Wheat quality gene TaSF3B4 and application of molecular marker thereof

By developing KASP molecular markers for the wheat quality-related gene TaSF3B4, the problem of lack of efficient gene resources and marker-assisted selection methods in wheat breeding is solved, efficient detection and tracking of wheat varieties is achieved, and the efficiency and accuracy of wheat breeding is improved.

CN120099205APending Publication Date: 2025-06-06GANSU AGRI UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510186937.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The molecular marking and application of the wheat quality-related gene TaSF3B4 has not been seen in the prior art, resulting in a lack of efficient gene resources and marker-assisted selection methods in wheat breeding.

Method used

KASP molecular markers for the SNP sites in the promoter region of the wheat quality-related gene TaSF3B4 were developed. By detecting the genotype of the SNP sites, efficient detection and tracking of the TaSF3B4 gene in wheat varieties/strains were achieved.

Benefits of technology

This molecular marker can divide wheat varieties into two haplotypes: AA and GG. Through phenotypic correlation analysis, it was found that wheat materials with AA genotype have higher starch content, drop value and weakening, providing a method for screening wheat varieties with excellent traits, and improving the efficiency and accuracy of wheat breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099205A_ABST
    Figure CN120099205A_ABST
Patent Text Reader

Abstract

The invention relates to a KASP molecular marker of a wheat quality related gene TaSF3B4 and application of the KASP molecular marker. The KASP molecular marker is KASP-TaSF3B4, and an SNP (Single Nucleotide Polymorphism) site (A / G) is detected at 248421161bp of a wheat 3B chromosome, namely, the distance between a TaSF3B4 promoter region and an initiation codon is 1127bp. According to the marker, a TaSF3B4 gene influencing the wheat quality character is obtained according to a way that differentially expressed genes in 15d transcriptome data of a grain extreme material are extremely remarkably enriched to a spliceosome, and regular SNP loci exist through sequence comparison and analysis of the TaSF3B4 genes in different varieties and upstream and downstream sequences of the TaSF3B4 genes. The functional KASP molecular marker of the wheat poly (adenylic acid binding protein) gene TaSF3B4 provided by the invention can be used for identifying whether TaSF3B4 excellent alleles exist in wheat varieties / strains or not, and can be applied to assisted selective breeding and pyramiding breeding of other genes related to known quality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant bioengineering, and specifically relates to a molecular marker of a wheat quality-related gene TaSF3B4 and an application thereof. Background Art

[0002] Wheat (Triticum aestivum L.) is one of the earliest domesticated crops and feeds 40% of the world's population. Wheat is one of the most important staple crops in the world and an indispensable source of energy and nutrition for humans. With the improvement of the quality of life, people's demand for healthy diet is getting higher and higher, and nutritional quality has become a hot topic in wheat research.

[0003] High-yield wheat breeding is a process of continuously aggregating excellent haplotypes of different yield genes. In the wheat breeding process, by screening out excellent genotypes related to key agronomic and physiological traits, wheat genetic gain is carried out, and finally excellent high-yield wheat varieties are bred. However, in the traditional wheat breeding process, it relies too much on experience and phenotypes, and the probability of excellent varieties appearing is low due to differences in environment and selection criteria. There are a large number of allele variations in wheat germplasm. Studying haplotypes in the genome of polyploid plants can reveal the evolutionary process of crops and their breeding history. Using haplotype-dominated breeding methods, new haplotypes can be discovered and their phenotypic phenomena can be tracked to maximize the genetic benefits in the breeding program. Therefore, molecular marker-assisted selection breeding, as a highly effective and low-cost genetic improvement method, greatly reduces the uncertainty of breeding by accurately locating target genes.

[0004] Wheat quality is the key to determine the value and final use of wheat. Developing molecular markers related to quality traits and conducting marker-phenotypic trait association analysis will provide genetic resources for wheat genetic improvement and improve the efficiency of excellent gene aggregation. Therefore, the development of functional markers using allele variation will provide a basis for marker-assisted selection breeding and provide efficient assistance for the effective use of wheat germplasm resources. The prior art has not yet seen the molecular marker of wheat quality-related gene TaSF3B4 and its application. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides a molecular marker of wheat quality-related gene TaSF3B4 and its application. In order to achieve the above-mentioned object, the present invention adopts the following technical scheme:

[0006] 1. Application of the molecular marker TaSF3B4 of wheat quality-related gene in assisted breeding, wherein the molecular marker includes the AA type shown in the sequence list SEQ ID No.1, wherein the 28th position is A; and the GG type shown in SEQ ID No.2, wherein the 28th position is G; and the following method is used to realize assisted breeding:

[0007] (1) Extract DNA from the offspring of natural wheat populations, amplify with primers, and perform genotyping on the products;

[0008] (2) Determine the genotype by detecting the fluorescent signal of the amplified product. If the product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.1, the genotype of the wheat SNP marker to be tested is AA; if the product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.2, the genotype of the wheat SNP marker to be tested is GG;

[0009] (3) Wheat genotyped as AA type is a variety with high starch content, falling number, and weakening degree.

[0010] 2. Application of molecular marker TaSF3B4 related to wheat quality in assisted breeding, the primer sequence includes:

[0011] KASP-TaSF3B4-F1: GAAGGTCGGAGTCAACGGATTAGCTGATAGTAAC TCTATGGG CTATCTA; KASP-TaSF3B4-R: AAACATGTGAGTTGTCACTGGAAAT;

[0012] KASP-TaSF3B4-F2: GAAGGTGACCAAGTTCATGCTGCTGATAGTAACTC TATGGGC TATCTG; KASP-TaSF3B4-R: AAACATGTGAGTTGTCACTGGAAAT.

[0013] 3. Application of the wheat quality-related gene TaSF3B4 molecular marker in assisted breeding. The TaSF3B4 molecular marker is a SNP variation site located at -1127bp from the start codon in the promoter region of the gene TraesCS1A02G143500, which can be divided into two different haplotypes, AA and GG.

[0014] 4. A method for obtaining a molecular marker of the wheat quality-related gene TaSF3B4, the method being specifically as follows: (1) extracting wheat DNA, (2) detecting SNP sites, and (3) data analysis.

[0015] 5. The wheat quality-related gene TaSF3B4 gene, whose gene ID is TraesCS1A02G143500, was enriched by transcriptome data of grains from two extreme materials 15 days after flowering. Quantitative verification proved that the expression level was the highest 15 days after flowering, and there was a difference in the expression level between the two materials.

[0016] Beneficial effects: The present invention provides a molecular marker of wheat quality-related gene TaSF3B4, which is a KASP molecular marker developed for the SNP site in the promoter region of the weight measurement gene TaSF3B4, and can efficiently detect and track the TaSF3B4 gene in wheat varieties / lines. The molecular marker can be used to screen and / or identify wheat varieties with excellent traits, and is used in wheat assisted breeding. The present invention performs genotyping and phenotypic association analysis on 157 wheat germplasm resources materials in different provinces in China and 2 in the United States. The results show that the TaSF3B4-KASP molecular marker can divide different varieties of wheat into two haplotypes: haplotype TaSF3B4-Hap1 and haplotype TaSF3B4-Hap2. The genotype of haplotype TaSF3B4-Hap1 is AA, and the genotype of haplotype TaSF3B4-Hap2 is GG. Combined with the phenotypic data, the materials of different genotypes were subjected to association analysis, and it was found that the starch content, falling number and weakening degree of the wheat material with AA genotype were significantly greater than those of the wheat material with GG genotype. It shows that the genotype AA is an excellent allele variation, which has a positive effect on the starch content, falling number and attenuation degree of wheat. In the breeding process, the aggregation of favorable mutant alleles is consistent with the result of increased yield in the crop breeding process, so the present invention provides TaSF3B4-KASP molecular markers that can efficiently detect and track the TaSF3B4 gene in wheat varieties / lines, providing technical support for improving high-quality wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 These are the transcriptome analysis results of grains of two extreme materials at 15DAF after flowering.

[0018] Figure 2 This is the expression analysis of TaSF3B4 in the present invention at 0, 5, 10, 15, 20, and 25 DAF after flowering in two extreme materials, *P<0.05; **P<0.01; ***P<0.001.

[0019] Figure 3 It is the distribution of SNP sites in the coding region and promoter region of TaSF3B4 gene.

[0020] Figure 4 The results of genotyping wheat germplasm resources in different wheat regions of my country using the TaSF3B4 gene KASP marker primer set. The scattered dots in the upper left box represent the HEX allele A, and the scattered dots in the lower right box represent the FAM allele G.

[0021] Figure 5The correlation between TaSF3B4-Hap1 and TaSF3B4-Hap2 and protein content, starch content, ash content, falling number, weakening degree and wet gluten in 159 wheat materials under three environmental conditions; E1-E3 are Tongwei (35°11'N, 105°19'E, 1750m above sea level), Zhuanglang (35°21'N, 105°58'E, 2110m above sea level), and Zhongliang (34°34'N, 105°53'E, 1550m above sea level) in Gansu in 2022. *P<0.05; **P<0.01.

[0022] Figure 6 This is the geographical distribution of the two genotype wheat germplasm resources of TaSF3B4 in the present invention in the main wheat-growing areas of my country.

[0023] Figure 7 The two genotype sequences of TaSF3B4 are shown in Figure 1. The underlined sequence is the sequence amplified by the KASP marker primer, and the box is the SNP site. DETAILED DESCRIPTION

[0024] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0025] Example 1

[0026] This example provides a wheat quality-related gene TaSF3B4, which is as follows:

[0027] 1. Transcriptome analysis of two extreme materials

[0028] 1.1 Transcriptome material sampling

[0029] The dominant grains in the middle of the ear were sampled from 30 wheat materials with extremely full grains and grain defects at 0, 10, 15, 20, and 25 days after flowering. The 15 materials with full grains and 15 materials with grain defects at each period were mixed evenly, and each sample was biologically replicated 3 times. The 30 samples were quickly frozen with liquid nitrogen and stored in a -80℃ refrigerator for total RNA extraction.

[0030] 1.2 RNA-seq sequencing

[0031] Total RNA was extracted using TRIzol reagent according to the instructions. RNA purity and quantification were identified using a NanoDrop 2000 spectrophotometer (ThermoScientific, USA), and RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Transcriptome libraries were constructed using the VAHTS Universal V6 RNA-seq Library Prep Kit according to the instructions. The library was sequenced using the Illumina Novaseq 6000 sequencing platform and 150 bp paired-end reads were generated. Fastp software was used to process raw reads in fastq format, and clean reads were obtained after removing low-quality reads for subsequent data analysis. HISAT2 software was used for reference genome alignment and gene expression (FPKM) calculation, and HTSeq-count was used to obtain read counts for each gene. PCA analysis and plotting of genes (counts) were performed using R (v 3.2.0) to evaluate sample biological repeats. Transcriptome sequencing and analysis were performed by Shanghai Ouyi Biotechnology Co., Ltd. (Shanghai, China).

[0032] 2. qRT-PCR analysis of TaSF3B4 gene

[0033] Grains of the two extreme materials were collected at 0, 5, 10, 15, 20 and 25 days after flowering to obtain samples. Total RNA was extracted from the collected samples using the Plant Tissue RNA Rapid Extraction Kit, and the RNA concentration was determined using an ultramicrophotometer. The first-chain cDNA was synthesized using the FastKing gDNA isolation method (Beijing). FastReal qPCR PreMix (SYBRGreen) was used to detect the changes in the relative expression of the TaSF3B4 gene in different tissues by qRT-PCR analysis. Wheat tissue development expression analysis was performed using wheat TaGADPH as an internal reference gene (refer to L. Guo et al., 2022).

[0034] The PCR reaction system was 20 μL, including 10 μL FastReal qPCR PreMix (SYBR Green), 0.6 μL each of forward primer and reverse primer, 2 μL cDNA and 6.8 μL ddH 2 O. PCR conditions were 95°C, 2 min; 95°C, 5 s, 58°C, 10 s, 72°C, 15 s (collecting fluorescence), 40 cycles.

[0035] The primers used for qRT-PCR are shown in Table 1. -ΔΔCT Methods The relative expression level of the TaSF3B4 gene was calculated (see Schmittgen & Livak, 2008). All quantifications were performed in 3 biological replicates.

[0036] Table 1 Primer information

[0037] Gene name Forward primer Reverse primer TaSF3B4 ACCTACGTCGGCAACCTC GGAGTGAGGAAGATGCAGATTAT TaGADPH CCTTCCGTGTTCCCACTGTTG ATGCCCTTGAGGTTTCCCTC

[0038] The expression level of TaSF3B4 in the grains at 0, 5, 10, 15, 20, and 25 days after anthesis was determined by qRT-PCR. Figure 3 qRT-PCR results showed that the expression level of TaSF3B4 in grains at different stages after flowering first increased and then decreased, and showed significant differences in the two extreme materials at 15DAF, suggesting that it plays a potential role in grain development.

[0039] Example 2

[0040] This example provides a molecular marker for wheat quality-related gene TaSF3B4, which is as follows:

[0041] Wheat quality-related gene TaSF3B4 encodes a polyadenylate binding protein with two RRM domains at its N-terminus. The RRM domain is involved in mRNA translation to form proteins. According to the analysis of 677 hexaploid wheat resequencing data from the Wheat Genome Variation Union Database (http: / / wheat.cau.edu.cn / WheatUnion / ), it was found that the TaSF3B4 gene has multiple SNP variation sites in the promoter region, coding region and intron, which can be divided into two different haplotypes ( Figure 4 ).

[0042] The KASP molecular marker for wheat quality-related gene TaSF3B4 in this embodiment is located in the promoter region at -1127 bp from the start codon. The KASP marker primer set includes:

[0043] KASP-TaSF3B4-F1: GAAGGTCGGAGTCAACGGATTAGCTGATAGTAAC TCTATGGG CTATCTA; KASP-TaSF3B4-R: AAACATGTGAGTTGTCACTGGAAAT;

[0044] KASP-TaSF3B4-F2: GAAGGTGACCAAGTTCATGCTGCTGATAGTAACTC TATGGGC TATCTG; KASP-TaSF3B4-R: AAACATGTGAGTTGTCACTGGAAAT.

[0045] As shown in the sequence list SEQ No. 1 and SEQ No. 2, the promoter region of TaSF3B4 was used to develop the SNP site and its nearby sequence information (±100bp) for KASP marker development, and the underlined sequence is the KASP marker primer amplification sequence.

[0046] SEQ No. 1 shows the molecular marker AA type amplification sequence, and the 28th is A. As shown in the sequence list SEQ No. 2 is the molecular marker

[0047] GG type amplification sequence, the 28th position is G.

[0048] Example 3

[0049] This example provides a method for obtaining a molecular marker of wheat quality-related gene TaSF3B4, which is as follows:

[0050] 1. Extraction of Wheat DNA

[0051] The CTAB method was used to extract DNA from leaves of wheat seedlings at the two-leaf, one-heart stage. Several DNA working solutions were randomly selected and the concentration was measured using NanoDrop2000. An A260 / A280 ratio of about 1.8 indicated that the sample quality was qualified.

[0052] 2.SNP site detection

[0053] A PCR reaction system including two temperature steps is used: DNA is denatured at a higher temperature, and then annealed and extended at a lower temperature. PCR amplification can be performed on any suitable PCR gene amplifier. The PCR reaction system is: 2xTaq DNA Polymerase Mix 2μL, SNP Primer Mix (4x) 1μL, DNA 2μL. The PCR amplification system is: (1) 94℃, 15min; (2) 94℃, 20s; 61~55℃, decreasing by 0.6℃ per cycle; 10 cycles in total; (3) 94℃, 20s; 55℃, 45s, 37 cycles. After the PCR amplification cycle is completed, the fluorescence value is read using the OMEGA SNP typing instrument. In this method, SNP site detection uses the fluorophores FAM (excitation light 485nm, emission light 520nm) and VIC (excitation light 535nm, emission light 556nm) to distinguish two isogenic sites. The passive reference dye ROX (excitation light 575 nm, emission light 610 nm) was used to correct the signal difference between wells due to reaction volume errors.

[0054] 3. Data Analysis

[0055] The data were analyzed using the genotype reading software Kluster Caller, in which VIC and FAM data were plotted on the x-axis and y-axis, respectively. The VIC and FAM values ​​of each reaction well were corrected by the value of the reference dye (ROX) of that specific well, and the data fluorescence values ​​were standardized to obtain the relative fluorescence values ​​corresponding to VIC and FAM of each PCR reaction well. Based on the relative fluorescence values, the samples were clustered, and the genotypes were further determined based on the sample clusters and fluorescence types.

[0056] Example 4

[0057] This example provides the application of the molecular marker TaSF3B4 related to wheat quality, as follows:

[0058] 1. 159 wheat germplasm resources from different ecological zones in my country were used in Table 1. The materials were planted in the Tongwei County Experimental Station (E1) in Gansu Province, the Nanhu Experimental Station (E2) in Zhuanglang County, Gansu Province, and the Zhongliang Town Experimental Station (E3) in Tianshui City, Gansu Province in 2021-2022. The field experiment adopted a randomized block experiment with 3 replicates. Each material was planted in 3 rows, with a row spacing of 20 cm and a row length of 1 m, and 20 seeds were planted in each row.

[0059] 2. After the wheat grains matured, 5 plants were randomly sampled in each environment for threshing. After the grains were air-dried, the protein content, starch content, ash content, sedimentation coefficient, wet gluten and weakening degree of the wheat grains were determined using 1. The phenotypic value was the average of 3 repetitions. The specific data are shown in Table 1.

[0060] 3. Using the TaSF3B4 molecular marker provided in Example 2 and the method provided in Example 3, the TaSF3B4 genotypes of wheat germplasm resources in different ecological zones were analyzed. The typing results are as follows: Figure 4 The single-factor ANOVA method using Excel (2016) software was used to analyze whether there were significant differences in protein content, starch content, ash content, sedimentation coefficient, wet gluten and weakening degree among wheat varieties with different genotypes. The results are shown in Figure 5 Specific data are shown in Table 1.

[0061] Figure 6 The main wheat-growing areas in my country (Henan, Shaanxi, Shanxi, Shandong, Hebei, etc.) are shown. The materials with AA genotype occupy a major position. The specific geographical information of wheat germplasm resources is shown in Table 2. The information sources are "The First Industry Approved Variety Information Query" and Zhuang Qiaosheng's "China Wheat Variety Improvement and Pedigree Analysis".

[0062] Table 1 Grain quality phenotype data of two haploid wheat germplasm resources in different ecological zones

[0063]

[0064]

[0065] Table 2 Geographical release of wheat germplasm resources

[0066] area TaSF3B4-Hap1 quantity TaSF3B4-Hap2 quantity Beijing 14 1 Gansu 58 0 Hebei 15 1 Henan 8 1 Heilongjiang 1 0 USA 1 1 Qinghai 0 2 Shandong 3 6 Shanxi 31 0 Shaanxi 9 3 Tianjin 2 0 Xinjiang 2 0

[0067] The results showed that the dominant varieties of TaSF3B4-Hap1 were distributed in Gansu (100%), Shanxi (100%), Hebei (94%) and Beijing (93%), which are the main wheat producing areas in China.

[0068] The above is only a specific implementation of the present application. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present application, and these should also be regarded as the scope of protection of the present application.

Claims

1. Application of molecular marker TaSF3B4 of wheat quality gene in assisted breeding, characterized in that The molecular markers include the AA type shown in the sequence table SEQ ID No. 1, whose 28th position is A; the GG type shown in SEQ ID No. 2, whose 28th position is G; and the molecular markers are used to implement assisted breeding in the following method: (1) Extract DNA from the offspring of natural wheat populations, amplify with primers, and perform genotyping on the products; (2) Determine the genotype by detecting the fluorescent signal of the amplified product. If the product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.1, the genotype of the wheat SNP marker to be tested is AA; if the product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.2, the genotype of the wheat SNP marker to be tested is GG; (3) Wheat genotyped as AA is a variety with high starch content, falling number, and weakening degree.

2. The application of the wheat quality gene TaSF3B4 molecular marker in assisted breeding according to claim 1, characterized in that The primer sequences include: KASP-TaSF3B4-F1: GAAGGTCGGAGTCAACGGATTAGCTGATAGTAAC TCTATGGG CTATCTA; KASP-TaSF3B4-R: AAACATGTGAGTTGTCACTGGAAAT; KASP-TaSF3B4-F2: GAAGGTGACCAAGTTCATGCTGCTGATAGTAACTC TATGGGC TATCTG; KASP-TaSF3B4-R: AAACATGTGAGTTGTCACTGGAAAT.

3. The application of the wheat quality-related gene TaSF3B4 molecular marker in assisted breeding according to claim 1, characterized in that The TaSF3B4 molecular marker is a SNP variation site located at -1127 bp from the start codon in the promoter region of the gene TraesCS1A02G143500, and can be divided into two different haplotypes, AA and GG.

4. A method for obtaining a molecular marker of wheat quality-related gene TaSF3B4, characterized in that The method is specifically as follows: (1) extracting wheat DNA, (2) detecting SNP sites, and (3) data analysis.

5. Wheat quality-related gene TaSF3B4 gene, characterized in that The gene ID is TraesCS1A02G143500. The gene is enriched by transcriptome data analysis of grains of two extreme materials 15 days after flowering. Quantitative verification proves that the expression level is the highest 15 days after flowering, and there is a difference in the expression level between the two materials.

Citation Information

Cited By

  • Functional molecular marker of wheat TaUFD1-3B gene and application of functional molecular marker

    CN120945117A