InDel molecular marker closely linked with major QTL (Quantitative Trait Loci) of fruit shape index of pumpkin fruit and application of InDel molecular marker

By developing InDel molecular markers closely linked to the main effect QTL of the pumpkin fruit shape index, the problem of difficult to efficiently judge the pumpkin fruit shape index in the existing technology is solved, and the efficiency and accuracy of pumpkin fruit shape detection is achieved, and the efficiency of the appearance quality breeding of pumpkin fruits is improved.

CN120099206AActive Publication Date: 2025-06-06FOSHAN UNIVERSITY +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510269380.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-06-06
Estimated Expiration
2045-03-07

AI Technical Summary

Technical Problem

The existing technology is difficult to efficiently judge the fruit shape index of pumpkin fruits, which leads to a large amount of manpower and material resources required during subsequent planting, which is relatively inefficient.

Method used

An InDel molecular marker closely linked to the main effect QTL of the pumpkin fruit shape index was developed. By detecting InDel sites specific to the chromosome 14 of the Chinese pumpkin genome, corresponding amplification primers were designed to achieve efficient detection of the shape of the pumpkin fruit.

Benefits of technology

Through the application of InDel molecular marker, the fruit shape index of pumpkin fruit can be efficiently and accurately judged, the efficiency of the appearance quality selection of pumpkin fruits can be improved, and the manpower, material resources and financial resources for planting non-target breeding resources can be reduced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099206A_ABST
    Figure CN120099206A_ABST
Patent Text Reader

Abstract

The invention discloses an InDel molecular marker closely linked with a pumpkin fruit shape index major QTL and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is as shown in SEQ ID NO: 1. The method comprises the following steps: by taking DNA (Deoxyribonucleic Acid) of a pumpkin to be detected as a template, carrying out PCR (Polymerase Chain Reaction) amplification by adopting primers with sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 3; if the strip size of the amplification product is 233bp, the pumpkin to be detected is a flat pumpkin, and if the strip size of the amplification product is 205bp, the pumpkin to be detected is an oval pumpkin. The Indel molecular marker and the amplification primer thereof can be applied to detection of the fruit shape index of the pumpkin fruit, the fruit shape index of the pumpkin fruit can be efficiently and accurately judged, the breeding efficiency of the appearance quality of the pumpkin fruit is improved, and planting manpower, material resources and financial resources of non-target breeding resources are reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of crop genetic breeding, and in particular relates to an InDel molecular marker tightly linked to a major effect QTL of a pumpkin fruit shape index and an application thereof. Background Art

[0002] Pumpkin (Cucurbit moschata) is one of the important melon crops in the Cucurbitaceae family. It plays an important role in the dietary structure of residents and has broad market prospects and important economic value.

[0003] As one of the main appearance qualities of pumpkin, the shape of the fruit is very diverse, such as flat, oblate, oval, long tube, etc. The fruit shape index is the ratio of the longitudinal diameter to the transverse diameter of the mature fruit, which can be used to describe the shape characteristics of the fruit. The larger the fruit shape index, the more slender the fruit, and the smaller the fruit shape index, the flatter the fruit.

[0004] In the past, the judgment of fruit shape needed to rely on data measurement and visual description of mature fruits, which required a large amount of planting area screening. Through genotype judgment, the fruit shape index of fruits can be efficiently judged in the seedling stage, reducing the manpower and material resources for subsequent planting, and greatly improving efficiency.

[0005] Therefore, it is necessary to deeply explore and utilize molecular markers that are closely linked to the major effect QTL of pumpkin fruit shape index to accelerate the process of pumpkin molecular breeding. Summary of the invention

[0006] Based on this, the object of the present invention is to provide a molecular marker tightly linked to the major effect QTL of pumpkin fruit shape index.

[0007] The specific technical solutions for achieving the above-mentioned invention objectives include the following.

[0008] In a first aspect of the present invention, an InDel molecular marker tightly linked to a major QTL of pumpkin fruit shape index is provided for use in detecting pumpkin fruit shape. The InDel molecular marker is located in the 426937-526389 segment on chromosome 14 of the Chinese pumpkin genome, and the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO: 1.

[0009] In a second aspect of the present invention, a kit for detecting pumpkin fruit shape is provided, comprising a reagent for detecting an InDel molecular marker tightly linked to a major effect QTL of pumpkin fruit shape index, wherein the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO:1.

[0010] The third aspect of the present invention provides a method for detecting pumpkin fruit shape, comprising: detecting the InDel molecular marker whose nucleotide sequence is tightly linked to the major effect QTL of pumpkin fruit shape index as shown in SEQ ID NO:1.

[0011] The inventors of the present invention obtained F by crossing a pumpkin resource with a flat fruit and an oval fruit as parents. 1 , F 1 Self-fertilization F 2 Genetically segregating population, combining parents, F 2 The genotype and phenotype of individual plants were analyzed, and the main effect QTL of fruit shape index was located in the 99.452kb (426937-526389) segment on chromosome 14 of Chinese pumpkin. An InDel site was found in the localization interval. 2 The InDel locus was detected in 30 Chinese pumpkin germplasm resources, and the phenotype-genotype consistency rate exceeded 80%. Therefore, the Indel molecular marker and its amplification primer can be applied to the detection of pumpkin fruit shape index, which can efficiently and accurately determine the pumpkin fruit shape index, improve the efficiency of pumpkin fruit appearance quality breeding, and reduce the planting manpower, material and financial resources of non-target breeding resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The diagrams are of fruits of two parents of the present invention, wherein the left diagram is the female parent P1 and the right diagram is the male parent P2.

[0013] Figure 2 This is the location of the main effect QTL of the fruit shape index of pumpkin fruit in Example 1 of the present invention. The horizontal axis is the position of the linkage group, the vertical axis represents the LOD value, the red dotted line represents the threshold of LOD (p value is less than 0.05), and the area above the dotted line represents significant association.

[0014] Figure 3 The polyacrylamide gel electrophoresis diagram of the genotype detection of two parents and F1 using amplification primers in Example 1 of the present invention; wherein the first lane is the marker, the second lane is the maternal P1, the third lane is the paternal P2, and the fourth lane is the F 1 .

[0015] Figure 4 This is part F in Example 2 of the present invention. 2 Polyacrylamide gel electrophoresis of individual strains.

[0016] Figure 5This is a polyacrylamide gel electrophoresis diagram of genotype detection of 30 Chinese pumpkin germplasm resources using amplification primers marked with InDel molecules in Example 3 of the present invention; wherein the first lane is a marker, and the last three lanes from left to right are maternal P1, paternal P2, F 1 , the middle lanes represent different Chinese pumpkin germplasm resources. DETAILED DESCRIPTION

[0017] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0018] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0019] Unless otherwise specified, the examples are based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2013), or the conditions recommended by the manufacturer's instructions.

[0020] In the present invention, the F cultivar is obtained by hybridizing a squash resource having a flat fruit and an oval fruit as parents. 1 , F 1 Self-fertilization F 2 Genetically segregating populations, constructing high-density linkage genetic maps, combining parental, F 2 The genotype and phenotype of individual plants located the main effect QTL of fruit shape index in the 99.452kb (426937-526389) segment on chromosome 14 of Chinese pumpkin, and the phenotypic contribution rate of this QTL was 31.439%. Further, based on the genome resequencing information of the two parents, an InDel site was found and screened in the positioning interval. The site was AGTTGCATTTCCA TTAGATGATAAAAGTT in the flat pumpkin resources (fruit shape index less than 0.5), and the amplified band size was 233bp; in the oval pumpkin resources (fruit shape index greater than 1), it was A, and the amplified band size was 205bp; in F1, two bands of 205bp and 233bp were amplified simultaneously. Primers were designed based on the InDel site and cloned in the two parents, F 2In 113 strains F 2 Among the individual plants, the genotype of 93 individual plants was consistent with the phenotype value of the fruit shape index, and the accuracy rate of judging the phenotype by genotype was about 82.3%. Using primers designed according to the InDel site, 30 Chinese pumpkin germplasm resources were genotyped at the seedling stage, and the subsequent statistics of the fruit shape index showed that the phenotype-genotype consistency rate was 90%. Therefore, the Indel molecular marker and its amplification primer can be applied to the detection of pumpkin fruit shape index.

[0021] In some embodiments of the present invention, an InDel molecular marker tightly linked to the major QTL of pumpkin fruit shape index is used in detecting pumpkin fruit shape. The InDel molecular marker is located in the 426937-526389 segment on the 14th chromosome of the Chinese pumpkin genome, and the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO: 1.

[0022] In other embodiments of the present invention, a kit for detecting pumpkin fruit shape is disclosed, comprising a reagent for detecting an InDel molecular marker tightly linked to a major QTL of pumpkin fruit shape index, wherein the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO:1.

[0023] In some embodiments, the reagents include: primers whose sequences are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0024] In other embodiments of the present invention, a method for detecting pumpkin fruit shape is disclosed, comprising: detecting the InDel molecular marker whose nucleotide sequence is tightly linked to the major effect QTL of pumpkin fruit shape index as shown in SEQ ID NO:1.

[0025] In some embodiments, the detection is performed by PCR.

[0026] In some of the embodiments, the sequences of the primers used in the PCR method are shown as SEQ ID NO:2 and SEQ ID NO:3.

[0027] In some embodiments, the method for detecting the shape of a pumpkin fruit comprises the following steps:

[0028] (1) extracting DNA from the pumpkin to be tested;

[0029] (2) using the DNA extracted in step (1) as a template, and performing PCR amplification using primers with sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 3;

[0030] (3) Gel electrophoresis detection: If the band size of the amplified product is 233 bp, the pumpkin to be tested is a flat pumpkin; if the band size of the amplified product is 205 bp, the pumpkin to be tested is an oval pumpkin.

[0031] In some embodiments, the reaction system of the PCR method includes: Taq HiFi PCR MIX, template DNA, and primers whose sequences are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0032] In some embodiments, the PCR reaction system includes: 9 μL to 11 μL Taq HiFi PCR MIX, 0.9 μL to 1.1 μL primers, 1.5 μL to 2.5 μL DNA template, and ddH 2 0 to 20 μL.

[0033] In some embodiments, the reaction procedure of the PCR method includes: 95°C, 3 min; 94°C, 25 s, 54.7°C, 25 s, 72°C, 15 s, 35 cycles; 72°C, 5 min.

[0034] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0035] Example 1 Location of the major QTL for pumpkin fruit shape index and development of InDel molecular markers

[0036] The flat-fruit pumpkin resource (female parent P1) and the oval-fruit pumpkin resource (male parent P2) selected and preserved by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences were used as parents ( Figure 1 ), the two parents are crossed to obtain F 1 , F 1 Self-fertilization to obtain F 2 Separate groups.

[0037] In 2023, using two parents and 200 F 2 A high-density genetic linkage map was constructed by developing SNP markers through whole-genome resequencing. The final map had a total distance of 2538.269 cM and contained 20 linkage groups. 2 The fruit shape index of the population was phenotypically identified. 2 The results of individual plant phenotypic identification showed that the major QTL controlling the fruit shape index was located in the 99.452 kb (426937-526389) segment on chromosome 14 of Chinese pumpkin (http: / / cucurbitgenomics.org / ftp / genome / Cucurbita_moschata / v1 / ), and the phenotypic contribution rate of this QTL was 31.439% ( Figure 2).

[0038] Whole genome resequencing was performed on both parents to obtain InDel sites in the entire gene range. Within the main effect QTL positioning interval, an InDel molecular marker site with obvious polymorphism (located at 452908) was screened. In the maternal parent P1, the nucleotide sequence of this site was AGTTGCATTTCCATTAGATGATAAAAG TT, and in the paternal parent P2, this site was A.

[0039] According to the upstream and downstream sequences of the InDel molecular marker site (AGTTGCATTTCCATTAGATGATAAAAGTT, SEQ ID NO: 1), primers (including upstream primer F and downstream primer R) were designed, and then the primer pair was used to amplify the two parents, F 1 Perform genotyping.

[0040] Upstream primer F (SEQ ID NO: 2): ACAATTCTGGACAATGGAGAGCG

[0041] Downstream primer R (SEQ ID NO: 3): ACCGGTAAAGTTTGAACACGTAA

[0042] PCR amplification system 20 μL: 2xTaq HiFi PCR MIX 10 μL, 0.5 μL upstream primer (10 μM), 0.5 μL downstream primer (10 μM), 2 μL DNA template, 7 μL ddH 2 O.

[0043] PCR amplification program: 95°C, 3 min; 94°C, 25 s, 54.7°C, 25 s, 72°C, 15 s, 35 cycles; 72°C, 5 min.

[0044] The results of polyacrylamide gel electrophoresis were as follows: Figure 3 As shown. Figure 3 The results showed that specific bands appeared between the parents. The amplified band size in the flat pumpkin resource of the female parent P1 (fruit shape index less than 0.5) was 233bp; the amplified band size in the oval pumpkin resource of the male parent P2 (fruit shape index greater than 1) was 205bp (nucleotide sequence was A); 1 Two bands of 205 bp and 233 bp were amplified simultaneously.

[0045] Example 2 InDel molecular markers of Example 1 in F 2 Verification in individual plants of the population

[0046] The InDel molecular marker amplification primers in Example 1 were used to amplify 113 strains of F2 The genotype of a random plant in the population was verified, and the genotype detection method was the same as in Example 1. Part F 2 The test results of individual plants are as follows Figure 4 shown.

[0047] from Figure 4 It can be seen that the amplified band size of the maternal parent P1 is 233 bp, the amplified band size of the paternal parent P2 is 205 bp, and the F 1 The amplified bands were 205 bp and 233 bp in size. 2 There are P1, P2 and F in the random individual plants of the population 1 Three types.

[0048] Further analysis revealed that 113 strains of F 2 Among the random plants in the population, 93 plants were F 2 The genotype of the individual plant is consistent with the phenotypic value of the fruit shape index, so the accuracy of judging the phenotype by genotype is about 82.3%. Among them, 17 plants with amplified bands of 233bp have a fruit shape index less than 0.5; 23 plants with amplified bands of 205bp have a fruit shape index greater than 1; and 53 plants with amplified bands of 205bp and 233bp have a fruit shape index of 0.5 to 1. It can be seen that the InDel molecular markers and amplification primers of Example 1 can well type the individual plants of the parents and genetic separation groups.

[0049] Example 3 Practical application of the InDel molecular marker of Example 1

[0050] In the autumn of 2024, the InDel molecular marker amplification primers in Example 1 were used to perform genotype detection on 30 Chinese pumpkin germplasm resources (different from the maternal parent P1 and the parent P2) collected, preserved and created by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences to determine the fruit shape index of Chinese pumpkin type germplasm resources. The specific method of genotype detection is the same as in Example 1. The results are as follows Figure 5 shown.

[0051] Among the 30 germplasm resources, 11 were detected with an amplified band of 233bp, 18 were detected with an amplified band of 205bp, and 1 was detected with amplified bands of 233bp and 205bp. According to the numerical statistics of the fruit shape index of mature fruits, the genotypes of 27 germplasm resources were consistent with the fruit shape index phenotype, and the consistency rate between phenotype and genotype was 90%.

[0052] It can be seen that the use of the InDel molecular markers of the present invention can efficiently and accurately determine the fruit shape index of pumpkin fruit, thereby improving the efficiency of pumpkin fruit appearance quality breeding.

[0053] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0054] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of an InDel molecular marker tightly linked to the main effect QTL of pumpkin fruit shape index in detecting pumpkin fruit shape, characterized in that: The InDel molecular marker is located in the 426937-526389 segment on the 14th chromosome of the Chinese pumpkin genome, and the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO:

1.

2. A kit for detecting pumpkin fruit shape, characterized in that: The invention comprises a reagent for detecting an InDel molecular marker which is closely linked to a major effect QTL of fruit shape index of pumpkin fruit, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO:

1.

3. The test kit for detecting pumpkin fruit shape according to claim 2, characterized in that: The reagents include primers with sequences as shown in SEQ ID NO: 2 and SEQ ID NO:

3.

4. A method for detecting the shape of pumpkin fruit, characterized in that: include: Detect the InDel molecular marker whose nucleotide sequence according to claim 1 is tightly linked to the major effect QTL of pumpkin fruit shape index as shown in SEQ ID NO:

1.

5. The method for detecting pumpkin fruit shape according to claim 4, characterized in that: The detection adopts PCR method.

6. The method for detecting pumpkin fruit shape according to claim 5, characterized in that: The sequences of the primers used in the PCR method are shown in SEQ ID NO:2 and SEQ ID NO:

3.

7. The method for detecting pumpkin fruit shape according to claim 6, characterized in that: The following steps are involved: (1) extracting DNA from the pumpkin to be tested; (2) using the DNA extracted in step (1) as a template, and performing PCR amplification using primers with sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 3; (3) Gel electrophoresis detection: If the band size of the amplified product is 233 bp, the pumpkin to be tested is a flat pumpkin; if the band size of the amplified product is 205 bp, the pumpkin to be tested is an oval pumpkin.

8. The method for detecting pumpkin fruit shape according to any one of claims 4 to 7, characterized in that: The reaction system of the PCR method includes: Taq HiFi PCR MIX, template DNA, and primers whose sequences are shown in SEQ ID NO: 2 and SEQ ID NO:

3.

9. The method for detecting pumpkin fruit shape according to claim 8, characterized in that: The reaction system of the PCR method includes: 9 μL to 11 μL Taq HiFi PCR MIX, 0.9 μL to 1.1 μL primers, 1.5 μL to 2.5 μL DNA template, and ddH2O added to 20 μL.

10. The method for detecting pumpkin fruit shape according to any one of claims 4 to 7, characterized in that: The reaction procedure of the PCR method includes: 95°C, 3 min; 94°C, 25 s, 54.7°C, 25 s, 72°C, 15 s, 35 cycles; 72°C, 5 min.

Citation Information

Patent Citations

  • SNP (single nucleotide polymorphism) molecular markers closely linked to pumpkin lutein content major QTL (quantitative trait loci) and application of SNP molecular markers

    CN107142315A

  • Molecular marker for distinguishing sizes of pumpkin fruits, identification method and application

    CN116162721A

  • KASP molecular marker for pumpkin fruit length character and application of KASP molecular marker

    CN117887895A