimental results:

[0134] like Figure 5 As shown, CAR-T cells overexpressing C1QBP proliferated more rapidly and produced more cells ( Figure 5 A-5D). At the same time, after the removal of IL-7 / IL-15, CAR-T cells overexpressing C1QBP were still able to differentiate into a higher proportion of TCM populations after stimulation with tumor cells ( Figure 5 E-5F).

[0135] That is, CAR-T cells overexpressing C1QBP can show stronger proliferation ability under stimulation and can maintain an active proliferation state for a longer period of time. It also promotes the differentiation of CAR-T cells into memory-like T cell populations. Central memory T cells have strong self-renewal ability and long-term immune response ability, which enables C1QBP-overexpressing CAR-T cells to survive for a long time in the body and maintain a sustained anti-tumor effect.

[0136] Embodiment 6:

[0137] CAR-T cells overexpressing C1QBP had higher mitochondrial membrane potential (TMRM), lower mitochondrial ROS (MitoSOX), and higher mitochondrial oxidative phosphorylation.

[0138] 1. Flow cytometry of mitochondrial membrane potential (TMRM) of CAR-T cells: Collect cells, wash them with 1 ml PBS, and then incubate them with dead / live cell dyes (Zombie Dyes) to exclude dead cells. After this step, cells were stained with all relevant antibodies (APC / Cy7anti-human CD3 (clone UCHT1; 300470); PE / Cyanine7 anti-human CD8 (clone SK1; 344712);) at room temperature for 0.5 h, then washed with PBS, stained with dye Tetramethylrhodamine, MethylEster (TMRM) for 15 min, washed with PBS, and finally remixed with 200 μL PBS. Data were analyzed using FlowJo software.

[0139] 2. Flow cytometry detection of mitochondrial ROS (MitoSOX) in CAR-T cells: Collect cells, wash them with 1 ml PBS, and then incubate them with dead / live cell dyes (Zombie Dyes) to exclude dead cells. After this step, cells were stained with all relevant antibodies (APC / Cy7anti-human CD3(clone UCHT1;300470); PE / Cyanine7 anti-human CD8(clone SK1;344712);) at room temperature for 0.5h, then washed with PBS, and then incubated with the dye MitoSOX. TM Red Mitochondrial Superoxide Indicator staining was performed for 15 min, and the cells were then washed with PBS and remixed with 200 μL PBS. Data were analyzed using FlowJo software.

[0140] 3. Seahorse Cell Energy Metabolism Analysis: Oxygen consumption rate (OCR) was measured using a Seahorse XF-96 Cell Energy Metabolism Analyzer (Seahorse Bioscience). CAR-T cells were collected on a 96-well plate coated with poly-D-lysine (2 × 10 cells per well). 5 cells) at 37°C without CO 2 The cells were cultured for at least 45 min under the condition of . After treatment with 1 μM oligomycin, 0.5 μM trifluoromethoxycyanophenylhydrazine (FCCP) and 1 μM rotenone (all produced by Sigma-Aldrich), the cell OCR (pmoL / min) was measured. The relevant quantitative data of at least three independent experiments were analyzed in duplicate.

[0141] 4. Experimental results:

[0142] like Figure 6 As shown: C1QBP-overexpressing CAR-T cells showed lower mitochondrial superoxide anion (O 2 - ) levels, indicating that its mitochondrial antioxidant system is more efficient. By reducing the accumulation of ROS, C1QBP-enhanced CAR-T cells can maintain activity and function in the face of intense immune responses ( Figure 6 A- Figure 6 B), CAR-T cells overexpressing C1QBP can store energy more efficiently due to their higher membrane potential, providing the energy support required for cell proliferation and sustained anti-tumor response ( Figure 6 C- Figure 6 D). At the same time, C1QBP overexpression also promoted the enhancement of mitochondrial oxidative phosphorylation pathway ( Figure 6 E- Figure 6 F), which is essential for cells to maintain efficient energy production. By enhancing oxidative phosphorylation, CAR-T cells can maintain a high energy state under long-term antigen stimulation, supporting their proliferation, activity and survival.

[0143] That is, overexpression of C1QBP not only improves the proliferation ability of CAR-T cells, but also enhances their persistence and anti-tumor effect by optimizing mitochondrial metabolism, increasing membrane potential, reducing ROS and enhancing oxidative phosphorylation. These changes make CAR-T cells with overexpression of C1QBP more resistant to CAR-T exhaustion in vivo and have stronger long-term anti-tumor activity.

[0144] Embodiment 7:

[0145] CAR-T cells overexpressing C1QBP have stronger anti-tumor effects in vivo

[0146] 1. Mice:

[0147] The same number of 6- to 8-week-old NOD / SCID / IL-2Rg-null (NSG) male mice with an initial body weight of 20-25 g were used in the experiment. They were obtained from Shanghai Model Organism Center (Shanghai, China). All animal experiments strictly followed the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (NIH) of the United States and were approved by the Animal Care and Use Ethics Committee of Anhui Medical University (approval number: LLSC20231069).

[0148] 2. In vivo experimental model:

[0149] On day 0, Raji-Luc cells (7×10 5) (injected into NSG mice (NOD / SCID / IL-2Rγ-null) by intravenous injection to establish a tumor model. On day 8, CAR-T cells (1×10 6 ) was administered intravenously to evaluate its therapeutic effect. The tumor burden and survival of mice were monitored every 3-4 days by bioluminescence imaging (BLI). The experiment continued until the experimental endpoint, and tumor growth and mouse survival data were recorded at each time point.

[0150] 3. Experimental results:

[0151] like Figure 7 As shown: Compared with mice with ordinary CAR-T cells, CAR-T cells overexpressing C1QBP showed significantly better tumor control, body weight maintenance, and prolonged survival ( Figure 7 A- Figure 7 E), demonstrated stronger anti-tumor efficacy.

[0152] That is, CAR-T cells overexpressing C1QBP showed stronger anti-tumor effects in vivo. C1QBP optimizes the function of CAR-T cells by enhancing the metabolic activity of CAR-T cells, especially by increasing mitochondrial oxidative phosphorylation, increasing membrane potential, and reducing ROS levels. It can better maintain activity in the tumor microenvironment, improving its proliferation ability and persistence. CAR-T cells overexpressing C1QBP significantly inhibited tumor growth in tumor models and prolonged the survival of mice. These improvements make CAR-T cells overexpressing C1QBP a potential anti-tumor treatment, especially in the treatment of drug-resistant tumors, which may provide more lasting and effective therapeutic effects.

[0153] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing CAR-T cells overexpressing C1QBP, characterized in that: The preparation method comprises the following steps: S1. Design C1QBP gene sequence and tNGFR gene sequence; S2. Preparation of CAR gene sequence bacterial solution: inserting C1QBP and tNGFR gene sequence fragments into the lentiviral vector pCDH-CD19-CAR, and selecting and constructing the CAR sequence bacterial solution through sequencing identification; S3. Preparation of lentivirus containing C1QBP and tNGFR genes: plasmid extraction was performed on the above CAR sequence bacterial solution, and then lentivirus packaging was used. The pCDH-CD19-CAR vector containing C1QBP and tNGFR genes and auxiliary plasmids pMD2.G and pSPAX2 were co-transfected into HEK293T cells to obtain lentivirus containing C1QBP and tNGFR genes; S4. Preparation of CAR-T cells overexpressing C1QBP: Isolate T cells required for preparing CAR-T cells from peripheral blood, co-transduce lentivirus containing C1QBP and tNGFR genes with T cells to prepare CAR-T cells overexpressing C1QBP; S5. Expansion and culture: The above-mentioned C1QBP-overexpressing CAR-T cells are expanded in a culture medium containing cytokines to promote the proliferation of CAR-T cells and the formation of a memory-like phenotype.

2. The preparation method according to claim 1, characterized in that: In the step S1, the C1QBP gene sequence is shown as SEQ ID NO.1, and the tNGFR gene sequence is shown as SEQ ID NO.

2.

3. The preparation method according to claim 1, characterized in that: In step S2, the CAR gene at least comprises an antibody single-chain variable fragment scFv portion that recognizes tumor cell surface antigens.

4. The preparation method according to claim 1, characterized in that: The specific operations in step S2 include the following steps: S2-1, seamless cloning: using homologous recombinase, CAR gene sequence fragment, double distilled water, and linearized pCDH-CD19-CAR vector cut by Not I restriction endonuclease, a seamless cloning product was obtained after reaction; S2-2, transformation and plating: the seamless cloned products and competent cells were cultured in LB liquid medium without antibiotics, and then spread on the surface of LB plates containing antibiotics and cultured inverted; S2-3. Bacteria picking and sequencing: Randomly pick a number of bacterial plaques on the LB plate, place them in LB liquid culture medium containing ampicillin resistance, and then sequence them. The sequencing results will be compared with the CAR gene sequence. The bacterial solution with the correct comparison is the CAR gene sequence bacterial solution.

5. The preparation method according to claim 4, characterized in that: The reaction system in step S2-1 is a 10 μL system: 2 μL of homologous recombinase, 50 ng of CAR gene sequence fragment, 100 ng of linearized pCDH-CD19-CAR vector, and the rest is made up with 10 μL of double distilled water. The temperature is controlled at 50° C. and the reaction time is 60 min.

6. The preparation method according to claim 1, characterized in that: In the step S4, polybrene is used as a transfection agent during co-transduction.

7. The preparation method according to claim 1, characterized in that: In step S5, the cytokines are any one or more combinations of L-2, IL-15 and IL-7.

8. Use of a C1QBP-overexpressing CAR-T cell prepared by any preparation method according to any one of claims 1 to 7 in the preparation of an anti-tumor agent.

9. The use according to claim 8, characterized in that: The tumor was diffuse large B-cell lymphoma.

Images