SNP (Single Nucleotide Polymorphism) molecular marker related to body weight character of local chicken and application of SNP molecular marker
Through whole-genome sequencing and GWAS analysis of local chickens, SNP molecular markers related to body weight were identified, and the marker was used for marker-assisted selection, which significantly improved the 18-week-old weight of local chickens, solved the problem of low weight in local chickens, and improved breeding efficiency and economic benefits.
Patent Information
- Application Number
- CN202510417349.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-04-03
AI Technical Summary
The low weight and slow growth rate of local chickens lead to low production efficiency, which limits the high-quality development of the local chicken industry.
By whole-genome sequencing of 490 Jianghan chickens, GWAS analysis was used to identify the SNP molecular marker at base 77325222 of the GRCg6a Primary Assembly version of the international chicken reference genome. The polymorphism of this mark significantly affected body weight at 18 weeks of age.
The SNP molecular marker is used for marker assisted selection, and the TT genotype individual is preferred, which significantly improves the 18-week-old weight of local chickens, thereby improving breeding efficiency and economic benefits.
Smart Images

Figure BDA0005344292590000051 
Figure HDA0005344292600000011 
Figure HDA0005344292600000012
Abstract
Description
Technical Field
[0001] The invention belongs to the field of molecular biology and breeding technology, and specifically relates to a SNP molecular marker related to the body weight trait of local chickens and an application thereof. Background Art
[0002] The poultry industry is not only a pillar industry of my country's agriculture, but also an important industry related to the national economy, people's livelihood and social stability. With the development of social economy and the improvement of people's living standards, the market demand for diversified, characteristic and personalized poultry products has grown rapidly, and the consumer demand for high-quality characteristic local chicken products has become increasingly strong. my country's local chicken germplasm resources are rich, distinctive, and excellent in meat quality. At the same time, they have the advantages of low requirements for the breeding environment, strong disease resistance, and high survival rate. However, due to the lack of high-intensity systematic breeding, there are defects such as slow growth, low weight, and poor egg-laying performance, resulting in low production efficiency, which largely restricts the high-quality development of the local chicken industry. As a local specialty chicken breed in Hubei Province, Jianghan chicken has the advantages of tolerance to roughage, strong disease resistance, and tender meat, but its growth rate is significantly lower than that of commercial broiler breeds (such as white-feathered chickens). According to the 2023 Hubei Provincial Livestock and Poultry Genetic Resources Census, the average weight of adult Jianghan chickens is only 1.2-1.5kg, far lower than the level of white-feathered chickens in the same period.
[0003] The weight trait of chickens reflects the growth performance of chickens and is an important economic trait. The genetic improvement of this type of trait directly affects its economic benefits, and this type of trait has always been the target trait in chicken breeding. In addition, the weight and uniformity of 18-week-old chickens are key factors in determining the egg production rate and the durability of the peak egg production period. In order to improve the weight trait of chickens, breeding methods are generally used to select individuals with fast growth rates. However, the traditional breeding method is through family selection, which has slow progress and severely limits the genetic improvement of weight traits. It is urgent to identify some key molecular markers, and then use molecular marker-assisted selection or genomic selection to improve the breeding of related traits. Summary of the invention
[0004] In order to solve the above technical problems, the present invention provides a SNP molecular marker related to the body weight trait of local chickens and its application.
[0005] To achieve the above object, the present invention adopts the following technical solutions:
[0006] A SNP molecular marker associated with the body weight trait of local chickens, the SNP molecular marker is located at the 77325222nd base of chromosome 4 of the international chicken reference genome GRCg6a Primary Assembly version, the 77325222nd base is C or T, and the mutation causes polymorphism.
[0007] The present invention is based on 490 local breed Jianghan chickens, and the weight at 18 weeks of age is measured and recorded, and the SNP typing data obtained by whole genome sequencing is used for GWAS analysis, and the GWAS results are further analyzed, and finally the nucleotide site 77325222 of chromosome 4 is identified to be significantly associated with the weight at 18 weeks of age. The research results show that the polymorphism of the SNP site is C / T, and the weight of individuals with CT and TT genotypes at 18 weeks of age is significantly higher than that of individuals with CC genotypes.
[0008] Preferring the TT genotype during breeding can significantly increase the body weight of local chickens at 18 weeks of age.
[0009] Preferably, the nucleotide sequence containing the above-mentioned SNP molecular marker is as shown in SEQ ID NO.3, and the 108th base R in the sequence is the SNP molecular marker site, and R represents C or T.
[0010] Furthermore, the nucleotide sequence of the SNP molecular marker is a fragment containing the base at position 108 in the nucleotide sequence shown in SEQ ID NO. 3. By detecting the base site of the specific fragment, the genotype of the chicken individual can be distinguished.
[0011] The present invention provides specific primers for specific amplification including the above-mentioned molecular markers. In one embodiment of the present invention, the specific primers include an upstream primer having a nucleotide sequence shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence shown in SEQ ID NO.2.
[0012] Furthermore, the present invention provides a detection reagent for detecting the molecular marker or a kit containing the detection reagent. Preferably, it includes the above-mentioned specific primer.
[0013] Furthermore, the present invention also provides the use of the above molecular markers or the above specific primers or the above detection reagents or kits in identifying chicken weight traits or chicken assisted breeding. During identification or assisted breeding, the genotype of the molecular marker site is selected as the TT genotype as the dominant genotype.
[0014] The present invention also provides a method for detecting the SNP molecular marker associated with the chicken body weight trait as described above, which comprises the following steps:
[0015] (1) Obtaining genomic DNA of each individual of the chicken species or strain to be tested;
[0016] (2) detecting the genotype of the SNP molecular marker in the genomic DNA;
[0017] (3) Select individuals with TT genotype and eliminate individuals with CC and CT genotypes.
[0018] In the method as described above, preferably, in step (1), the chicken genomic DNA is DNA extracted from wing vein blood.
[0019] In the method as described above, preferably, in step (2), the identification method uses PCR amplification, and the amplified product is sequenced and typed.
[0020] The SNP molecular markers described above are used in marker-assisted selection of chicken body weight traits.
[0021] In the application as described above, preferably, the chicken body weight trait is mainly used in the selection of body weight at 18 weeks of age.
[0022] Use of the above-mentioned SNP molecular marker, the above-mentioned primer set, the above-mentioned kit or the above-mentioned method in chicken breeding.
[0023] Preferably, the breeding is the selection of superior individuals with significantly increased growth rate.
[0024] The SNP molecular marker with TT genotype was selected as breeder chickens, which had the advantageous trait of increasing body weight at 18 weeks of age.
[0025] The beneficial effects of the present invention are:
[0026] The SNP molecular marker related to the chicken weight trait provided by the present invention has a significant effect on the 18-week-old weight of local chickens at this site. By determining the genotype of the polymorphism, it is possible to effectively identify whether the individual is a fast-growing individual, providing a detection technology means for early breeding and improving breeding efficiency. The present invention also provides a reliable molecular marker for the breeding and improvement of the weight trait of local chickens, which is of great significance to the genetic improvement of chickens.
[0027] The present invention can be used to select TT genotype as breeding chickens through the detection of the SNP molecular site, so as to increase the individual weight of local chickens and help to improve the economic benefits of the local chicken breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 The Manhattan plot of the GWAS results of body weight at 18 weeks of age in Example 1 of the present invention;
[0029] Figure 2 is the phenotypic value of individuals with different genotypes of the SNP in Example 1 of the present invention;
[0030] Figure 3 This is a diagram showing the results of the primers designed in Example 2 of the present invention for three genotypes. DETAILED DESCRIPTION
[0031] The present invention is based on the local resource Jianghan chicken population owned by the applicant team. By measuring and recording the weight at 18 weeks of age, the SNP typing data obtained by whole genome sequencing was used to conduct a GWAS study on the weight trait, and the GWAS results were further analyzed to identify a SNP molecular marker that is significantly associated with the weight at 18 weeks of age. The SNP molecular marker can be used to carry out marker-assisted selection for the 18-week-old weight index, conduct early breeding, and improve breeding efficiency. The present invention provides a reliable molecular marker detection method for the genetic improvement of the weight trait of local chickens.
[0032] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.
[0033] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents used in the present invention are of analytical grade or above.
[0034] Example 1 Acquisition of SNP loci affecting the weight of chickens at 18 weeks of age
[0035] 1. Test materials
[0036] A group of 490 local breed Jianghan chickens were selected as the research subjects. The body weight phenotype data of all individuals at 18 weeks of age were measured, and wing vein blood was collected for genomic DNA extraction.
[0037] 2. Test methods
[0038] 2.1 DNA extraction
[0039] DNA was extracted using the commonly used phenol-chloroform crude extraction method (for the phenol-chloroform crude extraction method, see Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning Laboratory Guide [M]. 2nd edition. Jin Dongyan, Li Mengfeng. Beijing: Science Press, 1999. 465-467) or other recognized extraction methods with equal effectiveness, which are all reported commonly used methods.
[0040] 2.2. Chicken whole-genome SNP typing method based on whole-genome sequencing
[0041] By sequencing the whole genome of 490 individuals at a depth of 10×, 20.78 million SNP sites were initially identified through read alignment, sorting, marking duplication, base quality recalibration and variation detection. Plink software was used to calculate the individual deletion rate, SNP site deletion rate, and minimum allele frequency MAF, and quality control standards were established, ultimately obtaining 8.72 million high-quality SNP markers.
[0042] 2.3. Genome-wide association analysis
[0043] GWAS analysis of body weight at 18 weeks of age was performed using a mixed linear model based on GEMMA software. The analysis model is as follows:
[0044] y=Wa+Xb+u+e
[0045] Among them, y represents the matrix of trait phenotype values; W represents the covariance matrix, a represents the vector of corresponding coefficients including the intercept; X represents the SNP genotype vector, b represents the effect size of the SNP; u represents the random effect; and e represents the error effect.
[0046] GWAS results Figure 1 As shown in the figure, the SNP sites significantly associated with body weight at 18 weeks of age are concentrated on chromosome 4. Further analysis of the significantly associated SNP sites revealed that the SNP site (4:77325222) (C / T), i.e., the base C / T at position 77325222 of chromosome 4 of the international chicken reference genome GRCg6aPrimary Assembly version, was the most significantly associated site (P = 2.21 × 10 -11 ). For the total sample of 490, 116 were CC type, 227 were CT type, 146 were TT type, and 1 individual genotype was missing. The specific test results are shown in Table 1. The research results show that the polymorphism of the SNP site is C / T, and the weight of individuals with CT and TT genotypes at 18 weeks of age is significantly higher than that of individuals with CC genotypes. Figure 2 The TT genotype can be used as a breeding option. The polymorphic locus can be used to carry out marker-assisted selection for the 18-week-old body weight trait, conduct early breeding, and improve breeding efficiency. This provides a reliable detection basis for the genetic improvement of the body weight trait of local chickens.
[0047] Table 1 Comparison of body weight phenotypes of Jianghan chickens with different genotypes at 18 weeks of age
[0048]
[0049] The values in the table are "mean ± standard deviation". Different lowercase letters in the same row indicate significant differences (P<0.05), and the same letters indicate insignificant differences.
[0050] Example 2 Genotyping Identification
[0051] 1. Detection primer design
[0052] For the nucleotide site C / T at position 77325222 of chromosome 4 obtained in Example 1, a primer combination for detecting the site was designed for PCR detection of the SNP site. The upstream and downstream primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The sequence of the amplified product is shown in SEQ ID NO.3, wherein the base R at position 108 of the sequence is a SNP site, and R represents C or T, resulting in a C / T polymorphism at the site for the weight trait at 18 weeks of age.
[0053] The details are as follows:
[0054] SEQ ID NO.1: 5'-GCACATTCTGTATCCCTG-3'
[0055] SEQ ID NO.2: 5'-TCCTTCTGCCACTTATTT-3'
[0056] SEQ ID NO.3: GCAATTCTGTATCCCTGGCACAGAGCAGGCGCT CAGAGATTGCCATCCTCAAAGTAAAATGGTAGTTCTAGAGGAATATCAGGGTCAGATGGAAAGTCCAGGTGTGRATCAGGTAGCCTATGGCATGCTGACAGGTAACACTGCCCAATAGTGGATTTTCTGGGGAAATAAGTGGCAGAAGGA
[0057] 2. DNA template
[0058] According to the whole genome DNA sequencing results, genomic DNA of three individuals with CC, CT and TT genotypes at SNP sites were selected as templates.
[0059] 3. PCR amplification of target fragment
[0060] PCR reaction system 20μL: r-Taq 0.1μL, 10×Buffer 2μL, dNTP Mix 1.6μL, two upstream and downstream primers (10μmol / L) 1.0uL each, DNA template 2.0μL (50ng / uL), ddH 2 The PCR reaction program was: 95°C pre-denaturation for 3 min, 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 30 s, a total of 35 cycles; 72°C for 5 min, and 4°C storage.
[0061] 4. Sequencing and identification
[0062] The PCR amplified products were subjected to Sanger sequencing at Aoke (Wuhan) Biotechnology Co., Ltd., and the gene fragments were subjected to both forward and reverse reactions. The obtained sequences were compared with the reference genome GRCg6a Primary Assembly of chicken to obtain the corresponding SNP marker site mutations, such as Figure 3 shown.
Claims
1. A SNP molecular marker associated with the body weight trait of local chickens, characterized in that: The SNP molecular marker is located at base 77325222 of chromosome 4 of the international chicken reference genome GRCg6a Primary Assembly version. The base 77325222 is C or T, and the mutation causes polymorphism.
2. The SNP molecular marker according to claim 1, characterized in that The nucleotide sequence containing the above-mentioned SNP molecular marker is shown in SEQ ID NO.
3. The 108th base R in the sequence is the SNP molecular marker site, and R represents C or T.
3. The SNP molecular marker according to claim 1, characterized in that The nucleotide sequence thereof is a fragment including the 108th base in the nucleotide sequence shown in SEQ ID NO.
3.
4. Specific primers for specifically amplifying the molecular marker according to any one of claims 1 to 3.
5. The specific primer according to claim 4, characterized in that It comprises an upstream primer having a nucleotide sequence shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence shown in SEQ ID NO.
2.
6. A detection reagent for detecting the molecular marker described in any one of 1 to 3 or a kit containing the detection reagent.
7. The detection reagent according to claim 6 or a kit containing the detection reagent, characterized in that The invention comprises the specific primer according to claim 4 or 5.
8. Use of the molecular marker according to any one of claims 1 to 3, or the specific primer according to claim 4 or 5, or the detection reagent or kit according to claim 6 or 7 in identifying chicken body weight traits or chicken assisted breeding.
9. The use according to claim 8, characterized in that The TT genotype was selected as the dominant genotype.
10. A method for breeding local chickens capable of improving their body weight traits, characterized in that: The following steps are involved: (1) Obtaining genomic DNA of each individual of the chicken species or strain to be tested; (2) detecting the genotype of the SNP molecular marker according to any one of claims 1 to 3 in the genomic DNA; (3) Select individuals with TT genotype and eliminate individuals with CC and CT genotypes.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker for genetic improvement of chicken carcass traits
CN115125308A
SNP (Single Nucleotide Polymorphism) marker related to egg laying traits of local chickens as well as detection method and application of SNP marker
CN116751868A
Egg-type chicken whole-genome SNP chip and use thereof
US20210395803A1