Primer group and kit for detecting klebsiella pneumoniae and ST11 high-risk clone typing of klebsiella pneumoniae

By designing multiple fluorescent PCR primer sets and asymmetric fluorescent PCR amplification methods, the shortcomings of detecting high-risk clonal forms of Klebsiella pneumoniae in the prior art were solved, and fast, efficient and accurate detection was achieved, which improved detection efficiency and curbed the spread of the strain.

CN120099199APending Publication Date: 2025-06-06PEOPLES HOSPITAL PEKING UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510330387.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-19
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art lacks fast, efficient, accurate and inexpensive methods to detect the ST11 high-risk clonal form of Klebsiella pneumoniae, especially in terms of comprehensive monitoring and early intervention of five typical marker genes (bmr3, sdaC, pyrB, mltC and ppsC).

Method used

A multiplex fluorescent PCR primer set was designed, using asymmetric fluorescent PCR amplification and melting curve methods to distinguish detection of mutant and wild-type samples, and achieve rapid and accurate typing of 5 marker genes in ST11 cloning.

Benefits of technology

The rapid, efficient and accurate detection of high-risk cloning and typing of Klebsiella pneumoniae ST11 was achieved, reducing the consumption of time, reagents and costs, improving the detection efficiency, and effectively identifying and curbing the spread of this strain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099199A_ABST
    Figure CN120099199A_ABST
Patent Text Reader

Abstract

The invention discloses a primer group, a kit and a detection method for high-risk clone typing detection of klebsiella pneumoniae ST11, the primer group comprises one or more amplification primer pairs and probes for detecting high-risk clone marker genes (including bmr3, sdaC, pyrB, mltC and ppsC) of klebsiella pneumoniae and ST11, and the high-risk clone typing detection of klebsiella pneumoniae and ST11 is realized by using a method of asymmetric fluorescent PCR amplification and melting curve. According to the present invention, the mutation type sample and the wild type sample are subjected to the differentiated detection so as to form the stable PCR reaction kit system, such that the clinical klebsiella pneumoniae pathogen can be efficiently and accurately detected, and the ST11 typing detection can be performed on the ST11 high-risk cloning marker gene. A complete system formed by the primer group, the kit and the detection method has high specificity and accuracy, klebsiella pneumoniae pathogens and ST11 high-risk clone typing can be effectively detected, rapid, efficient and low-cost detection can be realized, the detection time is greatly shortened, and large-scale application is facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and specifically relates to a multiplex fluorescent PCR primer set and a kit for detecting Klebsiella pneumoniae and ST11 high-risk clone marker typing thereof. Background Art

[0002] The widespread spread of carbapenem-resistant gram-negative bacilli (CRGNB) around the world has become a global public health problem. In 2024, the World Health Organization (WHO) listed carbapenem-resistant Enterobacteriales (CRE) as "critical priority" resistant bacteria in the list of priority resistant pathogens that urgently need new antibiotic development. Among them, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii and Pseudomonas aeruginosa are listed as four gram-negative bacteria among the six leading pathogens of resistance-related deaths. Carbapenem-resistant Klebsiella pneumoniae (CRKP) is one of the seven multi-drug resistance (MDR) or extensive drug resistance (XDR) pathogens.

[0003] From 2011 to 2021, a total of 6609 non-repetitive CRE clinical isolates were obtained from 28 provinces and cities in China. Among the clinical isolates of CRE, CRKP accounted for 71.4% of the 6609 non-repetitive CRE isolates, followed by carbapenem-resistant Escherichia coli and Enterobacter cloacae. According to the data from the 2023 "China Pneumonia Research", ST11 is the most common clonal type of CRKP in my country (accounting for 80.7% (1565 / 1940)), followed by ST23 (accounting for 2.4% (46 / 1940)) and ST15 (accounting for 2.3% (44 / 1940)); the serotype is mainly KL64 [743 strains (38.3%)], followed by KL47 [265 strains (13.7%)]. The five genes cloned by ST11 (including bmr3, sdaC, pyrB, mltC and ppsC) all form high-risk clones through single-base mutations, that is, the wild type is low-toxic and the mutant type is high-toxic. There are many types of molecular detection methods for single-base mutations, which can be roughly divided into three categories according to the technical principles:

[0004] The first category is the detection method based on traditional PCR, which has high sensitivity and good specificity. A variety of derivative typing methods have been born around PCR technology, which can be simply divided into two types: 1) the use of primer probes that bind to specific bases during the amplification process to detect single-base mutations or introduce oligonucleotides to block non-targeted sequences; 2) post-amplification melting curve analysis methods, including probe method and dye method.

[0005] The second type is based on probe binding gene chip method, such as Affymetrix This type of DNA microarray chip, after the modified nucleic acid sample is injected into the reaction chip, hybridized, washed, stained, and then the fluorescence signal of each characteristic point is scanned to identify the corresponding single-base mutation site. The gene chip data collection throughput is high, and the number of SNPs that can be processed simultaneously currently ranges from thousands to millions.

[0006] The third category is the typing method based on sequencing methods, among which the second-generation sequencing technology (NGS) is the most representative. The current NGS testing service has formed an industrialized process, which can be simply summarized as follows: after the sample is processed in the early stage, the sequence reading is completed by library construction and sequencing while synthesis (here refers to the sequencing principle dominated by Illumina), and finally the data is analyzed by multiple algorithms such as alignment, splicing, and annotation.

[0007] The detection of ST11 high-risk Klebsiella pneumoniae is mainly carried out through molecular biology, gene chips and genomics. Some aspects have detected a specific marker gene, but there is still a lack of rapid, efficient, accurate and low-cost detection methods covering five typical marker genes (including bmr3, sdaC, pyrB, mltC and ppsC) to facilitate comprehensive monitoring and early intervention of ST11 high-risk strains of Klebsiella pneumoniae, so as to more effectively identify the strain and curb its spread in clinics and communities. Summary of the invention

[0008] The present invention designs primers and probes for five marker genes bmr3, sdaC, pyrB, mltC and ppsC of ST11 clone of Klebsiella pneumoniae based on wild-type sequences, and uses asymmetric fluorescence PCR amplification and melting curve methods to distinguish and detect mutant and wild-type samples. A sensitive and specific molecular biological method is established to distinguish wild-type (low toxicity) and mutant (high toxicity) samples of five marker genes (including bmr3, sdaC, pyrB, mltC and ppsC) cloned from ST11. The method is simple to operate, greatly saves time, reagents and costs, and has the advantages of being fast, effective, highly sensitive and specific.

[0009] To implement this method, the present invention provides the following scheme:

[0010] Embodiment 1, a primer set for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing, characterized in that it includes amplification primer pairs and probes for detecting one or more of the Klebsiella pneumoniae and high-risk clone marker genes pyrB, ppsC, mltC, bmr3 and sdaC typing,

[0011] The nucleotide sequences of the amplification primer pair for Klebsiella pneumoniae are shown in SEQ ID NO:1 and SEQ ID NO:2, and the nucleotide sequence of the probe for Klebsiella pneumoniae is shown in SEQ ID NO:3;

[0012] The nucleotide sequences of the primer pair for amplifying the high-risk clone marker gene pyrB are shown in SEQ ID NO:4 and SEQ ID NO:5, and the nucleotide sequence of the probe for the high-risk clone marker gene pyrB is shown in SEQ ID NO:6;

[0013] The nucleotide sequences of the amplification primer pair for the high-risk clone marker gene ppsC are shown in SEQ ID NO:7 and SEQ ID NO:8, and the nucleotide sequence of the probe for the high-risk clone marker gene ppsC is shown in SEQ ID NO:9;

[0014] The nucleotide sequences of the primer pair for amplifying the high-risk clone marker gene mltC are shown in SEQ ID NO: 10 and SEQ ID NO: 11, and the nucleotide sequence of the probe for the high-risk clone marker gene mltC is shown in SEQ ID NO: 12;

[0015] The nucleotide sequences of the amplification primer pair for the high-risk clone marker gene bmr3 are shown in SEQ ID NO: 13 and SEQ ID NO: 14, and the nucleotide sequence of the probe for the high-risk clone marker gene bmr3 is shown in SEQ ID NO: 15;

[0016] The nucleotide sequences of the primer pair for amplifying the high-risk clone marker gene sdaC are shown in SEQ ID NO:16 and SEQ ID NO:17, and the nucleotide sequence of the probe for the high-risk clone marker gene sdaC is shown in SEQ ID NO:18.

[0017] Embodiment 2. A primer set for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing according to embodiment 1, characterized in that the primer set also includes one or more internal reference amplification primer pairs and probes, wherein the nucleotide sequence of the internal reference amplification primer pair is shown in SEQ ID NO: 19 and SEQ ID NO: 20, and the nucleotide sequence of the internal reference probe is shown in SEQ ID NO: 21.

[0018] Embodiment 3. A primer set for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to embodiment 1, characterized in that the probe is an oligonucleotide fluorescent probe, a 5' end of which is labeled with a fluorescent reporter group, and a 3' end of which is labeled with a fluorescent quencher group, wherein the fluorescent reporter group is selected from one or more of FAM, Texas Red / ROX, Cy5, Cy5.5, and HEX / VIC; and the fluorescent quencher group is selected from one or more of BHQ1, BHQ2, and BHQ3.

[0019] Embodiment 4: According to the primer set for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing as described in embodiment 1, it is characterized in that the ST11 high-risk clone typing comprises one or more of the SNP typing of the marker genes pyrB, ppsC, mltC, bmr3 and sdaC.

[0020] Embodiment 5: A kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof, characterized in that the kit comprises the primer set for detecting Klebsiella pneumoniae and ST11 high-risk clone marker gene typing thereof according to any one of embodiments 1-4.

[0021] Embodiment 6: According to the kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to embodiment 5, it is characterized in that the kit further comprises a PCR mixture, wherein the PCR mixture comprises a DNA polymerase, dNTP, Mg 2+ , Buffer.

[0022] Embodiment 7, according to embodiment 5 or 6, the kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof is characterized in that the amplification primer pair comprises a forward primer and a reverse primer, the molar concentration range of the forward primer is 0.1 to 100 μM, the molar concentration range of the reverse primer is 1 to 100 μM, and the molar concentration range of the probe is 0.1 to 100 μM, for example, 2 to 10 μM, for example, 5 to 20 μM, for example, 10 to 50 μM.

[0023] Embodiment 8: The kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to embodiment 5 is characterized in that the kit is used to prepare a PCR reaction composition.

[0024] Embodiment 9: According to the kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to embodiment 5, it is characterized in that the kit is used for detecting Klebsiella pneumoniae and ST11 high-risk clone typing thereof by fluorescent PCR melting curve method, comprising the following steps:

[0025] Adding internal participants to the sample to be tested;

[0026] Extracting nucleic acid DNA from the sample to be tested to obtain sample DNA;

[0027] The sample DNA, PCR mixture, primer pair, probe nucleotide sequence and nuclease-free water are fully mixed to prepare a PCR reaction composition;

[0028] The PCR reaction composition detects the gene typing of Klebsiella pneumoniae and its ST11 high-risk clone marker through fluorescent PCR amplification and melting curve method.

[0029] Embodiment 10. The kit according to embodiment 9, characterized in that:

[0030] The PCR reaction composition is prepared as follows: the sample and internal reference DNA, PCR mixture, nuclease-free water and the primer set are fully mixed to obtain the PCR reaction composition;

[0031] The fluorescent PCR amplification reaction conditions are as follows: pre-denaturation process at 95°C for 1-5 min for 1 cycle; denaturation and extension process at 90-95°C for 1-20S, and 58-62°C for 20-60S for a total of 40-50 cycles;

[0032] The melting process of the melting curve method is carried out at 40-95°C.

[0033] Embodiment 11: A primer set and a kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to any one of embodiments 1 to 10, characterized in that:

[0034] For the test results obtained by the melting curve method of the kit, the interpretation of positive test results includes:

[0035] (1) The internal reference Ct value is ≤40.0, and the melting curve Tm is within the range of 75±1.5; the negative control group and the no-template control group have no Ct value and no Tm value; if it does not meet the requirements, multiplex real-time fluorescence quantitative PCR and melting curve detection are performed again, or nucleic acid is re-extracted for multiplex real-time fluorescence quantitative PCR and melting curve detection;

[0036] (2) The test results are interpreted according to Table 5.

[0037] The corresponding wild-type Tm value range was established for the five genes cloned by ST11. If the measured Tm value was within the wild-type Tm value range, it was defined as wild-type; if the measured Tm value was within the wild-type Tm value range, it was defined as mutant.

[0038] Embodiment 12: A primer set, a kit, and a method for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to any one of embodiments 1 to 11, characterized in that the test results obtained by the melting curve method are interpreted according to the following rules for the test sample:

[0039] (1) Klebsiella pneumoniae negative: no Klebsiella pneumoniae DNA was detected;

[0040] (2) Klebsiella pneumoniae positive: Klebsiella pneumoniae DNA was detected;

[0041] (3) Klebsiella pneumoniae ST11 high-risk clone typing was positive: Klebsiella pneumoniae was detected and ≥3 marker genes of ST11 high-risk clone typing were positive;

[0042] (4) Klebsiella pneumoniae ST11 high-risk clone typing negative: Klebsiella pneumoniae was detected and the number of marker genes of ST11 high-risk clone typing was less than 3, which was considered positive;

[0043] (5) Klebsiella pneumoniae ST11 high-risk clone typing positive-wild type: Klebsiella pneumoniae was detected to be positive and the five marker genes of ST11 high-risk clone typing were all wild type;

[0044] (6) Klebsiella pneumoniae ST11 high-risk clone typing positive-mutant type: Klebsiella pneumoniae was detected to be positive and all five genes of the ST11 clone were mutant;

[0045] (7) Klebsiella pneumoniae ST11 high-risk clone typing positive - uncertain: Klebsiella pneumoniae was detected positive and any of the five marker genes of ST11 high-risk clone had wild type and mutant type, or only three or four marker genes had melting curves (Tm values ​​regardless of wild type or mutant);

[0046] (8) Invalid results: Klebsiella pneumoniae test negative, ST11 high-risk clone 5 marker genes negative, internal standard negative, need to be retested, the same sample has two consecutive invalid results and needs to be resampled;

[0047] (9) Error / No result: The instrument did not complete the test, or the test data was insufficient. If retesting is required, the sample should be retested using a new test kit.

[0048] On one hand, the present invention provides a multiplex PCR primer pair and probe for detecting marker genes of Klebsiella pneumoniae and its high-risk clones, including amplification primer pairs and MGB probes for detecting 5 marker genes of Klebsiella pneumoniae and ST11 high-risk clone typing.

[0049] On one hand, the present invention provides a multiplex PCR primer pair and probe for detecting marker genes of Klebsiella pneumoniae and its high-risk clones, and also includes a pair of internal reference primer pairs and probes;

[0050] Another aspect of the present invention provides a multiplex PCR detection kit for detecting five marker genes of Klebsiella pneumoniae and ST11 high-risk clone typing thereof, wherein the detection kit comprises the primer set.

[0051] The present invention designs primers for the gene sequences of five marker genes for typing of Klebsiella pneumoniae and its ST11 high-risk clone, can simultaneously perform multiple fluorescent PCR in one reaction tube, distinguish the detection results by fluorescent melting curves, and after optimizing the reaction system and conditions, determine a perfect multiple fluorescent PCR reaction system and melting curve interpretation threshold.

[0052] The present invention discloses the following technical effects:

[0053] 1. The present invention adopts multiplex PCR fluorescent melting curve technology, which can realize the genotyping of ST11 high-risk clones by designing ST11 high-risk clone marker gene-specific probes, thereby realizing the typing of ST11 high-risk clones of Klebsiella pneumoniae.

[0054] 2. The present invention adopts multiplex fluorescence PCR technology to design specific primers and probes for species-specific Klebsiella pneumoniae and ST11 high-risk clone typing marker genes, and applies fluorescence PCR amplification technology and its melting curve to establish a method for rapid identification of Klebsiella pneumoniae and ST11 high-risk typing. The method only requires one sample addition, one reaction tube and one reaction system to complete the typing detection of 5 marker genes of Klebsiella pneumoniae and ST11 high-risk clone typing within 2 hours, has the advantages of being fast, efficient and accurate, greatly shortens the detection time, saves the detection cost, and improves the detection efficiency.

[0055] 3. The multiplex fluorescent PCR primer set and the corresponding melting curve used in the present invention can be used alone or in any combination, and both present a stable detection effect. The entire reaction process is fully closed, effectively avoiding environmental pollution. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0057] Figure 1 This is the fluorescence PCR amplification curve of the specific primer set for the marker gene of Klebsiella pneumoniae and ST11 high-risk clone.

[0058] Figure 2 This is the fluorescence PCR melting curve of the specific primer set for the marker gene of Klebsiella pneumoniae and ST11 high-risk clones. DETAILED DESCRIPTION

[0059] Now, various exemplary embodiments of the present invention are described in detail, which should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present invention. It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not used to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the range is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded in the range. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by conventional technicians in the field of the present invention. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe methods and / or materials related to the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0060] Definition of some terms

[0061] Unless otherwise defined hereinafter, the meaning of all technical terms and scientific terms used in the specific embodiments of the present invention are intended to be the same as those generally understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present invention.

[0062] As used in the present invention, the terms "comprise", "comprising", "having", "containing" or "involving" are inclusive or open-ended, and do not exclude other unrecited elements or method steps. The term "consisting of" is considered to be a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only these embodiments.

[0063] The terms "approximately" and "substantially" in the present invention represent the accuracy range that can be understood by those skilled in the art to still ensure the technical effect of the feature in question. The term usually represents ±10% deviation from the indicated value, preferably ±5%.

[0064] When referring to a singular noun an indefinite or definite article e.g. "a" or "an", "the" or "an" is used, this includes a plural of that noun.

[0065] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily required to describe a sequential or chronological order. It should be understood that the terms so used are interchangeable under appropriate circumstances, and that the embodiments described in the present invention can be implemented in other sequences than those described or illustrated in the present invention.

[0066] Some of the terms used in the present invention are defined as follows:

[0067] The primer pair of the present invention comprises a forward primer (-F) and a reverse primer (-R) for PCR amplification;

[0068] The primer set of the present invention comprises a primer pair and a probe (-P) for PCR amplification;

[0069] To implement this method, the present invention provides the following scheme:

[0070] On the one hand, the present invention provides a primer set and a probe for detecting Klebsiella pneumoniae and its high-risk clone marker genes, including an amplification primer pair and a fluorescent probe for detecting Klebsiella pneumoniae, and an amplification primer pair and a probe for detecting 5 marker genes of ST11 high-risk clone typing, wherein the nucleotide sequence of the amplification primer pair for Klebsiella pneumoniae is shown in SEQ ID NO:1 and SEQ ID NO:2, and the nucleotide sequence of the probe for Klebsiella pneumoniae is shown in SEQ ID NO:3; the nucleotide sequence of the amplification primer pair for ST11 high-risk clone typing marker gene pyrB is shown in SEQ ID NO:4 and SEQ ID NO:5, and the nucleotide sequence of the probe for ST11 high-risk clone typing marker gene pyrB is shown in SEQ ID NO:6; the nucleotide sequence of the amplification primer pair for ST11 high-risk clone typing marker gene ppsC is shown in SEQ ID NO:7 and SEQ ID NO:8, and the nucleotide sequence of the probe for ST11 high-risk clone typing marker gene ppsC is shown in SEQ ID NO:9. NO:9; the nucleotide sequence of the amplification primer pair for the ST11 high-risk clonal typing marker gene mltC is shown in SEQ ID NO:10 and SEQ ID NO:11, and the nucleotide sequence of the probe for the ST11 high-risk clonal typing marker gene mltC is shown in SEQ ID NO:12; the nucleotide sequence of the amplification primer pair for the ST11 high-risk clonal typing marker gene bmr3 is shown in SEQ ID NO:13 and SEQ ID NO:14, and the nucleotide sequence of the probe for the ST11 high-risk clonal typing marker gene bmr3 is shown in SEQ ID NO:15; the nucleotide sequence of the amplification primer pair for the ST11 high-risk clonal typing marker gene sdaC is shown in SEQ ID NO:16 and SEQ ID NO:17, and the nucleotide sequence of the probe for the ST11 high-risk clonal typing marker gene sdaC is shown in SEQ ID NO:18.

[0071] In some embodiments, the primer set further includes one or more internal reference amplification primer pairs and probes, wherein the nucleotide sequences of the internal reference amplification primer pairs are shown in SEQ ID NO:19 and SEQ ID NO:20, and the nucleotide sequence of the internal reference probe is shown in SEQ ID NO:21.

[0072] The sequence information described in this application is as follows:

[0073] SEQ ID NO:1: CTCGTTAAGCTATGATTTCGG

[0074] SEQ ID NO:2:GTTGGTACGGTCGGAGCT

[0075] SEQ ID NO:3:TCGTTAAGCTATGATTTCGG

[0076] SEQ ID NO:4:GATGGTCGGCGATCTGAAG

[0077] SEQ ID NO:5:GAGGATGTACTGCGGCAT

[0078] SEQ ID NO:6:CGGGCGTGGCCAAATTCAACGGCAACCGCTTCGCCCG

[0079] SEQ ID NO:7:CGCAGGTCACAGCGTTTAC

[0080] SEQ ID NO:8:CCCAGACGGTGAAGAAGGTT

[0081] SEQ ID NO:9:GCCGAATACTGCGCCGTGCCGGCAGGCGGC

[0082] SEQ ID NO:10:GTACTGCGGGTCTTCTCCA

[0083] SEQ ID NO:11:GCCGTATTAACTTTGTACAGATAGC

[0084] SEQ ID NO:12:GCGGCTGGCGCCAGGGGACGTCTACCGCCGC

[0085] SEQ ID NO:13:CCTATATCCTCAGCTCCACCA

[0086] SEQ ID NO:14:CACCAGCTGGGTCATATTCT

[0087] SEQ ID NO:15:CCGCGCAAAATTGTGCTGCAGGGCGCGG

[0088] SEQ ID NO:16:AATCCTTCCTTGGCCACTATCT

[0089] SEQ ID NO:17:GGTGGTGATCAGCATGAACA

[0090] SEQ ID NO:18:CGCCGATTAAATCCCTGCGCAGTAAAGGCAAATCGGCG

[0091] SEQ ID NO:19:GAGGATGTCAAGACCTGGTA

[0092] SEQ ID NO:20:TCGCAAGACTGAAACTCAAA

[0093] SEQ ID NO:21:AACCACATGCTCCACCGCTT

[0094] In some embodiments, the primer pair and probe for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing marker gene and internal reference are oligonucleotide fluorescent probes, the 5' end of which is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. The fluorescent reporter group is FAM, Texas Red / ROX, Cy5, Cy5.5, HEX / VIC, etc.; the fluorescent quencher group is selected from one or more of BHQ1, BHQ2 and BHQ3.

[0095] In some embodiments, the primer set for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing, the ST11 high-risk clone typing comprises one or more of the SNP typing of the marker genes bmr3, sdaC, pyrB, mltC and ppsC.

[0096] On the other hand, the present invention provides a multiplex PCR detection kit for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing, wherein the detection kit comprises amplification primer pairs and probes for detecting the marker genes bmr3, sdaC, pyrB, mltC and ppsC of Klebsiella pneumoniae and its ST11 high-risk clone and one or more of the internal references.

[0097] Preferably, the kit further comprises a PCR mixture (eg, Luna Universal Probe qPCR Master Mix), template DNA, and nuclease-free water (ie, ddHO). 2 O). The PCR mixture includes DNA polymerase, dNTP, Mg2+, and Buffer.

[0098] In some embodiments, the molar concentration range of the primer pairs and probes of the multiplex PCR detection kit for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing is 1 to 100 μM, such as 2 to 10 μM, such as 5 to 20 μM, such as 10 to 50 μM.

[0099] In some embodiments, the molar concentration range of the primer pairs and probes of the kit for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing is 0.1 to 100 μM for the forward primer, 1 to 100 μM for the reverse primer, and 0.1 to 100 μM for the probe, for example, 2 to 10 μM, for example, 5 to 20 μM, for example, 10 to 50 μM.

[0100] In some embodiments, the kit for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing is used to prepare a PCR reaction composition.

[0101] In some embodiments, the kit is used for fluorescent PCR detection, comprising the following steps:

[0102] Add internal reference bacteria to the sample to be tested;

[0103] Extracting nucleic acid DNA from the sample to be tested to obtain sample DNA;

[0104] The sample DNA, PCR mixture, primer pair, probe nucleotide sequence and nuclease-free water are fully mixed to prepare a PCR reaction composition;

[0105] The PCR reaction composition detects the genotyping of Klebsiella pneumoniae and its ST11 high-risk clone markers and its internal reference by multiple real-time fluorescence quantitative PCR and melting curve method;

[0106] The changes in the corresponding Tm values ​​obtained by the melting curve method were used to determine whether each gene was wild type (low toxicity) or mutant type (high toxicity);

[0107] In some embodiments, the method for using the kit for non-diagnostic purposes is characterized in that it includes using the kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing to perform fluorescence PCR and melting curve method for detection and result interpretation, comprising the following steps:

[0108] Adding internal participants to the sample to be tested;

[0109] Extracting nucleic acid DNA from the sample to be tested to obtain sample DNA;

[0110] preparing a PCR reaction composition;

[0111] The PCR reaction composition is subjected to PCR amplification and melting curve method to perform typing detection of the Klebsiella pneumoniae and its high-risk clone marker gene and detection of the internal reference;

[0112] The changes in the corresponding Tm values ​​obtained by the melting curve method were used to determine whether each gene was wild type (low toxicity) or mutant type (high toxicity);

[0113] Wherein, the high-risk clone marker genes include bmr3, sdaC, pyrB, mltC and / or ppsC.

[0114] In some embodiments, the PCR reaction composition is prepared as follows: the internal reference and sample DNA, PCR mixture, nuclease-free water and the primer set are fully mixed to obtain the PCR reaction composition;

[0115] In some embodiments, the PCR amplification reaction conditions are: pre-denaturation process at 95°C for 1-5 min for 1 cycle; denaturation and extension process at 90-95°C for 1-20S, and 58-62°C for 20-60S for a total of 40-50 cycles; melting curve at 40-95°C.

[0116] Preferably, the pre-denaturation process is 95°C for 5 min for 1 cycle; the denaturation and extension process is 95°C for 5S, 60°C annealing and extension for 30S for a total of 45 cycles; and the melting curve is performed at 40-95°C.

[0117] In some embodiments, the primer set and kit for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone typing, the test results obtained by the melting curve method, the interpretation of positive test results include: (1) the internal reference Ct value is ≤40.0, and the melting curve Tm is within the range of 75±1.5; the negative control group and the no-template control group have no Ct value and no Tm value; if it does not meet the requirements, multiple real-time fluorescence quantitative PCR and melting curve detection are performed again, or nucleic acid is re-extracted for multiple real-time fluorescence quantitative PCR and melting curve detection; (2) the interpretation of the test results is to establish a corresponding wild-type Tm value range according to the 5 genes cloned in ST11. If the measured Tm value is within the wild-type Tm value range, it is defined as wild type; if the measured Tm value is within the wild-type Tm value range, it is defined as mutant.

[0118] In some embodiments, the test results obtained by the melting curve method are interpreted according to the following rules for the test sample:

[0119] (1) Klebsiella pneumoniae negative: no Klebsiella pneumoniae DNA was detected;

[0120] (2) Klebsiella pneumoniae positive: Klebsiella pneumoniae DNA was detected;

[0121] (3) Klebsiella pneumoniae ST11 high-risk clone typing was positive: Klebsiella pneumoniae was detected and ≥3 marker genes of ST11 high-risk clone typing were positive;

[0122] (4) Klebsiella pneumoniae ST11 high-risk clone typing negative: Klebsiella pneumoniae was detected and the number of marker genes of ST11 high-risk clone typing was less than 3, which was considered positive;

[0123] (5) Klebsiella pneumoniae ST11 high-risk clone typing positive-wild type: Klebsiella pneumoniae was detected to be positive and the five marker genes of ST11 high-risk clone typing were all wild type;

[0124] (6) Klebsiella pneumoniae ST11 high-risk clone typing positive-mutant type: Klebsiella pneumoniae was detected to be positive and all five genes of the ST11 clone were mutant;

[0125] (7) Klebsiella pneumoniae ST11 high-risk clone typing positive - uncertain: Klebsiella pneumoniae was detected positive and any of the five marker genes of ST11 high-risk clone had wild type and mutant type, or only three or four marker genes had melting curves (Tm values ​​regardless of wild type or mutant);

[0126] (8) Invalid results: Klebsiella pneumoniae test negative, ST11 high-risk clone 5 marker genes negative, internal standard negative, need to be retested, the same sample has two consecutive invalid results and needs to be resampled;

[0127] (9) Error / No result: The instrument did not complete the test, or the test data was insufficient. If retesting is required, the sample should be retested using a new test kit.

[0128] The PCR reaction system also includes: primer pairs and probes covering marker genes of Klebsiella pneumoniae and high-risk clones; in this application, PCR reaction system and PCR reaction composition have the same meaning.

[0129] Preferably, the PCR reaction system comprises: the final concentration of each forward primer is 0.5 μM, the final concentration of each reverse primer is 5 μM, the final concentration of the probe is 0.2 μM, the 2×PCR Mix (i.e., the PCR mixture) is 1×, 20 μL of sample nucleic acid is added, and then nuclease-free water (ddH 2 O) to the reaction system to make up to 60 μL.

[0130] The above ranges can be used alone or in combination. The present application can be more easily understood through the following examples.

[0131] Example

[0132] Example 1 Primer design for rapid detection of Klebsiella pneumoniae and its ST11 high-risk clone marker genes pryB, ppsC, mltC, bmr3 and sdaC typing

[0133] 1. Composition of the kit

[0134] (1) Primer set: primer pairs and probes for detecting the genotyping of Klebsiella pneumoniae and its ST11 high-risk clone markers pryB, ppsC, mltC, bmr3 and sdaC, see Table 1 for details;

[0135] Table 1 Primer set sequence information

[0136]

[0137]

[0138] (2) Preparation process of the reaction composition of the kit:

[0139] Configure the PCR reaction system to a 50 μl system (as shown in Table 2):

[0140] Table 2 PCR reaction system (i.e. PCR reaction composition)

[0141] Component name Reaction system Final concentration PCR Mix 10μl 1X Forward primer (10 μM) 0.05μl 0.5μM Reverse primer (10 μM) 0.5μl 5μM Probe (10 μM) 0.2μl 0.2μM DNA template 20μl <100ng <![CDATA[ddH 2 The]]> ~20μl

[0142] Among them, PCR Mix is ​​a PCR mixture containing DNA polymerase, dNTP, Mg 2+ , Buffer, etc.; the forward primer (-F), reverse primer (-R) and probe (-P) comprise the primer-probe combination mixture shown in Table 1, ddH 2 O means nuclease-free water.

[0143] Example 2 Detection limit verification of the kit for Klebsiella pneumoniae ST11 high-risk clones

[0144] In order to verify the minimum detection limit of the gene primers for detecting high-risk clones of Klebsiella pneumoniae ST11, two strain samples were used for typing of high-risk clones of Klebsiella pneumoniae ST11, namely wild type and mutant type. 2 and 10 6 The detection limit (LOD) was tested with 5 CFU / ml gradients, and 6 biological replicates were performed for each gradient. DNA extracted from clinical strains was diluted to a suitable concentration for PCR detection after concentration dilution.

[0145] 1. Extract sample nucleic acid

[0146] 1×106CFU / mL, 1×105CFU / mL, 1×104CFU / mL, 1×103CFU / mL, and 1×102CFU / mL of Klebsiella pneumoniae culture were added to the negative sputum, respectively, and added to a centrifuge tube containing 50μL of magnetic beads, and then 10μL of internal reference, lysis buffer, and proteinase K were added. The nucleic acid was extracted and purified by magnetic beads, and then the elution buffer was added to obtain the nucleic acid DNA of the sample to be tested.

[0147] 2. Prepare PCR reaction system

[0148] The extracted DNA was used as a template, and 20 μL of the DNA template was added to a 0.2 mL PCR reaction tube, and 20 μL of the sample DNA was added, and ddH 2 O 7 μL, and then gently cover the lid and mix thoroughly to prepare the PCR reaction system. Then, PCR reaction is carried out in a PCR instrument. The PCR reaction program is shown in Table 4 below.

[0149] Table 3 PCR reaction system

[0150] Element Reaction system 50μL (μL) Primer Mix 3μL 2×PCR Mix 25μL Internal reference primer probe Mix 0.5μL water 1.5μL template 20μL

[0151] 3. Perform PCR reaction according to the PCR amplification program

[0152] As shown in Table 4, the PCR reaction amplification program was set as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 5 s, 60°C annealing and extension for 30 s, 45 cycles, and the amplification curve is shown in Figure 1 As shown; 40-95℃ melting curve, amplification curve as Figure 2 Finally, the experimental results were interpreted according to the Tm value of the melting curve. The interpretation of the Tm value is shown in Table 5 below.

[0153] Table 4 PCR reaction program

[0154]

[0155] Table 5 Tm value interpretation table of melting curve

[0156]

[0157] The detection limit of the primer set for the high-risk clone gene of Klebsiella pneumoniae ST11 is shown in Table 6. The results show that the detection limit of the high-risk clone gene of Klebsiella pneumoniae ST11 of the present invention is 1×10 3 CFU / mL, both the wild type and mutant types were correctly detected at the detection limit, without any false or misdetection.

[0158] Table 6 Klebsiella pneumoniae specific detection results

[0159]

[0160] Example 3 Verification of the accuracy of Klebsiella pneumoniae ST11 high-risk clone marker gene detection

[0161] In order to verify the accuracy of the designed Klebsiella pneumoniae ST11 high-risk clone marker gene detection, two groups of samples were divided into wild type and mutant type according to clinical Klebsiella pneumoniae isolates for Klebsiella pneumoniae ST11 high-risk clone detection. Each sample was tested at 1×10 3 CFU / mL was used for 10 biological replicates. Different Klebsiella pneumoniae were clinical isolates, and after concentration dilution determination, they were diluted to a suitable concentration for PCR detection. The implementation steps are as follows:

[0162] 1. Extract sample nucleic acid

[0163] The sample nucleic acid extraction was the same as that in Example 2, and the sample conditions are detailed in Tables 7 and 8.

[0164] 2. Prepare PCR reaction system

[0165] The PCR reaction system was configured in the same manner as in Example 2.

[0166] 3. PCR reaction was carried out according to the PCR program reaction conditions described in Example 2. After the PCR reaction was completed, the sample positive and negative was judged according to the melting curve to obtain the accuracy test of the Klebsiella pneumoniae ST11 high-risk clone marker gene primer pair and probe of the present invention. The detailed results are shown in Tables 7 and 8. The test results show that the Klebsiella pneumoniae ST11 high-risk clone marker gene primer pair and probe of the present invention accurately detect its typing with an accuracy of 100%, indicating that the primer pair and probe of the present invention have extremely high detection accuracy.

[0167] Table 7 Klebsiella pneumoniae ST11 high-risk clone marker gene wild type accuracy test results

[0168]

[0169] Table 8 Accuracy test results of Klebsiella pneumoniae ST11 high-risk clone marker gene mutation

[0170]

[0171]

[0172] The primer set and kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone marker gene typing of the present invention have the advantages of fast, high efficiency, high accuracy, high specificity, low cost, and the advantages of being beneficial to promotion, and can facilitate rapid identification of high-risk clone typing of clinical high-risk Klebsiella pneumoniae strain ST11, so as to carry out comprehensive monitoring and early intervention, and can more effectively identify the strain and curb its spread in clinic and community. The above-mentioned embodiments are only to describe the preferred mode of the present invention, and are not to limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by ordinary technicians of the art to the technical solution of the present invention should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A primer set for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof, characterized in that: The invention comprises a pair of amplification primers and a probe for detecting one or more of the typing of Klebsiella pneumoniae and high-risk clone marker genes pyrB, ppsC, mltC, bmr3 and sdaC, The nucleotide sequences of the amplification primer pair for Klebsiella pneumoniae are shown in SEQ ID NO:1 and SEQ ID NO:2, and the nucleotide sequence of the probe for Klebsiella pneumoniae is shown in SEQ ID NO:3; The nucleotide sequences of the primer pair for amplifying the high-risk clone marker gene pyrB are shown in SEQ ID NO:4 and SEQ ID NO:5, and the nucleotide sequence of the probe for the high-risk clone marker gene pyrB is shown in SEQ ID NO:6; The nucleotide sequences of the amplification primer pair for the high-risk clone marker gene ppsC are shown in SEQ ID NO:7 and SEQ ID NO:8, and the nucleotide sequence of the probe for the high-risk clone marker gene ppsC is shown in SEQ ID NO:9; The nucleotide sequences of the primer pair for amplifying the high-risk clone marker gene mltC are shown in SEQ ID NO: 10 and SEQ ID NO: 11, and the nucleotide sequence of the probe for the high-risk clone marker gene mltC is shown in SEQ ID NO: 12; The nucleotide sequences of the amplification primer pair for the high-risk clone marker gene bmr3 are shown in SEQ ID NO: 13 and SEQ ID NO: 14, and the nucleotide sequence of the probe for the high-risk clone marker gene bmr3 is shown in SEQ ID NO: 15; The nucleotide sequences of the amplification primer pair for the high-risk clone marker gene sdaC are shown in SEQ ID NO:16 and SEQ ID NO:17, and the nucleotide sequence of the probe for the high-risk clone marker gene sdaC is shown in SEQ ID NO:

18.

2. The primer set for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to claim 1, characterized in that: The primer set also includes one or more internal reference amplification primer pairs and probes, wherein the nucleotide sequences of the internal reference amplification primer pairs are shown in SEQ ID NO: 19 and SEQ ID NO: 20, and the nucleotide sequence of the internal reference probe is shown in SEQ ID NO:

21.

3. The primer set for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to claim 1, characterized in that: The probe is an oligonucleotide fluorescent probe, the 5' end of which is labeled with a fluorescent reporter group and the 3' end is labeled with a fluorescent quencher group, the fluorescent reporter group is selected from one or more of FAM, Texas Red / ROX, Cy5, Cy5.5, HEX / VIC; the fluorescent quencher group is selected from one or more of BHQ1, BHQ2 and BHQ3.

4. The primer set for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to claim 1, characterized in that: The ST11 high-risk clone typing includes one or more of the SNP typing of the marker genes pyrB, ppsC, mltC, bmr3 and sdaC.

5. A kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing, characterized in that: The kit comprises the primer set for detecting Klebsiella pneumoniae and ST11 high-risk clone marker genotyping thereof according to any one of claims 1 to 4.

6. The kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to claim 5, characterized in that: The kit also includes a PCR mixture, which includes DNA polymerase, dNTP, Mg 2+ , Buffer.

7. The kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to claim 5 or 6, characterized in that: The amplification primer pair comprises a forward primer and a reverse primer, the molar concentration range of the forward primer is 0.1 to 100 μM, the molar concentration range of the reverse primer is 1 to 100 μM, and the molar concentration range of the probe is 0.1 to 100 μM.

8. The kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to claim 5, characterized in that: The kit is used for preparing a PCR reaction composition.

9. The kit for rapid detection of Klebsiella pneumoniae and ST11 high-risk clone typing thereof according to claim 5, characterized in that: The kit is used for detecting the typing of Klebsiella pneumoniae and its ST11 high-risk clones by using a fluorescent PCR melting curve method, and comprises the following steps: Adding internal participants to the sample to be tested; Extracting nucleic acid DNA from the sample to be tested to obtain sample DNA; The sample DNA, PCR mixture, primer pair, probe nucleotide sequence and nuclease-free water are fully mixed to prepare a PCR reaction composition; The PCR reaction composition detects the gene typing of Klebsiella pneumoniae and its ST11 high-risk clone marker through fluorescent PCR amplification and melting curve method.

10. The kit according to claim 9, characterized in that The PCR reaction composition is prepared as follows: the sample and internal reference DNA, PCR mixture, nuclease-free water and the primer set are fully mixed to obtain the PCR reaction composition; The fluorescent PCR amplification reaction conditions are as follows: pre-denaturation process at 95°C for 1-5 min for 1 cycle; denaturation and extension process at 90-95°C for 1-20S, and 58-62°C for 20-60S for a total of 40-50 cycles; The melting process of the melting curve method is carried out at 40-95°C.

Citation Information

Patent Citations

  • Nucleic acid composition, kit and detection method for detecting mutation of isoniazide drug-resistant gene of mycobacterium tuberculosis

    CN117230219A

  • Method for detecting ST11 type high-toxicity carbapenem-resistant klebsiella pneumoniae

    CN118186113A

  • Primer group and kit for rapidly detecting rhizomucor and rhizopus

    CN119530434A