SSR molecular marker related to rice fertility, primer pair and application of SSR molecular marker
By providing SSR molecular markers and primer pairs for detecting hybrid sterility genes in rice indica-indica subspecies, the problem of hybrid sterility phenomenon in indica subspecies was solved, effective methods for identifying rice fertility, and guiding the utilization of hybrid advantages in indica subspecies.
Patent Information
- Application Number
- CN202510346172.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-24
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-03-24
AI Technical Summary
Due to the genetic diversity within the indica subspecies, hybrid infertility has been restricted, which has limited the further utilization of hybrid advantages in the subspecies, and it is difficult to effectively guide the utilization of hybrid advantages in the indica subspecies.
A pair of SSR molecular markers and primer related to rice fertility is provided to detect whether there are hybrid sterile genes in the indica-indica subspecies and guide the parental selection of hybrid dominant utilization within the rice indica subspecies.
By localizing and screening molecular markers closely linked to the hybrid sterile gene S68, rice breeding can be effectively identified, and hybrid advantage utilization within the indica-indica subspecies can be guided, and rice breeding efficiency can be improved.
Smart Images

Figure CN120099215A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of rice breeding, and in particular to an SSR molecular marker related to rice fertility, a primer pair and an application thereof. Background Art
[0002] In recent years, due to breeders' preference for parent selection, the genetic basis between rice varieties has become increasingly narrow, which has led to a stagnant rice yield. Due to its wide geographical distribution and the influence of long-term artificial selection, Asian cultivated rice has formed rich genetic diversity and population differentiation characteristics. Indica rice is the most important subspecies of Asian cultivated rice and plays an extremely important role in promoting the process of rice breeding. In the 1950s and 1960s, the mining and breeding of semi-dwarf genes in indica rice increased rice yield by about 20%; in the 1970s, the use of hybrid vigor within indica-indica subspecies increased rice yield by about 20%. Therefore, fully tapping the potential of hybrid vigor within indica-indica subspecies is an effective way to break through the current bottleneck of rice yield. However, since indica rice is widely distributed around the world and the direction and pressure of artificial selection are different, it has created rich genetic diversity within indica rice subspecies, and also led to hybrid sterility between different indica rice varieties, limiting the further use of hybrid vigor within subspecies. Therefore, identifying hybrid sterility genes within indica-indica subspecies of rice has practical significance for guiding the utilization of hybrid advantages within indica subspecies. Summary of the invention
[0003] The purpose of the present invention is to provide an SSR molecular marker, a primer pair and an application thereof related to rice fertility, so as to solve the problems existing in the above-mentioned prior art. The SSR molecular marker and the primer pair provided by the present invention can be used to detect whether the hybrid sterility gene exists in the indica-indica subspecies, and the present invention has important guiding and practical significance for the parent selection for the utilization of hybrid vigor in the indica subspecies of rice.
[0004] To achieve the above object, the present invention provides the following solutions:
[0005] The present invention provides an SSR molecular marker related to rice fertility. The SSR molecular marker is obtained by amplifying a forward primer having a nucleotide sequence as shown in SEQ ID NO.11 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.12.
[0006] Preferably, the rice is an indica-indica intra-subspecies hybrid, i.e., a hybrid of an indica rice variety and an indica rice variety.
[0007] The present invention provides a primer pair for amplifying the above-mentioned SSR molecular marker, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.11 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.12.
[0008] The present invention provides the use of the primer pair in preparing a product for identifying rice fertility.
[0009] Preferably, the rice is an indica-indica intra-subspecies hybrid.
[0010] Preferably, the product comprises a reagent, a kit or a chip.
[0011] The invention provides a product for identifying rice fertility, and the product comprises the above primer pair.
[0012] Further preferably, the rice is an indica-indica intra-subspecies hybrid.
[0013] Further preferably, the product includes a reagent, a kit or a chip.
[0014] The present invention provides the use of the above-mentioned SSR molecular marker, the above-mentioned primer pair or the above-mentioned product in identifying rice fertility.
[0015] The invention provides a method for identifying rice fertility, comprising taking DNA of rice to be tested as a template, adopting the above primer pair for amplification, and determining the rice fertility according to the band pattern of the amplified product.
[0016] Preferably, when one band appears at 195-205bp or 180-190bp, the two tested rice hybrids are normal fertile rice; when one band appears at 195-205bp and 180-190bp, the two tested rice hybrids are semi-sterile rice. That is, when the band sizes of the two tested rices are the same, there is no hybrid fertility barrier between the tested rices; when the band sizes of the two tested rices are inconsistent, there is a hybrid fertility barrier between the tested rices.
[0017] The present invention discloses the following technical effects:
[0018] The present invention constructs a near isogenic line (NIL-S68) with Indian indica rice variety Swarna as donor, indica rice IR64 as recipient parent and recurrent parent and containing hybrid sterility gene S68, and hybridizes recurrent parent IR64 with NIL-S68 to obtain F 1 The pollen fertility of the recurrent parents IR64 and NIL-S68 was normal, and the F 1The plants of the first generation showed semi-sterile pollen. Then, a high-generation segregation population was cultivated by hybridization of IR64 and NIL-S68, and the hybrid sterility gene was located within the range of 190kb at the end of the short arm of the third chromosome, and molecular markers and primer pairs closely linked to the gene S68 were screened, which can be used to detect whether the hybrid sterility gene exists in the indica-indica subspecies. The present invention has important guidance and practical significance for parent selection for utilizing heterosis in indica subspecies of rice. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0020] Figure 1 The recurrent parents IR64, NIL-S68 and the hybrid F 1 Pollen fertility identification diagram; A is the plant phenotype of the recipient parent IR64; B is the hybrid F 1 The plant phenotype of the first generation; C is the plant phenotype of NIL-S68; the scale bars of AC are 10 cm; D is the pollen fertility of the recipient parent IR64; E is the hybrid F 1 The green arrows indicate normal pollen grains, and the red arrows indicate aborted pollen grains; F is the pollen fertility of NIL-S68; the scale bars in DF are 100 μm; G is the quantitative analysis results of pollen fertility and spikelet fertility; H is the analysis results of pollen germination rate;
[0021] Figure 2 The pollen cytological observation diagram in Example 1; A is the anther morphology of the recurrent parent IR64; B is the anther morphology of the hybrid F 1 The anther morphology of the first generation; C is the anther morphology of NIL-S68; the scale bars in AC are 200 μm; D is the pollen grain morphology of the recurrent parent IR64; E is the pollen grain morphology of the hybrid F 1 The green arrows indicate normal pollen grains, and the red arrows indicate aborted pollen grains; F is the pollen grain morphology of NIL-S68; the scale bars in DF are 20 μm; G is the enlarged view of the pollen grains of the recurrent parent IR64; H is the hybrid F 1 I is an enlarged view of the pollen grain of NIL-S68; the scale bars in G and I are 5 μm; J is the cross section of the pollen grain of the recurrent parent IR64; K is the cross section of the hybrid F 1The cross section of the pollen grain of the first generation; L is the cross section of the pollen grain of NIL-S68; the scale bars of JL are 5 μm; M is the pollen wall structure of the recurrent parent IR64; N is the cross section of the hybrid F 1 The pollen wall structure of the first generation; O is the pollen wall structure of NIL-S68; the scale bars in MO are all 500 nm; Ex is the pollen exine; In is the pollen intine; Te is the pollen tectum; Ne is the pollen nexine; Ba is the pollen bacula;
[0022] Figure 3 IR64 / Swarna BC in Example 1 6 F 2 Pollen fertility distribution map of the population;
[0023] Figure 4 The background and introgression of the rice 1K liquid phase chip to detect the near-isogenic line; green represents the homozygous recurrent parent IR64 genotype, blue represents the homozygous donor parent Swarna genotype, red represents the heterozygous type, and gray represents missing data; PS represents pollen semi-sterility; PF represents pollen fertility;
[0024] Figure 5 This is the correlation analysis between SSR markers and pollen fertility;
[0025] Figure 6 is the linkage map of the S68 locus in Example 1;
[0026] Figure 7 This is the electrophoresis pattern of the marker S347 used in Example 2 to detect the fertility of indica-indica hybrids; wherein, 1 is the banding pattern of the IR64 parent; 2 is the banding pattern of the Swarna parent; and 4 is the heterozygous banding pattern; the sample in the first lane is IR64, the sample in the second lane is Swarna, and the remaining lanes are the hybrid offspring populations of IR64 and NIL-S68. DETAILED DESCRIPTION
[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0028] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.
[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0032] Hybrid sterility is a complex quantitative trait controlled by multiple genes. In order to eliminate the interference of other hybrid sterility sites or genetic backgrounds, the present invention uses Indian indica rice variety Swarna as the donor parent and IR64 bred by the International Rice Research Institute as the recipient parent and recurrent parent, constructs a high-generation segregating population, identifies the hybrid sterility gene S68 acting in the indica-indica subspecies, and screens molecular markers for identifying the hybrid sterility gene S68, so as to guide the utilization of hybrid vigor in the indica-indica subspecies of rice.
[0033] Example 1
[0034] 1. Construction of near-isogenic lines containing the S68 gene
[0035] The inventors used the indica rice variety IR64 cultivated by the International Rice Research Institute as the female parent and the Indian indica rice variety Swarna as the male parent to obtain F 1 Then, F 1 BC was obtained by backcrossing with IR64 as the female parent and IR64 as the male parent and the recurrent parent. 1 F 1 Group. The inventors used I 2 The pollen fertility of each plant was detected by the KI staining method as follows: 5-10 spikelets that were to bloom on the same day were collected from the branches and stalks in the middle and upper part of the main spike of each plant before flowering, and fixed in 70% ethanol. 2-KI solution staining, under 160 × ordinary optical microscope, the pollen fertility was divided into four categories: empty abortion (typical abortion and round abortion), dyed abortion, small black and fertile, and the number of pollen in the four categories was recorded. Three fields of view were observed on each piece, and the percentage of pollen in the four categories was calculated in units of plants. 1 F 1 At the beginning of the generation, pollen semi-sterile plants were selected for backcrossing until BC 5 F 1 The pollen semi-sterile plants were selected for self-pollination to form BC 5 F 2 , using rice 1k liquid phase chip (Huazhi Biotechnology Co., Ltd.) to detect BC 5 F 2 The genotypes of each individual plant in the population were analyzed, and the individual plant with normal pollen fertility and homozygous introgression of the Swarna genomic fragment was selected as NIL-S68.
[0036] 2. Hybrid F between recurrent parent IR64 and NIL-S68 1 Phenotypic identification
[0037] Parents IR64 and NIL-S68 and their hybrid F 1 There were no significant differences in plant height, tiller number, heading date, effective panicle and spikelet fertility. Figure 1 AC in ). Figure 1 As can be seen from the DF, both parental pollen showed normal fertility, while in the hybrid F 1 Among the pollen, 53.43% of the pollen grains were stained normally, but their diameters were significantly smaller than normal pollen grains and were of the small black type.
[0038] In order to study the relationship between the parental IR64 and NIL-S68 and their hybrid F 1 The inventors investigated whether the pollen and spikelets of the next generation were fertile. 1 The pollen fertility and spikelet fertility of Figure 1 The results showed that the pollen fertility of the parents was normal, and the hybrid F 1 The pollen is semi-sterile. 1 The fertility of spikelets was normal.
[0039] In order to study whether such small pollen grains have the ability to germinate, the inventors conducted a pollen germination experiment. The pollen germination medium was 10% sucrose, 100 μL 1% H 3 BO 3 and 100 μL 1% Ca(NO 3 ) 2, and dilute to 10 mL with sterile water. The specific method is to select small flowers with newly opened husks, shake the pollen on the culture medium, incubate in the dark at 28°C for 10 minutes, and observe and record the pollen germination under a microscope. The results are as follows: Figure 1 The results showed that the pollen germination rates of the parents were 98.0% and 75.2%, respectively, while the hybrid F 1 The germination rate of pollen is only 51.6%. Pollen grains with small diameters do not have the ability to germinate, indicating that this type of pollen is abortive.
[0040] In order to study the causes of pollen abortion, the inventors used scanning electron microscopy and transmission electron microscopy to analyze the ultrastructure of anthers and pollen.
[0041] The SEM experimental method is as follows:
[0042] (1) Pre-fixation: Take the florets that are about to open the next day and fix them in 2.5% glutaraldehyde for 2h-4h.
[0043] (2) Post-fixation: The fixed samples were rinsed with 0.1 M phosphate buffer PB (pH 7.4) for 3 times, 15 min each time. They were fixed with 1% osmium acid at room temperature in the dark for 1-2 h. They were rinsed with 0.1 M phosphate buffer PB (pH 7.4) for 3 times, 15 min each time.
[0044] (3) Dehydration: ethanol gradient 30%-50%-70%-85%-95%-100% (2 times), each level for 15 min.
[0045] (4) Replacement: Soak in a mixture containing isoamyl acetate and ethanol (the volume ratio of isoamyl acetate to ethanol in the mixture is 1:1) for 10 minutes. Then soak in isoamyl acetate for 10 minutes.
[0046] (5) Critical point drying: The replaced sample is transferred into a sample basket and placed into the pre-cooled critical point dryer sample chamber. Liquid carbon dioxide is injected and heated to 15°C for 10 min, then heated to 35°C to allow it to vaporize. After venting, the lid is opened and the sample is taken.
[0047] (6) Pasting: Use double-sided tape or conductive adhesive to stick the sample to the sample stage.
[0048] (7) Coating: Coating was performed by ion sputtering and stored dry at room temperature.
[0049] (8) Observation and photography: Observe and collect images under a scanning electron microscope.
[0050] Scanning electron microscopy was used to scan anthers and pollen to find that the parental and hybrid F 1 There was no significant difference in anther morphology ( Figure 2 AC in). But the hybrid F 1Among the pollen grains, half of them were smaller and wrinkled compared to the normal pollen grains in their parents ( Figure 2 DI in ).
[0051] The structure of the pollen grains was then analyzed using transmission electron microscopy experiments.
[0052] The transmission electron microscopy experimental method is as follows:
[0053] (1) Sample fixation: Take the florets that are about to open on the next day and fix them in 2.5% glutaraldehyde at 4°C for 2-4 hours.
[0054] (2) Post-fixation: The tissue blocks were rinsed three times with 0.1 M phosphoric acid solution, each time for 15 min, and then the samples were fixed in 1% osmium acid in a 4°C refrigerator for 4 h or overnight.
[0055] (3) Sample dehydration: Samples were dehydrated by gradient shaking in 30%-50%-70%-80%-95%-100%-100% alcohol in sequence, each for 40 min, and 100% propylene oxide three times, each for 30 min.
[0056] (4) Infiltration and embedding: propylene oxide + embedding solution (volume ratio of 3:1), shake and infiltrate at room temperature for 4 hours, propylene oxide + embedding solution (volume ratio of 1:3), shake and infiltrate at room temperature overnight, pure embedding solution, shake and infiltrate at room temperature overnight, replace pure embedding solution, shake and infiltrate at room temperature for 3-4 hours. Then pick out the sample with a toothpick and embed it on the embedding plate.
[0057] (5) Polymerization: Place the embedding plate in a 60°C oven for 48 h. After the resin is completely polymerized, remove the embedding block and set aside.
[0058] (6) Semi-thin positioning and ultra-thin sectioning: After rough trimming, the resin block is positioned for semi-thin sectioning on an ultra-thin sectioning machine. After trimming according to the positioning, ultra-thin sections are performed at the desired position. The section thickness is 70 nm and the sections are scooped out using a copper mesh.
[0059] (7) Staining: Stain with 3% uranyl acetate saturated alcohol solution for 8 min; wash with 70% alcohol 3 times, and wash with ultrapure water 3 times; stain with 2.7% lead citrate solution for 8 min; wash with ultrapure water 3 times, and dry with filter paper.
[0060] (8) Observation and photography: Observe under a transmission electron microscope and collect images for analysis.
[0061] Further observation using transmission electron microscopy revealed that aborted pollen grains had fewer starch granules ( Figure 2 JL in the figure), and the pollen wall is significantly thicker than that of normal pollen grains ( Figure 2 These results suggest that starch granule formation and pollen wall development in aborted pollen grains are abnormal.
[0062] 3. Genetic analysis of S68 gene
[0063] In order to investigate whether the semi-sterile phenotype of hybrid pollen is controlled by a single gene, the inventors investigated the hybridization of NIL-S68 as the female parent and IR64 as the male parent to obtain F 1 The plant was selfed again to form IR64 / Swarna BC 6 F 2 Genetic population, the results are as follows Figure 3 The results showed that the pollen fertility in the population showed a bimodal distribution, and the ratio of pollen fertile plants to semi-sterile plants was consistent with a 1:1 ratio (χ 2 (1:1) =5.83, P-value=0.015). This indicates that the S68 gene is a single Mendelian genetic factor.
[0064] 4. Analysis of NIL-S68 infiltration fragments
[0065] In order to study the background substitution rate and introgression fragments of NIL-S68, the inventors randomly scanned three pollen fertile plants and three pollen semi-sterile plants using rice 1K liquid phase array (Huazhi Biotechnology Co., Ltd.). Figure 4 As shown. The 1K chip results showed that compared with the recurrent parent IR64, the background reversion rate of NIL-S68 was 92.5%. Further analysis found that all pollen semi-sterile plants had heterozygous introgression at the end of the short arm of the third chromosome, while all pollen fertile plants had the recurrent parent genotype at this position, indicating that the S68 gene controlling pollen semi-sterility may be located at the end of the short arm of the third chromosome. Next, the inventors analyzed the correlation coefficient between the SNP markers in the chip and pollen fertility, and the results are shown in Figure 5 The results showed that the correlation coefficient between the SNP markers in the chip and pollen fertility reached a significant negative correlation (r 2 =-0.813).
[0066] 5. Location of S68 gene
[0067] In order to locate the S68 gene, the inventors selected 41 SSR markers in the introgression fragment region and screened between IR64 and NIL-S68, and screened out 15 pairs of polymorphic markers. The 15 pairs of markers were used to detect the genotypes of each plant in the population. Combined with the phenotypes of each plant, the gene S68 was located within the range of 0.4 cM between markers S157 and S347, with a physical distance of about 190 kb. In this section, no hybrid sterility genes have been reported. Therefore, the S68 gene is a gene that controls the semi-sterility of hybrid pollen in the indica-indica subspecies ( Figure 6 ).
[0068] Table 1 Primer sequences used for gene S68 localization
[0069]
[0070]
[0071] Example 2 Application of S347 marker in detecting fertility of indica-indica hybrids
[0072] The S347 primer pair of the present invention can be used to detect whether hybrid fertility disorder exists in two indica rice varieties. The specific method is:
[0073] 1. Simple method to extract genomic DNA
[0074] (1) 12.1 g of tris (hydroxymethyl)aminomethane (Tris base) was dissolved in 1000 mL of water and the pH was adjusted to 8.7 with concentrated hydrochloric acid to prepare a 100 mmol / L Tris-HCl solution.
[0075] (2) Dissolve 74.5 g of sodium chloride (KCl) in 1000 mL of water to prepare a 1 mol / L KCl solution.
[0076] (3) Dissolve 3.73 g EDTA in 1000 mL water to prepare a 10 mmol / L EDTA solution.
[0077] (4) Mix Tris-HCl solution, KCl solution and EDTA solution in a volume ratio of 1:1:1 to prepare a rapid extraction solution.
[0078] (5) The samples IR64, Swarna and IR64 / Swarna hybrid populations (BC 6 F 2 , NIL-S68 was used as the female parent and IR64 as the male parent to obtain IR64 / Swarna BC 6 F 2 The leaves of each individual plant in the population were cut into 7-8 segments of about 0.5 cm and placed in a deep-well plate. 100 μL of nucleic acid rapid extraction solution was added to each well of each sample and boiled in an autoclave at 105°C for 10 min.
[0079] 2. Detect the purity and concentration of DNA in the sample
[0080] The present invention takes 1 μL of DNA crude extract and detects OD on Nanodrop. 260 / 280 , whether the ratio is between 1.8-2.0. And detect the concentration of crude DNA extract, dilute it with sterile water to between 20-100ng / μL.
[0081] 3. Construction of PCR system and PCR reaction conditions
[0082] The PCR reaction system of the present invention is 10 μL, including 25-50 ng DNA template, 5 μL 2×Taq PCR StarMix, 0.3 μM upstream primer (TTAGAGGAGATGATGGTGCAACG, SEQ ID NO.11) and downstream primer (AGCAGCCATTGAATGTGTTTGG, SEQ ID NO.12); the reaction program used is: 94°C pre-denaturation for 5 minutes, 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, 30 cycles, and finally 72°C extension for 5 minutes.
[0083] 4. Polyacrylamide electrophoresis detection
[0084] (1) acrylamide and methylenebisacrylamide were mixed in a volume ratio of 38:2 to prepare a 40% polyacrylamide solution, which was stored at 4° C. for later use;
[0085] (2) During electrophoresis, ddH 2 O, 10×TBE and 40% polyacrylamide solution were mixed in a volume ratio of 7:1:2, the 40% polyacrylamide solution was diluted to 8% working solution, and then the 8% working solution, TEMED and 10% APS were mixed in a volume ratio of 5:2:50 to prepare an 8% polyacrylamide gel;
[0086] (3) Perform electrophoresis at a constant voltage of 160 V and a 0.5×TBE buffer. The specific amplification time depends on the molecular weight of the amplified product.
[0087] Detection by silver staining after electrophoresis:
[0088] (1) Place the electrophoresis gel in a fixative (10% alcohol and 0.5% glacial acetic acid) for 10 min.
[0089] (2) Silver staining with 0.15% silver nitrate solution for 15 min.
[0090] (3) Color development in 1.5% sodium hydroxide, sodium tetraborate (4 g / L), and 0.4% formaldehyde solution.
[0091] (4) Rinse with deionized water for 1-2 minutes.
[0092] (5) Cover the gel with plastic wrap.
[0093] (6) The gel staining results were scanned and saved as images using an EPSON (GT10000) scanner.
[0094] The present invention uses S347 primers to amplify the genome fragments of each single group of IR64 and Swarna and IR64 / Swarna hybrid populations. The results are as follows: Figure 7 As shown. Figure 7 It can be seen that the banding patterns of IR64 and Swarna parents are both homozygous, but the molecular weight of the PCR products of the two are different. The IR64 banding pattern is recorded as 1 (homozygous IR64 genotype, that is, a band appears at 195-205bp), the Swarna banding pattern is recorded as 2 (homozygous Swarna genotype, that is, a band appears at 180-190bp), and the heterozygous banding pattern is recorded as 3 (heterozygous, that is, a band appears at 195-205bp and 180-190bp). The fertility of these plants was then investigated, and the results are shown in Table 2. The results showed that in the hybrid offspring population of IR64 and Swarna, the pollen fertility of the plants with heterozygous banding patterns was semi-sterile, and the pollen fertility of the plants with homozygous banding patterns was normal and fertile (Table 2).
[0095] Table 2 Pollen fertility corresponding to S347 marker genotype
[0096]
[0097]
[0098] Note: II, IS and SS represent homozygous IR64 genotype, heterozygous genotype and homozygous Swarna genotype, respectively.
[0099] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.
Claims
1. An SSR molecular marker related to rice fertility, characterized in that: The SSR molecular marker is obtained by amplifying a forward primer having a nucleotide sequence as shown in SEQ ID NO.11 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.
12.
2. The SSR molecular marker according to claim 1, characterized in that The rice is an intra-subspecies hybrid of Indica and Indica.
3. A primer pair for amplifying the SSR molecular marker according to claim 1, characterized in that: The primer pair includes a forward primer whose nucleotide sequence is shown as SEQ ID NO.11 and a reverse primer whose nucleotide sequence is shown as SEQ ID NO.
12.
4. Use of the primer pair according to claim 3 in preparing a product for identifying rice fertility.
5. The use according to claim 4, characterized in that: The rice is an intra-subspecies hybrid of Indica and Indica.
6. The use according to claim 4, characterized in that: The product includes a reagent, a kit or a chip.
7. A product for identifying rice fertility, characterized in that: The product comprises the primer pair described in claim 3.
8. Use of the SSR molecular marker described in claim 1, the primer pair described in claim 3 or the product described in claim 7 in identifying rice fertility.
9. A method for identifying rice fertility, characterized in that: The method comprises taking the DNA of the rice to be tested as a template, using the primer pair described in claim 3 to perform amplification, and determining the rice hybrid fertility according to the band pattern of the amplified product.
10. The method according to claim 9, characterized in that When one band appears at 195-205 bp or 180-190 bp, the two tested rice hybrids are normal and fertile; When one band appears at 195-205 bp and one band appears at 180-190 bp, the two tested rice hybrids are semi-sterile.
Citation Information
Patent Citations
Method for separating two tightly linked rice sterile genes
CN103374616A
Identifying and utilizing method of rice wide-compatibility recessive male nuclear sterile line
CN105986019A
Oryza sativa cytoplasmic male sterility restorer gene osrf19 and application thereof
WO2023016097A1