Medicine for treating cervical cancer as well as composition and diagnostic kit thereof
By developing a CMTM4-based cervical cancer diagnostic kit and preparing a therapeutic drug composition containing CMTM4 inhibitor, the problem of insensitivity to immunotherapy in patients with cervical cancer is solved, and the effect of enhancing the anti-tumor immune response and improving the therapeutic effect is achieved.
Patent Information
- Application Number
- CN202510193586.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-21
- Publication Date
- 2025-06-06
AI Technical Summary
Patients with cervical cancer are not sensitive to immunotherapy, mainly due to the suppression of the immune response in the tumor microenvironment, which makes the existing technology difficult to effectively solve this problem.
The effect of CMTM4 is blocked by using CMTM4 as a biomarker to develop a cervical cancer diagnostic kit and preparing therapeutic drug compositions containing CMTM4 inhibitors, such as a combination of siCMTM4 and anti-PD-1 monoclonal antibodies, thereby modulating the immune microenvironment and enhancing the anti-tumor immune response.
Blocking CMTM4 can significantly reduce the accumulation and activation of MDSCs, enhance anti-tumor immunity, improve the sensitivity of cervical cancer to immunotherapy, and may enhance the efficacy of PD-1 blockade treatment.
Smart Images

Figure CN120099177A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of medical biotechnology, and in particular to a drug for treating cervical cancer and a composition and a diagnostic kit thereof. Background Art
[0002] Cervical cancer is the most common malignant tumor of the female reproductive system. Recently, the National Cancer Center of China released the data on the burden of cancer in China in 2022, which clearly stated that cervical cancer is still the fourth most common new cancer in women, with about 150,700 new cases and about 55,700 deaths each year. The report also pointed out that the age-standardized incidence rate of cervical cancer is still increasing at an average annual rate of 7.3%, and the age-standardized mortality rate is increasing at an average annual rate of 5.1%. At present, the standard treatments for cervical cancer mainly include surgical resection and / or chemoradiotherapy, however, they have significant side effects. In addition, metastatic and recurrent cervical cancer is difficult to achieve a complete cure and is also a major risk factor for patient death. Immunotherapy provides new hope for patients with metastatic and recurrent cervical cancer, aiming to attack tumors by activating the patient's own immune system. However, as cervical cancer progresses, the tumor load in the patient's body increases, which strengthens the immunosuppressive signal and inhibits the body's immune response, resulting in patients being insensitive to immunotherapy. Therefore, it is necessary to strengthen the basic research on the immunosuppressive microenvironment in cervical cancer and clarify the formation mechanism of the immunosuppressive state, which will not only help improve the efficacy of immunotherapy for cervical cancer patients, but also have important scientific significance for improving the prognosis of cervical cancer patients.
[0003] 2. Research progress of chemokine-like factor superfamily in tumors
[0004] The CMTM family is a family of transmembrane proteins related to immune regulation and cancer. The family includes 9 members, namely chemokine-like factors (CKLF) and CMTM1-8, which have similar structural characteristics and functions. The common feature of CMTM family members is the MARVEL (MAL and related proteins for vesicle trafficking and membrane link) domain, which consists of four transmembrane regions and two extracellular regions. This structure enables CMTM family proteins to be located on the cell membrane and participate in a variety of cell signal transduction and regulation processes.
[0005] CMTM family molecules play an important regulatory role in the occurrence and development of tumors, affecting tumor growth, invasion and metastasis through various mechanisms. CMTM1 affects the invasive ability of tumor cells by regulating the expression and activity of MMPs. In addition, they can also affect the occurrence of epithelial-mesenchymal transition (EMT), regulate the expression of cell adhesion molecules (such as E-cadherin and N-cadherin), and thus affect the metastatic ability of tumor cells. CMTM3 and CMTM7 are considered to be tumor suppressor genes. They inhibit the proliferation of tumor cells by regulating the cell cycle and inhibiting the activity of cell proliferation-related signaling pathways (such as Wnt / β-catenin, EGFR, IL-6 / STAT3, etc.). CMTM5 was found to be missing or downregulated in many tumors, and its expression level was negatively correlated with clinical pathological indicators such as tumor differentiation, tissue infiltration, and lymph node metastasis, indicating that it may also have a tumor suppressor effect.
[0006] CMTM4 is a member of the chemokine-like factor superfamily. Its gene sequence is highly conserved and it has three RNA spliceosomes. Spliceosomes v1 and v2 are widely expressed in the cell membrane and cytoplasm of various tissue cells. Previous studies have shown that most members of the chemokine-like factor superfamily belong to tumor suppressor genes. Some literature reports that CMTM3 can inhibit the proliferation and invasion of liver cancer cells through the JAK2 / STAT3 signaling pathway; CMTM7 inhibits tumor growth through G1 / S cell cycle arrest and EGFR / AKT signaling pathway; CMTM4 expression is downregulated in liver cancer and renal clear cell carcinoma, but some studies have reported that only CMTM3 expression is downregulated in various tumor cell lines and primary tumors, but not CMTM4; and our study also found that compared with normal cervical tissue, CMTM4 expression is significantly increased in cervical precancerous lesions and cervical cancer tissues. Therefore, the relationship between CMTM4 and tumors is still worth further exploration.
[0007] 3. The role of myeloid-derived suppressor cells in tumor development
[0008] The accumulation of immunosuppressive cell populations in the TME confers immunosuppressive characteristics, resulting in poor immunotherapy effects in cancer patients. Myeloid-derived suppressor cells (MDSCs) constitute a heterogeneous population of bone marrow progenitor cells accumulated in the TME, playing a powerful mediating role in suppressing T cell function and promoting immune escape. Many studies have shown that MDSCs aggregate in the peripheral blood and tumor tissues of patients with various tumors, suggesting that this group of cells may play an important role in the immune escape mechanism of cervical cancer. The molecular mechanism by which tumor cells regulate MDSCs to achieve immune escape is very complex. At present, there are few reports on the mechanism of action of cervical cancer regulating MDSCs at home and abroad.
[0009] In healthy individuals, immature myeloid cells (IMCs) produced in the bone marrow migrate to different peripheral organs and differentiate into mature granulocytes, macrophages or dendritic cells. However, in pathological conditions such as cancer, various infectious diseases, sepsis, trauma, bone marrow transplantation or certain autoimmune diseases, the barrier of IMCs differentiation into mature myeloid cells leads to the expansion of this cell population. Under pathological conditions, these cells are activated and produce immunosuppressive enzymes and a variety of soluble inhibitory factors. In order to study the nature and clinical significance of this group of cells, this group of cells was defined in a 2007 article as myeloid-derived suppressor cells (MDSCs). This group of cells plays an important role in immune escape. MDSCs can also differentiate into tumor-associated macrophages (TAMs) in the tumor environment. These macrophages are cells with phenotypes and functions different from MDSCs.
[0010] It is worth noting that due to the biochemical and functional heterogeneity of the MDSCs population, different MDSCs subtypes have been isolated from different types of cancer. The combination of molecular markers used to identify the MDSCs population may vary depending on the disease background. Therefore, MDSCs lack specific cell markers expressed on the surface of monocytes, macrophages, dendritic cells, etc., and belong to a group of mixed myeloid cells. In mice, MDSCs are defined as cells that co-express myeloid differentiation antigens Gr-1 and CD11b. According to the expression of Ly6C and Ly6G, they can be subdivided into two subtypes with monocyte or neutrophil morphology. In humans, due to the lack of specific markers, the phenotype of human MDSCs has not been fully clarified. It is usually defined by a combination of various surface molecules (CD14, CD15, CD34, CD11b, CD33, Lin and HLA-DR, etc.), so different MDSCs phenotypes are obtained in different cancer patients. In addition to the phenotype, the ability to inhibit T cells is also included in the criteria for identifying MDSCs cells.
[0011] Previous studies have shown that MDSCs can inhibit the body's acquired and natural anti-tumor immunity through various pathways, allowing tumor cells to escape the body's immune surveillance and attack, and promoting tumor development. These include the production of soluble inhibitory factors such as ARG-1, iNOS, ROS, etc., activating and amplifying Tregs, and some of these mechanisms have been confirmed in cancer patients. Studies have reported that in patients with non-small cell lung cancer, MDSCs can produce ARG-1 and iNOS to inhibit CD8 + T cell activation; MDSCs in patients with various malignant tumors can promote a significant increase in the proportion of Tregs, and are negatively correlated with the degree of tumor progression and prognosis of patients, which is one of the important reasons why tumor immune escape and anti-tumor immunotherapy are difficult to succeed.
[0012] The exercise of MDSCs' functions requires two stages: the first stage is the expansion and aggregation of MDSCs, and the second stage is the activation of MDSCs to form cells with immunosuppressive functions under the continuous action of tumor factors.
[0013] The expansion and aggregation of MDSCs are mainly regulated by a variety of chemokines, inflammatory factors and other cytokines secreted by tumor cells and tumor stromal cells. The expansion of MDSCs may be mediated by factors that regulate normal bone marrow production, such as granulocyte-macrophage colony-stimulating factor (GM-CSF), granulocyte colony-stimulating factor (G-CSF) and macrophage colony-stimulating factor (M-CSF). Therefore, the in vitro differentiation of mouse IMCs into immunosuppressive MDSCs can be achieved by stimulation with GM-CSF and interleukin (IL)-6. IL-6 has been shown to promote the accumulation and immunosuppressive ability of MDSCs, mainly due to the activation of the signal transducer and transcription activator STAT3 signaling pathway, although the underlying molecular mechanism is not yet fully understood. Studies have reported that ascites-derived IL-6 and IL-10 can amplify CD14 in ovarian cancer patients. + HLA-DR - / low MDSCs; and in the metastasis of colorectal cancer, CXCL1 can recruit CXCR2 + MDSCs promote the formation of pre-metastatic foci; in anti-tumor therapy that blocks CSF1R, tumor-associated fibroblasts can recruit PMN-MDSCs, thereby weakening the therapeutic effect. In a breast cancer mouse model, CXCL1, CXCL2, CXCL5, and S100A8 / 9 promote the formation of lung metastases by recruiting MDSCs. Cancer cells secrete different chemokines to recruit MDSCs, which is common in different types of cancer. MDSCs are attracted to the tumor site by a variety of different cytokines (CCL2, CCL5, and CSF1 for M-MDSCs; CXCL1, CXCL5, CXCL6, CXCL8, and CXCL12 for PMN-MDSCs).
[0014] The activation and survival of MDSCs are regulated by the signal transducers and activators of transcription (STAT) family, such as STAT1, STAT3, STAT6, and NF-kB. Cancer cells, tumor-associated stromal cells, and activated T cells play a role in the signaling pathways that activate MDSCs by inducing the expression of TLR4, IL-1β, TGFβ, IFNγ, and IL-4. The transcription factor STAT3 is considered to be one of the main drivers of MDSC expansion and cooperates with other factors such as GM-CSF, M-CSF, and VEGF to promote the expression of MDSCs in tumors.
[0015] The relationship between CMTM4 and cervical cancer has not yet been clarified. It is urgent to further clarify the molecular mechanism of the occurrence and development of cervical cancer and actively screen for possible new specific molecular targets for the treatment of cervical cancer, which is of great scientific significance for improving the cure rate of cervical cancer and reducing the mortality rate. Summary of the invention
[0016] The purpose of the present invention is to address the deficiencies in the prior art and to provide a cervical cancer diagnosis kit and an inhibitor of CMTM4 for use in the preparation of a drug for treating cervical cancer.
[0017] In a first aspect, the present invention provides the use of CMTM4 as a biomarker in the preparation of a cervical cancer diagnosis kit.
[0018] In a second aspect, the present invention provides the use of a reagent for detecting the content of CMTM4 protein in the preparation of a cervical cancer diagnosis kit.
[0019] In a third aspect, the present invention provides the use of a CMTM4 inhibitor in the preparation of a drug for treating cervical cancer.
[0020] As a preferred example, the CMTM4 inhibitor is siCMTM4, and the siCMTM4 has the sequence shown in SEQ ID NO.27 and SEQ ID NO.28.
[0021] In a fourth aspect, the present invention provides a pharmaceutical composition for treating cervical cancer, wherein the pharmaceutical composition is composed of siCMTM4 and anti-PD-1 monoclonal antibody, and the siCMTM4 has the sequence shown in SEQ ID NO.27 and SEQ ID NO.28.
[0022] As a preferred example, the mass ratio of the siCMTM4 and the anti-PD-1 monoclonal antibody is 1:1.
[0023] In a fifth aspect, the present invention provides use of the pharmaceutical composition in the preparation of drugs for treating cervical cancer.
[0024] The present invention has the advantages that:
[0025] 1. CMTM4 is significantly overexpressed in cervical cancer and is a prognostic indicator for cervical cancer patients. CMTM4 knockout significantly delayed the growth of TC1 intradermal tumors in immune-competent mice and mainly downregulated the accumulation of MDSCs.
[0026] 2. Luminex analysis revealed that CMTM4 mainly regulates the expression of chemokine CCL2 and recruits MDSCs through the CCL2 / CCR2 pathway. In addition, it regulates the expression of inflammatory factor IL-6 and promotes the differentiation of MDSCs through the IL-6 / GP130 axis. Pharmacological inhibition of CCL2 / CCR2 and IL-6 / GP130 axes alleviated tumor growth in tumor-bearing mice and reduced the abundance of MDSCs.
[0027] 3. Mechanistically, CMTM4 interacts with PHB2 to activate the STING / TBK1 / STAT6 pathway, promotes the nuclear translocation of STAT6, and STAT6 binds to the CCL2 / IL-6 promoter, leading to the upregulation of CCL2 / IL-6 transcriptional expression.
[0028] 4. Treatment with siCMTM4 or anti-PD1 alone can inhibit tumor growth in cervical cancer-bearing mice. Compared with single-drug treatment, the combination of siCMTM4 and anti-PD1 treatment has the strongest anti-tumor effect on cervical cancer-bearing mice, suggesting that blocking CMTM4 may synergize with anti-PD-1 therapy. Therefore, CMTM4 is expected to become a candidate molecule for the development of new treatment strategies for cervical cancer.
[0029] The present invention uses clinical specimens of cervical cancer and various mouse cervical cancer models to propose a new molecular mechanism of cervical cancer regulating MDSCs: cervical cancer promotes its own expression and releases key tumor-related cytokines through CMTM4, amplifies and recruits MDSCs to the tumor microenvironment and activates them, inhibits effector lymphocytes in the microenvironment, and thus achieves immune escape. The role and mechanism of CMTM4 in the process of cervical cancer regulating MDSCs to escape immune from both in vivo and in vitro aspects is explored, providing a more sufficient scientific basis for establishing new targets for cervical cancer treatment, and has important scientific significance for the development of new methods for cervical cancer diagnosis, prognosis and targeted treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1CMTM4 is involved in the occurrence and development of cervical cancer. A. Detection of CMTM4 expression in human cervical tissue array. ×10 scale bar, 200μm; ×40 scale bar, 50μm. B. Statistical graph of the positive ratio of CMTM4 in normal cervical epithelial cells (n=16), CIN (n=34), CSC (n=32), CAC (n=41) and CASC (n=40). C. Statistical graph of the positive ratio of CMTM4 in paracancerous tissue and tumor tissue. D. Western Blot detection of CMTM4 expression in cervical cancer tissue and paracancerous tissue. P=paracancerous tissue, T=tumor tissue. E. IHC detection of CMTM4 expression in CINⅠ-Ⅲ tissues. ×10 scale bar, 200μm; ×40 scale bar, 50μm. F. Statistical graph of the positive ratio of CMTM4 in CINⅠ (n=13), Ⅱ (n=10) and Ⅲ (n=11). G. IHC detection of CMTM4 expression in CSC stage I-III tissues. ×10 scale bar, 200μm; ×40 scale bar, 50μm. H. Statistical graph of CMTM4 positive proportion in CSC stage I (n=3), stage II (n=18), and stage III (n=25). I. GEPIA website analysis of disease progression-free survival curves of cervical cancer patients with high or low expression of CMTM4. * P < 0.05; ** P < 0.01; *** P<0.001
[0031] Figure 2 CMTM4 promotes the proliferation of cervical cancer. AC.EDU assay detects the proliferation ability of HeLa, SiHa and TC1 after CMTM4 knockout. DF.CCK8 assay detects the proliferation ability of HeLa, SiHa and TC1 after CMTM4 knockout. ***P<0.001; ****P<0.0001
[0032] Figure 3 CMTM4 promotes the occurrence and development of cervical cancer by regulating the immune microenvironment. A. Tissue images of subcutaneous tumors in immunocompetent C57 / BL6 mice constructed using TC1-C4WT and TC1-C4KO cells (n=6). B. Difference in subcutaneous tumor weights in immunocompetent tumor-bearing mice between TC1-C4WT and TC1-C4KO groups. C. Difference in subcutaneous tumor growth in immunocompetent tumor-bearing mice between TC1-C4WT and TC1-C4KO groups. D. Tissue images of subcutaneous tumors in immunodeficient BALB / c mice constructed using TC1-C4WT and TC1-C4KO cells (n=6). E. Difference in subcutaneous tumor weights in immunodeficient tumor-bearing mice between TC1-C4WT and TC1-C4KO groups. F. Difference in subcutaneous tumor growth in immunodeficient tumor-bearing mice between TC1-C4WT and TC1-C4KO groups. *P<0.05; ***P<0.001 Figure 4CMTM4 regulates the expression of MDSCs in the immune microenvironment of cervical cancer. AB. Heatmaps showing the composition of immune cells in the spleen (A) and tumor (B) of tumor-bearing mice. C. Flow cytometry analysis of the expression of MDSCs in the spleen and tumor sites of TC1-C4WT and TC1-C4KO tumor-bearing mice. D. Flow cytometry analysis of the expression of G-MDSCs (right frame area) and M-MDSCs (left frame area) in the spleen and tumor sites of TC1-C4WT and TC1-C4KO tumor-bearing mice. *P<0.05; **P<0.01; ***P<0.001
[0033] Figure 5 Luminex analysis of CMTM4 regulatory factor secretion. A. Luminex-MultiDTX-43-human was used to detect the expression differences of 43 cytokines secreted by HeLa-C4WT and HeLa-C4KO. The heat map shows the expression of cytokines with concentrations greater than 100pg / ml. B. qRT-PCR was used to detect the mRNA expression of IL-6, CCL2 and VEGF in CMTM4 KO HeLa and CMTM4 KO SiHa or controls.
[0034] **P<0.01; ***P<0.001; ****P<0.0001
[0035] Figure 6CMTM4 recruits activated MDSCs through the CCL2 / CCR2 axis and the IL-6-GP130 axis. A. Cell culture supernatants collected from different groups were placed in the lower chamber. Freshly isolated PBMCs-MDSCs were inoculated in the upper chamber, and the number of cells in the lower chamber was counted after 24 hours (n=3). BC. In the CMTM4-NC HeLa (B) or CMTM4-NC-TC1 group (C), MDSCs were inoculated in the upper transwell chamber with 100 μL RPMI medium containing or without CCR2 inhibitor (RS504393, 10 mM). The lower chamber contained 600 μL of cell culture supernatant derived from CMTM4-KO HeLa (B) or CMTM4-KO TC1 (C), with or without recombinant CCL2 protein (1 ng / mL). After 24 hours, the cells in the lower chamber were counted (n=3). D. Flow cytometric analysis of CCR2 expression on MDSC in patients with benign tumors (n=6) and cervical cancer (n=5). CCR2 expression is described by percentage and mean fluorescence intensity (MFI). E. Flow cytometric analysis of CCR2 expression on MDSC derived from tumor-bearing mice in the spleen. CCR2 expression is described by percentage and mean fluorescence intensity (MFI) (n=6). F. TC1 CMTM4 KO cells or control cells were injected intradermally and treated with INCB3344 (10 mg / kg body weight) or DMSO every day after inoculation. G. Flow cytometric analysis of GP130 expression on cord blood mononuclear cells treated with different concentrations of IL-6 recombinant factor. GP130 expression is described by percentage and mean fluorescence intensity (MFI) (n=3). H. Cell culture supernatants collected from CMTM4NC HeLa with or without GP130 inhibitor (LMT28, 10 mM) and CMTM4 KO-HeLa with or without recombinant IL-6 protein (40 ng / mL) were co-cultured with umbilical cord blood mononuclear cells for 24 hours. Each group was treated with GM-CSF (40 ng / mL), and the proportion of MDSCs was detected by flow cytometry. Data are expressed as mean ± SEM (n = 3). I. Mice were intradermally injected with TC1 CMTM4 KO cells or control cells and treated with LMT-28 (10 mg / kg body weight) or DMSO every day after tumor inoculation (n = 4). *P < 0.05, **P < 0.01, ***P < 0.001, NS, no significant difference.
[0036] Figure 7CMTM4 activates STING / TBK1 / STAT6 and regulates CCL2 / IL-6 expression through PHB2. A. Immunoblotting analysis of the expression of CMTM4, p-STING, STING, p-STAT6, STAT6, p-TBK1, and TBK1 in HeLa cells after CMTM4 knockdown (n=3). B. Immunoblotting analysis of the expression of p-STING, STING, p-STAT6, STAT6, p-TBK1, and TBK1 in HeLa cells after PHB2 knockdown (n=3). C. Immunoblotting analysis of p-STING, STING, p-STAT6, STAT6, p-TBK1, and TBK1 in CMTM4-KO HeLa with or without PHB2 overexpression (n=3). D. Immunoblotting analysis of p-STING, STING, p-STAT6, STAT6, p-TBK1, and TBK1 in CMTM4-OEHeLa with or without PHB2 knockdown. β-actin was used as a control (n=3). E. Immunoblot analysis of the expression of p-STING, STING, p-STAT6, STAT6, p-TBK1, and TBK1 in HeLa cells treated with or without H-151 (n=3). F. Immunoblot analysis of p-STING, STING, p-STAT6, STAT6, p-TBK1, and TBK1 in CMTM4-OE HeLa treated with or without H-151 (n=3). GH. mRNA expression and protein expression of CCL2 (G) or IL-6 (H) in CMTM4-OE HeLa with or without PHB2 knockout (n=3). I. Immunoblot analysis of STAT6 levels in the nucleus and cytoplasm of CMTM4 NC HeLa and CMTM4 KO HeLa cells (n=3). J. Immunohistochemical staining of benign controls and cervical cancer. A specific antibody against STAT6 was used. Scale bar for ×20 images; 50 μm; scale bar for ×63 images, 20 μm. K. Immunofluorescence analysis of the subcellular distribution of endogenous STAT6 in CMTM4 NC HeLa and CMTM4 KO HeLa cells (n=3). L. Prediction of potential binding sites of STAT6 to CCL2 (upper) or IL-6 (lower) promoters using the hTFtarget website. M. ChIP analysis of STAT6 binding to CCL2 (upper) or IL-6 (lower) promoters via the CMTM4 / PHB2 pathway (n=3)
[0037] **P<0.01, ***P<0.001.
[0038] Figure 8Analysis of the correlation between CMTM4, CCL2 and IL-6 and MDSCs expression in clinical specimens. A. Flow cytometry detection of PMN-MDSC (right frame area) and M-MDSC (left frame area) in the peripheral blood of patients with benign tumors (n=21) and cervical cancer (n=18). B. Flow cytometry detection of Treg expression in the peripheral blood of patients with benign tumors (n=21) and cervical cancer (n=18). C. Flow cytometry detection of CD8+IFNγ+T cells in the peripheral blood of patients with benign tumors (n=21) and cervical cancer (n=18). D. Statistical graph of PMN-MDSC, M-MDSC, Treg cells, and CD8+IFNγ+T cells. E. Correlation analysis between PMN-MDSC or M-MDSCs expression and Treg expression in clinical specimens. F. Correlation analysis between PMN-MDSC or M-MDSC expression and CD8+IFNγ+T cell expression in clinical specimens. G. ELISA analysis of the expression of CCL2 in the serum of patients with benign tumors (n=17) and cervical cancer (n=11). H. ELISA analysis of the expression of IL-6 in the serum of patients with benign tumors (n=10) and cervical cancer (n=18). I. Correlation analysis between the expression of PMN-MDSC or M-MDSC and the expression of CCL2 in clinical specimens. J. Correlation analysis between the expression of PMN-MDSC or M-MDSC and the expression of IL-6 in clinical specimens. KL. GEPIA website analysis of the overall survival curve of patients with cervical cancer with high or low expression of CCL2 (K) or IL-6 (L). M. qRT-PCR analysis of the correlation between the expression of S100A8 or INOS and the expression of CMTM4 in clinical specimens. *P<0.05; **P<0.01
[0039] Fig. 9 Targeting CMTM4 can improve the efficacy of PD-1 blockade in the treatment of cervical cancerA. Schematic diagram of the treatment model: tumor growth in TC1 tumor-bearing mice treated with CMTM4 siRNA, anti-PD-1 monoclonal antibody (mAb), or anti-PD-1 mAb combined with CMTM4 siRNA (n=5 / group). B. Images of TC1 allografts. CD. Statistical analysis of tumor growth (C) and weight (D). EF. Flow cytometric analysis of the expression of CD11b+LY6GHighLY6CLow G-MDSCs and CD11b+LY6GLowLY6CHigh M-MDSCs in spleens and tumors of tumor-bearing mice. G. Flow cytometric analysis of the expression of CD4+CD25+FOXP3+Tregs in spleens and tumors isolated from tumor-bearing mice. H. Flow cytometric analysis of IFNγ+CD8+T cell infiltration in spleens and tumors. I. Schematic diagram of CMTM4 in promoting the development of cervical cancer. *P<0.05, **P<0.01 ***P<0.001, ****P<0.0001, NS=not significant. DETAILED DESCRIPTION
[0040] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.
[0041] It should be noted that, due to formatting issues, the XML file submitted for the sequence listing involved in the examples needs to replace all "U" in SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28 with "T". The specific details shall be subject to those shown in the examples.
[0042] Example 1
[0043] Experimental Materials and Methods
[0044] 1. Quantitative real-time polymerase reaction (qRT-PCR) was used to detect the expression of CMTM3-8 in the CMTM family in cervical cancer cell lines. Western blot was used to evaluate the expression of CMTM4 in normal cervical cell line ECT and various cervical cancer cell lines. Clinical specimens were collected for qRT-PCR analysis and immunohistochemistry (IHC) analysis of CMTM4 expression in benign control groups, paracancerous tissues, and cervical cancer tissues. Kaplan-Meier analysis was used to analyze the correlation between CMTM4 expression and the disease-free survival curve of cervical cancer patients. Materials and methods:
[0045] Primer sequences involved in the experiment:
[0046]
[0047] 2. CRISPR-Cas9 technology was used to knock out CMTM4 in HeLa, SiHa and TC1. In vitro functional experiments were performed to evaluate the role of CMTM4 in regulating the proliferation and migration of cervical cancer cells. Cervical cancer models of C57 / BL6 immune-competent mice and BALB / c immune-deficient mice were constructed using TC1-WT and TC1-C4KO cell lines, and the growth rate and size of subcutaneous tumors were observed. Flow cytometry was used to evaluate the expression of immune cells in tumors and spleens of immunocompetent TC1-WT and TC1-C4KO tumor-bearing mice.
[0048] Materials and Methods
[0049]
[0050] 3. Gene set enrichment analysis (GSEA) was used to reveal the biological regulatory pathways involved in CMTM4. Conditioned medium (CM) from HeLa-C4WT and HeLa-C4KO cells was collected and in vitro functional experiments were performed. On the one hand, the Transwell experiment was used to verify the changes in the ability of the two groups of CM to recruit MDSCs. On the other hand, umbilical cord blood mononuclear cells (CB-MNCs) were collected and co-cultured with CM, and flow cytometry was used to analyze the changes in the ability of the two groups of CM to induce monocytes to differentiate into MDSCs. Luminex-MultiDTX-43-Human was used to detect changes in inflammatory and chemokines in HeLa-C4WT and HeLa-C4KO CM, and qRT-PCR and enzyme-linked immunosorbent assay (ELISA) were performed for verification. The correlation between CMTM4 and IL-6 or CCL2 expression was further explored in clinical specimens.
[0051] 4. Flow cytometric analysis of CCR2 expression on MDSCs of human and mouse origin. The role of the CMTM4-CCL2-CCR2 axis in chemotaxis of MDSCs was evaluated by in vitro MDSCs migration assay. This was further clarified by an in vivo CCR2 blockade treatment model. Flow cytometry was used to evaluate the expression of GP130 on CB-MNCs treated with recombinant IL-6. The role of the CMTM4-IL-6-GP130 axis in promoting MDSCs differentiation was evaluated by an in vitro MDSCs differentiation assay and further clarified by an in vivo GP130 blockade treatment model.
[0052] Materials and Methods
[0053] 1. INCB3344 (Catalog No. HY-50674, MCE)
[0054] INCB3344 is a potent CCR2 antagonist with IC50 of 5.1 nM (hCCR2) and 9.5 nM (mCCR2) for antagonizing binding activity and 3.8 nM (hCCR2) and 7.8 nM (mCCR2) for antagonizing chemotaxis activity.
[0055] 2. LMT-28 (Catalog No. HY-102084, MCE)
[0056] LMT-28 is an orally active IL-6 inhibitor that directly binds to gp130. LMT-28 has low toxicity and selectively inhibits IL-6-induced phosphorylation of STAT3, JAK2, and gp130.
[0057] 3. Anti-PD1 monoclonal antibody (Catalog No. S0B0594, STARTER) or IgG isotype control (Catalog No. S0B0788, STARTER)
[0058] Anti-PD1 monoclonal antibody is a recombinant monoclonal antibody that blocks PD-1 / PD-L signaling in vivo
[0059] 4. Si-CMTM4 (GenePharma Co., Ltd. Shanghai, China) or negative control (GenePharma Co., Ltd. Shanghai, China).
[0060] CMTM4 knockout or control TC1 cells were subcutaneously injected into the dorsal flank of each 6-week-old female immunocompetent C57BL / 6 mouse. After tumor inoculation in C57BL / 6 mice, INCB3344 (Catalog No. HY-50674, MCE) (10 mg / kg body weight), LMT-28 (Catalog No. HY-102084, MCE) (10 mg / kg body weight) or DMSO was administered daily by intraperitoneal injection. Tumor size was measured every 3 days. Twenty days after tumor implantation, mice were sacrificed to evaluate tumor development. All animal studies have been approved by the Animal Experiment Ethics Committee of Tongji University.
[0061] 5.Western Blot detected that CMTM4 activated the STING / TBK1 / STAT6 pathway through PHB2, and observed changes in the transcription and protein levels of CCL2 and IL-6 by blocking this pathway in HeLa-C4OE cells. The nuclear translocation of STAT6 in HeLa-C4WT and HeLa-C4KO was detected by Western Blot and immunofluorescence. In addition, the distribution of STAT6 in tumor tissue samples from patients with cervical cancer and chronic cervicitis was analyzed by IHC. The hTFtarget website was used to predict the potential binding sites of STAT6 to the CCL2 / IL-6 promoter, and chromatin immunoprecipitation (ChIP) analysis was performed in HeLa cells. The role of CMTM4 in promoting the binding of STAT6 to the CCL2 / IL-6 promoter through PHB2 was further verified by rescue experiments. Materials and methods:
[0062] Oligonucleotides sequences used in the experiment:
[0063]
[0064]
[0065] 6. Flow cytometry was used to evaluate the abundance of PMN-MDSC, M-MDSC, T cells, and Treg cells in clinical peripheral blood samples. ELISA was used to detect the expression of CCL2 and IL-6 in the peripheral serum of clinical samples, and the correlation between the expression of PMN-MDSC and M-MDSC and the expression of CD8+IFN-γ+T cells, Treg cells, CCL2 or IL-6 was analyzed. Kaplan-Meier analysis was performed to analyze the correlation between CCL2 / IL6 expression and the overall survival rate of patients. qRT-PCR was used to analyze the correlation between the expression of CMTM4 and MDSCs-related immunosuppressive markers in clinical samples.
[0066] 7. We constructed an in vivo small interfering RNA (siCMTM4) targeting CMTM4. The results showed that both siCMTM4 and anti-PD1 treatment alone inhibited the growth of TC1 allografts compared with the control group. The combination of siCMTM4 and anti-PD1 treatment had the strongest antitumor effect on TC1 allografts compared with monotherapy. In addition, the combination treatment significantly enhanced antitumor immunity, characterized by a significant reduction in G-MDSCs. In addition, Tregs were significantly reduced in the combination treatment group compared with the control group and the monotherapy group. In contrast, a significantly increased level of activated T cell infiltration was found in TC1 allografts in the combination treatment group. These findings suggest that blocking CMTM4 may synergize with anti-PD-1 therapy, suggesting that CMTM4 is a potential therapeutic target for cervical cancer, and its inhibition can restore antitumor immunity and may enhance the efficacy of ICB therapy.
[0067] Materials and methods: TC1 cells were injected subcutaneously into the back of 6-week-old female C57BL / 6 mice. Starting from day 7, anti-PD1 monoclonal antibody (Catalog No. SOB0594, STARTER) or IgG isotype control (Catalog No. S0B0788, STARTER) was injected intraperitoneally (100 μg / injection every 3 days). Si-CMTM4 (GenePharma Co., Ltd. Shanghai, China) or negative control (GenePhama Co., Ltd. Shanghai) was administered by intertumoral injection (50 μg / tumor every 3 days). Tumors were measured every other day and weighed at harvest.
[0068] siCmtm4-Mus positive strand 5'-3':GCAUUUAUCUGCAUCGAGA ( SEQ ID NO.27 ) Reverse strand 5'-3':AGUCUCGAUGCAGAUAAAUGC ( SEQ ID NO.28 )
[0069] Experimental results:
[0070] 1. Compared with the normal control group, CMTM4 in cervical cancer increased significantly with the progression of the disease ( Figure 1 AH), the presence of which is associated with adverse patient outcomes ( Figure 1 I).
[0071] 2. CMTM4 knockout inhibits the proliferation and migration of cervical cancer cells in vitro ( Figure 2AF) and severely impaired the growth of TC1 allografts in immunocompetent mice. Compared with immunocompetent tumor-bearing mice, CMTM4 knockout did not significantly inhibit tumor growth in immunodeficient tumor-bearing mice ( Figure 3 AF). Further flow cytometric analysis of the composition and expression of the immune microenvironment in immune-competent tumor-bearing mice showed that the number of MDSCs, G-MDSCs, and M-MDSCs in TC1-C4KO tumor-bearing mice was significantly reduced, and the anti-tumor immune ability was enhanced ( Figure 4 AD).
[0072] 3. Luminex-MultiDTX-43-Human assay showed that inhibition of CMTM4 resulted in decreased levels of CCL2 and IL-6 in target cells ( Figure 5 A). There was a significant positive correlation between the expression of CMTM4 and IL-6 or CCL2 in clinical specimens ( Figure 5 BC). Flow cytometry results showed that CCR2 was significantly highly expressed in MDSCs derived from cervical cancer or MDSCs derived from C4WT tumor-bearing mice. In vitro MDSCs migration experiments and in vivo pharmacological blocking experiments suggested that CMTM4 recruited MDSCs through the CCL2 / CCR2 axis. In addition, flow cytometry results showed that GP130 expression on the surface of CB-MNC was upregulated in an IL-6 dose-dependent manner. In vitro MDSCs differentiation experiments and in vivo pharmacological blocking experiments suggested that CMTM4 promoted MDSCs differentiation through the IL-6 / GP130 axis ( Figure 6 AI).
[0073] 4. Further studies have shown that CMTM4 promotes the expression of CCL2 and IL-6 by targeting PHB2. Western Blot results suggest that cervical cancer cells activate the STING / TBK1 / STAT6 pathway by targeting PHB2 through CMTM4. Further experimental results show that CMTM4 promotes the nuclear translocation of STAT6 ( Figure 7 AK). CHIP experiments found that CMTM4 knockout significantly reduced the binding activity of STAT6 to CCL2 and IL-6 promoters. Based on this, overexpression of PHB2 can reverse this phenomenon ( Figure 7 LM).
[0074] 5. Compared with the benign control group, the proportion of PMN-MDSC, M-MDSC, Treg cells and the expression of CCL2 / IL-6 in the cervical cancer group were significantly upregulated, while the proportion of CD8+IFN-γ+T cells was downregulated. In addition, the expression of PMN-MDSC and M-MDSC was significantly negatively correlated with the expression of CD8+IFN-γ+T cells and positively correlated with the expression of CCL2 / IL-6. Kaplan-Meier analysis showed that patients with high expression of CCL2 / IL6 were significantly correlated with overall survival. The expression of CMTM4 was positively correlated with immunosuppressive markers associated with MDSCs in clinical samples ( Figure 8 AM).
[0075] 6. Previous studies have shown that CMTM4 may promote cancer progression through immune-dependent mechanisms. Therefore, we hypothesized that targeting CMTM4 may affect the response of cervical cancer to immunotherapy. To investigate this, we constructed an in vivo small interfering RNA targeting CMTM4 (siCMTM4). The results showed that siCMTM4 alone or anti-PD1 treatment inhibited the growth of TC1 allografts compared with the control group ( Fig. 9 AD). The combination of siCMTM4 and anti-PD1 treatment had the strongest antitumor effect on TC1 allografts compared with monotherapy ( Fig. 9 AD). In addition, the combination therapy significantly enhanced antitumor immunity, characterized by a significant reduction in G-MDSCs ( Fig. 9 EF). In addition, compared with the control group and the monotherapy group, the number of Tregs in the combination treatment group was significantly decreased ( Fig. 9 G). In contrast, significantly higher levels of activated T cell infiltration were found in TC1 allografts in the combination therapy group ( Fig. 9 H). These findings suggest that blocking CMTM4 may synergize with anti-PD-1 therapy, suggesting that CMTM4 is a potential therapeutic target for cervical cancer, and its inhibition may restore anti-tumor immunity and potentially enhance the efficacy of ICB therapy.
[0076] Experimental summary:
[0077] 1. CMTM4 is significantly overexpressed in cervical cancer and is a prognostic indicator for cervical cancer patients. CMTM4 knockout significantly delayed the growth of TC1 intradermal tumors in immune-competent mice and mainly downregulated the accumulation of MDSCs.
[0078] 2. Luminex analysis revealed that CMTM4 mainly regulates the expression of chemokine CCL2 and recruits MDSCs through the CCL2 / CCR2 pathway. In addition, it regulates the expression of inflammatory factor IL-6 and promotes the differentiation of MDSCs through the IL-6 / GP130 axis. Pharmacological inhibition of CCL2 / CCR2 and IL-6 / GP130 axes alleviated tumor growth in tumor-bearing mice and reduced the abundance of MDSCs.
[0079] 3. Mechanistically, CMTM4 interacts with PHB2 to activate the STING / TBK1 / STAT6 pathway, promotes the nuclear translocation of STAT6, and STAT6 binds to the CCL2 / IL-6 promoter, leading to the upregulation of CCL2 / IL-6 transcriptional expression.
[0080] 4. Treatment with siCMTM4 or anti-PD1 alone can inhibit tumor growth in cervical cancer-bearing mice. Compared with single-drug treatment, the combination of siCMTM4 and anti-PD1 treatment has the strongest anti-tumor effect on cervical cancer-bearing mice, suggesting that blocking CMTM4 may synergize with anti-PD-1 therapy. Therefore, CMTM4 is expected to become a candidate molecule for the development of new treatment strategies for cervical cancer.
[0081] In this study, we aimed to use cervical cancer clinical specimens and various mouse cervical cancer models to propose a new molecular mechanism for cervical cancer to regulate MDSCs: cervical cancer promotes its own expression and release of key tumor-related cytokines through CMTM4, amplifies and recruits MDSCs to the tumor microenvironment and activates them, inhibits effector lymphocytes in the microenvironment, and thus achieves immune escape. The role and mechanism of CMTM4 in the process of cervical cancer regulating MDSCs to escape immune from both in vivo and in vitro aspects were explored to provide a more sufficient scientific basis for establishing new targets for cervical cancer treatment, which has important scientific significance for the development of new methods for cervical cancer prediction, diagnosis, prognosis and targeted treatment. Therefore, by revealing the key role of CMTM4 in cervical cancer, the present invention proposes a possible combined treatment idea for immunotherapy, which has important scientific significance and clinical application value.
[0082] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention. These improvements and supplements should also be regarded as the scope of protection of the present invention.
Claims
1. Application of CMTM4 as a biomarker in the preparation of cervical cancer diagnostic kit.
2. Application of reagents for detecting CMTM4 protein content in the preparation of cervical cancer diagnostic kits.
3. Application of CMTM4 inhibitors in the preparation of drugs for the treatment of cervical cancer.
4. The application according to claim 3, characterized in that: The CMTM4 inhibitor is siCMTM4, and the siCMTM4 has the sequence shown in SEQ ID NO.27 and SEQ ID NO.
28.
5. A pharmaceutical composition for treating cervical cancer, characterized in that: The pharmaceutical composition consists of siCMTM4 and anti-PD-1 monoclonal antibody, and the siCMTM4 has the sequence shown in SEQ ID NO.27 and SEQ ID NO.
28.
6. The pharmaceutical composition according to claim 5, characterized in that The mass ratio of the siCMTM4 and the anti-PD-1 monoclonal antibody is 1:
1.
7. Use of the pharmaceutical composition according to claim 5 or 6 in the preparation of drugs for treating cervical cancer.