Kit for detecting camel-derived components based on RAA-CRISPR / Cas12a method, detection method and application

Abstract

The invention relates to the technical field of molecular biological detection of food safety, and discloses a kit for detecting camel-derived components based on an RAA-CRISPR / Cas12a method, a detection method and application. The detection method comprises the following steps: performing RAA amplification on a detection source component; an amplification product is added into a CRISPR / Cas12a system for a reaction; the CRISPR / Cas12a reaction product is subjected to fluorescence observation, and if fluorescence appears, the result is positive. By using the crRNA provided by the invention, a detection result can be obtained within 1 hour under the specific concentration and proportion of Cas12a protein and crRNA and the concentration of the FQ-ssDNA probe. According to the method, the lowest detection limit can reach 1pg / mu L of DNA, the camel DNA can be successfully detected in the mixed meat product with the adulteration proportion of 1%, and an efficient tool is provided for detecting the authenticity of the meat product.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection of food safety, and more specifically, to a kit for detecting camel-derived components based on the RAA-CRISPR / Cas12a method, a detection method and an application thereof. Background Art

[0002] In recent years, the severity of food adulteration has continued to increase, especially in meat products, where the incorporation of non-identified ingredients has triggered widespread food safety and integrity crises. Although traditional identification methods such as PCR and ELISA have high sensitivity and specificity, they still have some shortcomings in practical applications, such as complex operations, long time consumption, and susceptibility to nonspecific amplification or antibody cross-reactions, which may lead to false positive results. In order to solve these problems, the CRISPR / Cas system, as an emerging gene editing tool, has shown great potential in the field of molecular diagnosis due to its highly specific target recognition ability and rapid response characteristics. In particular, the CRISPR / Cas12a system can accurately identify specific DNA sequences through crRNA, and the cleavage activity of Cas12a will only be activated when the target sequence is completely matched with crRNA. This mechanism greatly reduces the risk of misjudgment caused by non-target sequences, thereby improving the specificity of detection.

[0003] The trans-cleavage activity of the CRISPR system is its important feature. During the detection process, Cas12a will only cut the fluorescent probe and release the fluorescent signal after the target is recognized. This dual-specific recognition mechanism further reduces the occurrence of non-specific reactions. Combined with pre-amplification technologies such as RAA (recombinase-assisted amplification), the sensitivity and speed of detection can be further improved. RAA technology can efficiently amplify target DNA under low temperature conditions, which reduces the accumulation of non-specific products caused by over-amplification. Through this innovative combination of technologies, the combination of CRISPR / Cas12a and RAA provides a faster, more specific and more efficient detection method for the field of food safety.

[0004] Prior art CN202311396738.X discloses a detection method based on RAA technology, in which DNA is amplified by RAA technology, the amplification curve is monitored in a fluorescent PCR instrument, and the result is judged according to the amplification curve and the peak time. Although RAA technology is relatively simple, its processing of complex samples may still have the problem of nonspecific amplification, leading to misjudgment (false positive or false negative), especially when facing meat products containing multiple ingredients. This method relies on the amplification curve and peak time to determine whether it is positive or negative, which makes the detection process time-consuming, and for some low-content target components, the sensitivity and specificity may be insufficient. In addition, this method requires the use of a fluorescent PCR instrument to monitor the amplification curve, and requires precise control of the amplification process, which limits its application in on-site rapid detection without high-end experimental equipment.

[0005] Prior art 202311566235.2 proposed a method for combining RAA with CRISPR / Cas12a to detect black carp. However, fish meat is usually easier to extract high-purity DNA, so the RAA amplification system is more stable and Cas12a is less interfered with during detection. In addition, fish genomes are smaller and have fewer repetitive sequences, so Cas12a can more easily identify and cut them. At present, there are no reports on the detection method of rapid detection of camel meat based on RAA-CRISPR / Cas12a technology. Summary of the invention

[0006] The present invention is to overcome the defects of the prior art described above that PCR, ELISA and other detections are easily affected by non-specific amplification or antibody cross-reaction, thereby causing false positives, and provide a kit for detecting camel-derived components using the RAA-CRISPR / Cas12a method;

[0007] Another object of the present invention is to provide an application of a kit for detecting camel-derived components based on the RAA-CRISPR / Cas12a method;

[0008] Another object of the present invention is to provide a method for detecting camel-derived components.

[0009] In order to solve the above technical problems, the technical solution of the present invention is as follows:

[0010] A kit for detecting camel-derived components based on the RAA-CRISPR / Cas12a method, comprising reagents required for RAA, crRNA, Cas12a protein, fluorescent probe and buffer; the crRNA comprises crRNA1 or crRNA2, and the sequence of crRNA1 is SEQ ID No.1:

[0011] UAAUUUCUACUAAGUGUAGAUCCUUCCACUUCAUCCUGCCAU,

[0012] The sequence of crRNA2 is SEQ ID No.2:

[0013] UAAUUUCUACUAAGUGUAGAUUUAUCACGGCCCUAGUAGCCG.

[0014] Preferably, the crRNA is crRNA1.

[0015] Furthermore, the reagents required for RAA include buffer, magnesium acetate and

[0016] Upstream primer: 5′-TTCCACTTCATCCTGCCATTTATTATCACGG-3′;

[0017] Downstream primer: 5′-CAGTGCTCCTAGGATGTCTTTAATTGTGTAG-3′.

[0018] An application of the kit for detecting camel-derived components based on the RAA CRISPR / Cas12a method is used for rapid detection of camel-derived components in meat, milk and their products.

[0019] A method for detecting camel-derived components, using the kit for detecting camel-derived components based on the RAA-CRISPR / Cas12a method.

[0020] Furthermore, the following steps are included: first performing RAA amplification on the detection source component; adding the amplification product to the CRISPR / Cas12a system reaction; and performing fluorescence observation on the CRISPR / Cas12a reaction product.

[0021] Preferably, the result is positive if fluorescence is observed.

[0022] Preferably, fluorescence observation is performed in a dark box that can be excited by ultraviolet light.

[0023] Preferably, the results are visually observed using a gel imager, and the fluorescence intensity is detected using an enzyme-labeled instrument.

[0024] Preferably, the reaction product is added to a black 96-well plate containing 80 μL of double distilled water, and the fluorescence intensity is measured using an ELISA instrument. By comparing the fluorescence intensity results, it is determined whether the camel-derived component is contained.

[0025] Furthermore, in the CRISPR / Cas12a system, the concentration of Cas12a protein is greater than 0.05 μmol / L.

[0026] Preferably, the concentration of Cas12a protein is 0.15-0.35 μmol / L.

[0027] Preferably, the concentration of Cas12a protein is 0.25 μmol / L.

[0028] Furthermore, in the CRISPR / Cas12a system, the concentration of the fluorescent probe is greater than 0.4 μmol / L.

[0029] Preferably, the concentration of the fluorescent probe is 0.5-0.7 μmol / L.

[0030] Preferably, the concentration of the fluorescent probe is 0.50 μmol / L.

[0031] Preferably, the concentration of crRNA is 0.15-0.70 μmol / L.

[0032] Preferably, the concentration of crRNA is 0.50 μmol / L.

[0033] Furthermore, in the CRISPR / Cas12a system, the molar concentration ratio of crRNA to Cas12a is 1 to 2:1.

[0034] Furthermore, in the CRISPR / Cas12a system, the molar concentration ratio of the fluorescent probe to Cas12a is 1.3 to 3.5.

[0035] Furthermore, the CRISPR / Cas12a system was incubated at 35-40° C. for 20-45 min for reaction.

[0036] Preferably, the RAA amplification system is: 25 μL Buffer, 3 μL upper primer (10 μmol / μL), 3 μL lower primer (10 μmol / μL), 2.1 μL magnesium acetate, 2 μL DNA template, ddH 2 Add 3% HO to 50 μL.

[0037] Preferably, the temperature of the RAA reaction is 35-40° C., and the time is 5-20 min.

[0038] Preferably, the CRISPR / Cas12a system is: 150nM Cas12a, 150nM crRNA, 500nM FQ-ssDNA probe (FAM-TTTTTTTT-BHQ1), 2μL RAA product, 1μL 10×NEBuffer2.1, ddH 2 Add 3% HO to 20 μL.

[0039] The present invention innovatively constructs a rapid detection method for camel-derived ingredients based on RAA-CRISPR / Cas12a, designs specific RAA primers for the camel cytochrome B (Cytb) gene, and optimizes the concentration and ratio of Cas12a, crRNA, and FQ-ssDNA probes to achieve a 1% detection limit, significantly improving the detection efficiency. By optimizing the Cas12a detection system and crRNA specific design, the present invention realizes the application of this technology in the field of terrestrial animal detection for the first time, effectively overcoming the influence of food matrix interference on detection, and improving the specificity, sensitivity and stability of detection.

[0040] In terms of the optimization of the Cas12a detection system, the present invention optimizes the processing method of the amplified product for the effect of the inhibitory factors that may exist in the RAA amplified product on the Cas12a enzyme activity, ensuring that Cas12a can still cut efficiently in a complex food matrix environment. By adjusting the ratio of Cas12a to crRNA, optimizing the FQ-ssDNA probe concentration and the reaction buffer system, the background activity is effectively reduced, the nonspecific cutting is reduced, and the signal-to-noise ratio of the detection is improved, so that the trans-cutting activity of Cas12a remains highly sensitive in the food detection environment, providing a guarantee for the accurate identification of camel DNA.

[0041] In terms of the specific design of crRNA, the present invention screens out camel-specific target sequences to avoid cross-reactions with other animal DNA such as cattle, sheep, and pigs, and optimizes the binding stability of crRNA for the high GC content and repetitive sequences of the camel genome to ensure efficient cutting of Cas12a. Combined with the characteristics of the camel genome, the specificity and reliability of the detection are further improved to ensure that camel-derived components can still be accurately detected in low-concentration DNA samples (such as adulterated meat products).

[0042] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0043] 1. High specificity and high sensitivity. The CRISPR detection system of the present invention only produces fluorescent signals for camel DNA, but has no reaction to cattle, sheep, pigs, chickens, ducks, horses, etc., showing extremely high specificity and effectively avoiding cross-reactions and false positives. In addition, the minimum detection limit (LOD) of the present invention can reach 1pg / μL DNA, which is more sensitive than the traditional RAA detection method and can accurately detect low-concentration camel-derived components.

[0044] 2. Low detection limit, suitable for food adulteration identification. The present invention can successfully detect camel DNA in mixed meat products with a 1% adulteration ratio, meeting the needs of food safety testing. Compared with traditional methods, the present invention can achieve accurate identification at a lower adulteration level, providing an efficient tool for meat product authenticity detection.

[0045] 3. Rapid detection, suitable for on-site screening. Combining RAA isothermal amplification and CRISPR / Cas12a fluorescence detection, the present invention can complete the detection within 1 hour, which is suitable for rapid food safety screening and on-site detection, and improves the detection efficiency.

[0046] 4. System optimization to ensure detection stability and convenience. Aiming at the detection challenges of camel meat, the present invention optimizes key parameters such as the RAA amplification system, CRISPR detection system, and DNA extraction method to ensure stability and repeatability between different sample batches. At the same time, this method does not require expensive instruments, is easy to operate, and is suitable for promotion and use by grassroots laboratories and market regulatory agencies. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 These are the test results under different CRISPR / Cas systems;

[0048] Figure 2 This is a schematic diagram of the specific experimental results of the CRISPR detection method for camel-derived ingredients, which are the reaction results of camel (Camel), sheep (Ovine), pig (Porcine), cattle (Bovine), chicken (Chicken), duck (Duck) derived ingredients and negative control;

[0049] Figure 3 This is a schematic diagram of the sensitivity results of CRISPR detection of camel-derived components in meat and meat products. Camel tissue DNA with a concentration of 10 ng / μL was gradiently diluted to 1 pg / μL;

[0050] Figure 4 This is a schematic diagram of the detection limit results of CRISPR detection of camel-derived components in meat and meat products. The high-priced meat (camel meat) and low-priced meat (chicken) were mixed in proportion to simulate adulterated meat samples for experiments. The CRISPR reactions of mixed meat samples with camel meat mass fractions of 30%, 10%, 5%, and 1% were prepared, respectively, with chicken as the base;

[0051] Figure 5 These are the detection results of different crRNAs. DETAILED DESCRIPTION

[0052] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0053] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0054] The minced meat of pig, cattle, sheep, chicken, duck and donkey used in the present invention was purchased from China Food and Drug Inspection Institute. Mixed simulated samples of meat and meat products were prepared in different proportions to determine the detection limit of camel-derived components in the mixed samples. DNA extraction kit: OMEGA Biological Company, USA.

[0055] RAA primers were designed based on the camel cytochrome B (Cytb) gene, and the primer nucleotide sequences are as follows: Upstream primer: 5'-TTCCACTTCATCCTGCCATTTATTATCACGG-3'

[0056] Downstream primer: 5′-CAGTGCTCCTAGGATGTCTTTAATTGTGTAG-3′.

[0057] Example 1

[0058] 1. Extract genomic DNA from the sample to be tested

[0059] 2. Prepare the following RAA reaction system (50 μL):

[0060]

[0061] After thorough mixing, centrifuge quickly and place in a PCR instrument or constant temperature device with set reaction conditions. The reaction conditions are: 39°C, 20min.

[0062] 3. Prepare the following CRISPR / Cas12a reaction system and incubate at 39°C for 20 minutes.

[0063]

[0064] Among them, the crRNA sequence is: SEQ ID No.1:

[0065] UAAUUUCUACUAAGUGUAGAUCCUUCCACUUCAUCCUGCCAU.

[0066] 4. After the reaction is completed, directly observe the results through a gel imager. If fluorescence appears, it indicates that the sample contains camel-derived components. Alternatively, add the reaction solution to a black 96-well plate containing 80 μL of double-distilled water and use an ELISA reader to measure the fluorescence intensity. By comparing the fluorescence intensity results, determine whether the sample contains camel-derived components.

[0067] Embodiments 2 to 4

[0068] The technical solutions of Examples 2 to 4 are similar to those of Example 1, except that the CRISPR / Cas12a systems are different, as shown in Table 1.

[0069] Table 1

[0070]

[0071] Embodiments 5 to 7

[0072] The technical solutions of Examples 5 to 7 are similar to those of Example 1, except that the CRISPR / Cas12a systems are different, as shown in Table 2.

[0073] Table 2

[0074] LbCas12a(nM) crRNA(nM) FQ-ssDNA probe (nM) Example 5 250 500 500 Example 6 250 500 600 Example 7 250 500 700

[0075] Example 8

[0076] The technical solution of Example 8 is similar to that of Example 1, except that in the CRISPR / Cas12a reaction system, the crRNA sequence is: SEQ ID No. 2:

[0077] UAAUUUCUACUAAGUGUAGAUUUAUCACGGCCCUAGUAGCCG.

[0078] Comparative Examples 1 to 3

[0079] The technical solutions of Comparative Examples 1 to 3 are similar to those of Example 1, and the differences are shown in Table 3.

[0080] Table 3

[0081]

[0082] Verification Method

[0083] 1. Camel-derived ingredient specificity test

[0084] According to the reaction system of Example 1, camel tissue DNA was used as a positive control, ultrapure water was used as a negative control, and DNA from sheep, pigs, cattle, chickens, ducks, and horses was used as a specific experimental template to determine the specificity of the camel-derived CRISPR detection method.

[0085] 2. Camel-derived ingredient sensitivity test

[0086] The camel tissue DNA with a concentration of 10 ng / μL was diluted to 1 pg / μL by gradient dilution. A sensitivity experiment was performed according to the system of Example 1.

[0087] 3. Detection limit experiment of camel-derived ingredients

[0088] The experiment was conducted by mixing high-priced meat (camel meat) and low-priced meat (chicken) in proportion to simulate adulterated meat samples. The mixed meat samples with camel meat mass fractions of 30%, 10%, 5% and 1% were prepared with chicken as the base, and the samples were tested using the reaction system of Example 1.

[0089] Analysis

[0090] 1. Verification of different reaction systems

[0091] When the sample to be tested is pure camel meat, Figure 1 A It can be seen that when Cas12a concentration is 50nM (Comparative Example 1), there is almost no difference between crRNA iso-ratio concentration or double concentration, and trans-cleavage activity is weak, and fluorescent signal is not obvious. When Cas12a concentration is 150nM, 250nM, and 350nM, double crRNA concentration is more obvious than iso-ratio concentration fluorescent signal. Wherein 250nMCas12a, 500nM crRNA are the best fluorescent signal. Figure 1 B Results show that the probe concentration of 300nM (Comparative Example 2) and 400nM (Comparative Example 3) cannot fully reflect the intensity of trans-cleavage activity. It reaches saturation when the probe concentration reaches 500nM, and the fluorescence intensity is almost the same as that at 600nM and 700nM.

[0092] according to Figure 5 As a result, the fluorescence signal intensity of crRNA1 (Example 1) is significantly higher than that of crRNA2 (Example 8), indicating that its target recognition ability is stronger. The weaker fluorescence signal of crRNA2 indicates that its recognition ability of camel DNA is low, resulting in a decrease in the cutting efficiency of Cas12a, thereby affecting the release of the fluorescence signal. In the detection of adulterated meat, the detection limit may be increased, resulting in low-concentration camel DNA being difficult to detect, increasing the risk of false negatives. In addition, a lower fluorescence signal means a decrease in detection sensitivity. In mixed meat products with low camel DNA content, the fluorescence changes will not be distinguishable by the naked eye, and the use of instrument detection will also make it difficult to distinguish between the real signal and the background noise, thereby affecting the detection accuracy. At the same time, the low binding efficiency of crRNA2 may also be related to its low specificity with the target sequence.

[0093] 2. Camel-derived ingredient specificity test

[0094] according to Figure 2 As a result, only camel DNA samples were able to generate strong fluorescent signals, while other animal-derived components (such as cattle, sheep, pigs, chickens, ducks, and horses) did not show specific amplification, indicating that the RAA-CRISPR / Cas12a method of the present invention has extremely high specificity for camel-derived components and is very sensitive, and can effectively distinguish camels from other animal-derived components. The results of the negative control proved that the method had no false positives, further enhancing its reliability in practical applications.

[0095] 3. Camel-derived ingredient sensitivity test

[0096] The results are as follows Figure 3As shown, except for NTC (negative control), all samples (i.e., 1pg, 10pg, 100pg, 1ng, and 10ng of camel DNA) produced obvious fluorescence signals, indicating that this method can specifically detect camel DNA and is very suitable for the detection of low-concentration DNA samples. It has a good detection limit and a sensitivity of up to 1pg / μL.

[0097] 4. Detection limit experiment of camel-derived ingredients

[0098] Figure 4 The results showed that the method of the present invention was able to detect camel-derived components in a mixed meat sample with a mass fraction of 1%, proving that the method had extremely high sensitivity and was suitable for low-amount adulterated or mixed samples that might be encountered in practice.

[0099] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the embodiments here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A kit for detecting camel-derived components based on the RAA-CRISPR / Cas12a method, characterized in that: It includes reagents required for RAA, crRNA, Cas12a protein, fluorescent probe and buffer; the crRNA includes crRNA1 or crRNA2, and the sequence of crRNA1 is SEQ ID No.1: UAAUUUCUACUAAGUGUAGAUCCUUCCACUUCAUCCUGCCAU, The sequence of crRNA2 is SEQ ID No.2: UAAUUUCUACUAAGUGUAGAUUUAUCACGGCCCUAGUAGCCG.

2. The kit for detecting camel-derived components based on the RAA-CRISPR / Cas12a method according to claim 1, characterized in that: The reagents required for RAA include buffer, magnesium acetate and Upstream primer: 5′-TTCCACTTCATCCTGCCATTTATTATCACGG-3′; Downstream primer: 5′-CAGTGCTCCTAGGATGTCTTTAATTGTGTAG-3′.

3. An application of a kit for detecting camel-derived components based on the RAA-CRISPR / Cas12a method according to any one of claims 1 to 2, characterized in that: Used for rapid detection of camel-derived ingredients in meat, milk and their products.

4. A method for detecting camel-derived components, characterized in that: A kit for detecting camel-derived components based on the RAA-CRISPR / Cas12a method according to any one of claims 1 to 2.

5. The method for detecting camel-derived components according to claim 4, characterized in that: The following steps are involved: The detection source components are first subjected to RAA amplification; the amplified products are added to the CRISPR / Cas12a system for reaction; and the CRISPR / Cas12a reaction products are subjected to fluorescence observation.

6. The method for detecting camel-derived components according to claim 5, characterized in that: In the CRISPR / Cas12a system, the concentration of the Cas12a protein is greater than 0.05 μmol / L.

7. The method for detecting camel-derived components according to claim 5, characterized in that: In the CRISPR / Cas12a system, the concentration of the fluorescent probe is greater than 0.4 μmol / L.

8. The method for detecting camel-derived components according to claim 5, characterized in that: In the CRISPR / Cas12a system, the molar concentration ratio of crRNA to Cas12a is 1 to 2:

1.

9. The method for detecting camel-derived components according to claim 5, characterized in that: In the CRISPR / Cas12a system, the molar concentration ratio of the fluorescent probe to Cas12a is 1.3 to 3.

5.

10. The method for detecting camel-derived components according to claim 5, characterized in that: The CRISPR / Cas12a system was incubated at 35-40°C for 20-45 min for reaction.

Images