A kit and method for identifying Fritillaria cirrhosa
By detecting the SNP sites of RPL17, CKX3 and ILA genes in the steroid alkaloid synthesis pathway of Fritillaria citrus and using the KASP method for genotyping, the problem of identification of Fritillaria citrus was solved, and the rapid and accurate identification of bases was achieved, and the quality control and resource utilization of medicinal materials were improved.
Patent Information
- Application Number
- CN202510558263.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2045-04-29
AI Technical Summary
The prior art is difficult to effectively distinguish the six basic plants of Fritillaria citrus, resulting in mixed products appearing on the market, affecting the efficacy of medicinal materials and consumer interests.
The SNP/InDel markers of RPL17, CKX3 and ILA genes based on the Fritillaria steroid alkaloid synthesis pathway were used to genotypic by KASP method, and the identification of Fritillaria citrulion was achieved using specific primers and fluorescence signal detection.
It has achieved rapid and accurate identification of Fritillaria citrus, and improved the reliability of medicinal materials quality control and resource utilization.
Smart Images

Figure CN120099226B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of SNP technology, and particularly relates to a kit and method for identifying Fritillaria cirrhosa. Background Art
[0002] Fritillaria cirrhosa is the dried bulb of several medicinal plants in the genus Fritillaria, Liliaceae. The 2020 edition of the Pharmacopoeia of the People's Republic of China lists its basal plants as Fritillaria cirrhosa, Fritillaria cirrhosa, Fritillaria gansuensis, Fritillaria thunbergii, Fritillaria wabuensis, and Fritillaria taibaiensis. As a representative and valuable medicinal material with a long history of medicinal use, Fritillaria cirrhosa has the benefits of clearing heat and moistening the lungs, resolving phlegm and relieving coughs. While the dried bulbs of these six basal plants are all considered Fritillaria cirrhosa, they are classified as "songbei," "qingbei," "lubei," and "cultivated" depending on their characteristics, resulting in varying market prices. "Songbei," primarily derived from Fritillaria cirrhosa, has the highest market price among all Fritillaria cirrhosa materials, reaching 5,000 yuan per kilogram in recent years. "Qingbei," primarily derived from Fritillaria cirrhosa, "lubei," primarily from Fritillaria thunbergii, and "cultivated" products primarily comprise the dried bulbs of Fritillaria wabuensis and Fritillaria taibaiensis. In recent years, due to increasing clinical demand, overexploitation, and the long growth cycle of the original plant, the resource of Fritillaria cirrhosa is becoming increasingly scarce. This has led to the emergence of "cultivated" varieties, "lubei" varieties, and even other counterfeit products posing as "songbei" or "qingbei" varieties in the market, directly impacting the efficacy, safety, and economic benefits of the medicinal material. Therefore, to address the confusion surrounding the origin of Fritillaria cirrhosa in the market, developing an efficient and simple method for identifying the original species is of great significance for clinical use, quality control, and the rational development and utilization of Fritillaria resources.
[0003] Molecular marker technology is a genetic marker based on nucleotide sequence variation in a species. It can directly reflect the genetic diversity of a species at the DNA level and is widely used in research on genetic diversity and genetic map construction, variety identification, gene fine mapping, and molecular marker-assisted breeding. Currently, scholars have used random amplified polymorphic DNA markers (RAPD), simple sequence repeat interval polymorphism (ISSR), restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), and sequence-related amplified polymorphism (SRAP) to identify Fritillaria cirrhosa and its adulterated products. The results show that these molecular markers can effectively separate Fritillaria cirrhosa from Fritillaria thunbergii and Fritillaria cirrhosa, but are not effective in simultaneously distinguishing the six ancestral species of Fritillaria cirrhosa. Single nucleotide polymorphism (SNP) and insertion / deletion (InDel) markers are the third generation of single nucleotide markers developed in recent years. They have the advantages of wide distribution in the genome, high density, high number, good reproducibility, and accurate and reliable results. However, existing research is limited to designing markers based on chloroplast genome sequence differences, such as patent CN118440943B, while SNP and InDel markers for transcriptome analysis of the alkaloid synthesis pathway have not been reported. SNP / InDel markers can be used to screen for enzyme genes closely related to steroid alkaloid synthesis through transcriptome data analysis. Therefore, using SNP molecular markers in the transcriptome of the alkaloid synthesis pathway of Fritillaria cirrhosa to identify the origin of Fritillaria cirrhosa is more conducive to the quality control of Fritillaria cirrhosa. However, there are currently no reports on the identification of the origin of Fritillaria cirrhosa based on SNP molecular markers in genes related to steroid alkaloid synthesis in Fritillaria cirrhosa. Summary of the Invention
[0004] The present invention aims to provide a kit for identifying Fritillaria cirrhosa, which comprises a reagent for detecting any one or more of the SNP sites of RPL17 gene segment 1855②, CKX3 gene segment 1642①, CKX3 gene segment 1642③, and ILA gene segment 14943③ of Fritillaria cirrhosa;
[0005] The nucleotide sequence of the RPL17 gene segment 1855② is shown in SEQ ID NO: 19;
[0006] The nucleotide sequence of the CKX3 gene fragment 1642① is shown in SEQ ID NO: 20;
[0007] The nucleotide sequence of the CKX3 gene fragment 1642③ is shown in SEQ ID NO: 21;
[0008] The nucleotide sequence of the ILA gene fragment 14943③ is shown in SEQ ID NO: 22.
[0009] Furthermore, the SNP site is located at position 228 in the RPL17 gene segment 1855②, and its polymorphism is T / C; located at position 122 in the CKX3 gene segment 1642①, and its polymorphism is A / G; located at position 112 in the CKX3 gene segment 1642③, and its polymorphism is T / G; located at position 213 in the ILA gene segment 14943③, and its polymorphism is G / A.
[0010] Furthermore, the reagents are reagents for sequencing, reagents for the KASP method, or reagents for the restriction fragment length polymorphism method.
[0011] Furthermore, the KASP method reagents include any one or more of the following KASP primer sets:
[0012] KASP primer set for detecting the RPL17 gene segment 1855② SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 7 to 9;
[0013] A KASP primer set for detecting the CKX3 gene segment 1642① SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 10 to 12;
[0014] The KASP primer set for detecting the CKX3 gene segment 1642③ SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 13 to 15;
[0015] The nucleotide sequences of the KASP primer set for detecting the 14943③ SNP site of the ILA gene segment are shown in SEQ ID NOs. 16 to 18.
[0016] Furthermore, it also includes reagents for amplifying the sequences of the RPL17 gene fragment, the CKX3 gene fragment and / or the ILA gene fragment;
[0017] The reagents for amplifying the RPL17 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 1 to 2; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 3 to 4; and the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 5 to 6.
[0018] The present invention also provides a use of the above-mentioned kit in identifying Fritillaria cirrhosa.
[0019] The present invention finally provides a method for identifying Fritillaria cirrhosa, comprising the following steps:
[0020] (1) Extracting total genomic DNA from Fritillaria cirrhosa samples;
[0021] (2) Detect the 228th SNP site in the RPL17 gene segment 1855②, the 122nd SNP site in the CKX3 gene segment 1642①, the 112th SNP site in the CKX3 gene segment 1642③, and the 213th SNP site in the ILA gene segment 14943③, and analyze them;
[0022] The nucleotide sequence of the RPL17 gene segment 1855② is shown in SEQ ID NO: 19;
[0023] The nucleotide sequence of the CKX3 gene fragment 1642① is shown in SEQ ID NO: 20;
[0024] The nucleotide sequence of the CKX3 gene fragment 1642③ is shown in SEQ ID NO: 21;
[0025] The nucleotide sequence of the ILA gene fragment 14943③ is shown in SEQ ID NO: 22.
[0026] Furthermore, the detection steps in step (2) are as follows:
[0027] Using the total genomic DNA extracted in step (1) as a template, PCR amplification is performed using an amplification reagent to obtain an amplified product; the amplified product is detected using a reagent using the KASP method, and the origin of Fritillaria cirrhosa is determined based on the fluorescence result;
[0028] The amplification reagents include reagents for amplifying RPL17 gene fragments, CKX3 gene fragments and / or ILA gene fragment sequences;
[0029] The reagents for amplifying the RPL17 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 1 to 2; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 3 to 4; and the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 5 to 6.
[0030] In the amplified product, the RPL17 gene fragment sequence is 296 bp long, the CKX3 gene fragment sequence is 369 bp long, and the ILA gene fragment sequence is 294 bp long;
[0031] The KASP method reagents include any one or more of the following KASP primer sets:
[0032] KASP primer set for detecting the RPL17 gene segment 1855② SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 7 to 9;
[0033] A KASP primer set for detecting the CKX3 gene segment 1642① SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 10 to 12;
[0034] The KASP primer set for detecting the CKX3 gene segment 1642③ SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 13 to 15;
[0035] The nucleotide sequences of the KASP primer set for detecting the 14943③ SNP site of the ILA gene segment are shown in SEQ ID NOs. 16 to 18.
[0036] Furthermore, when amplified with the KASP primer set that detects the SNP site 1855② of the RPL17 gene segment, blue fluorescence was generated, indicating that the origin of Fritillaria cirrhosa is Fritillaria wabuensis.
[0037] When amplified with the KASP primer set that detects the SNP site 1855② of the RPL17 gene segment, red fluorescence was produced. When amplified with the KASP primer set that detects the SNP site 1642① of the CKX3 gene segment, blue fluorescence was produced. The origin of Fritillaria cirrhosa is Fritillaria taibaiensis.
[0038] When the KASP primers for detecting the SNP site 1855② of the RPL17 gene segment and the KASP primers for detecting the SNP site 1642① of the CKX3 gene segment were used for amplification, both produced red fluorescence, indicating that the origin of Fritillaria cirrhosa is Fritillaria thunbergii.
[0039] When the KASP primers for detecting the SNP sites at 1855② of the RPL17 gene segment and the KASP primers for detecting the SNP sites at 1642③ of the CKX3 gene segment were used for amplification, both produced green fluorescence, indicating that the origin of Fritillaria cirrhosa is Fritillaria dahurica.
[0040] When amplified with the KASP primer set that detects the SNP site at 1855② of the RPL17 gene segment, green fluorescence was produced; when amplified with the KASP primer set that detects the SNP site at 1642③ of the CKX3 gene segment, red fluorescence was produced; and when amplified with the KASP primer set that detects the SNP site at 14943③ of the ILA gene segment, blue fluorescence was produced. The origin of Fritillaria cirrhosa is dark purple Fritillaria.
[0041] When amplification was performed using the KASP primer set that detected the 1855②SNP site of the RPL17 gene segment, green fluorescence was produced; when amplification was performed using the KASP primer set that detected the 1642③SNP site of the CKX3 gene segment, red fluorescence was produced; and when amplification was performed using the KASP primer set that detected the 14943③SNP site of the ILA gene segment, green fluorescence was produced. The origin of Fritillaria cirrhosa is Fritillaria thunbergii.
[0042] Furthermore, the genotype of the SNP site at position 228 of the RPL17 gene segment 1855② of the Fritillaria wabuensis is TT;
[0043] The genotype of Fritillaria taibaiensis at position 228 of RPL17 gene segment 1855② is CC, and the genotype of position 122 of CKX3 gene segment 1642① is AA;
[0044] The genotype of Fritillaria thunbergii at position 228 of the RPL17 gene segment 1855② is CC, and the genotype of the 122nd position of the CKX3 gene segment 1642① is GG;
[0045] The genotype of Gansu Fritillaria at position 228 of RPL17 gene segment 1855② is TC, and the genotype of position 112 of CKX3 gene segment 1642③ is TG;
[0046] The genotype of Fritillaria thunbergii at position 228 of RPL17 gene segment 1855② is TC, the genotype of CKX3 gene segment 1642③ at position 112 is GG, and the genotype of ILA gene segment 14943③ at position 213 is GG.
[0047] The genotype of Fritillaria cirrhosa at position 228 of RPL17 gene segment 1855② is TC, the genotype of CKX3 gene segment 1642③ at position 112 is GG, and the genotype of ILA gene segment 14943③ at position 213 is GA.
[0048] The "KASP method" described in the present invention uses allele-specific primers for PCR amplification and realizes genotyping through fluorescence signal detection. It is a genotyping technology based on single nucleotide polymorphism (SNP), mainly used to detect SNP and insertion / deletion polymorphism (InDel) in the genome.
[0049] The present invention designs SNP / InDel markers based on the RPL17 (1855), CKX3 (1642), and ILA (14943) gene sequences in the steroidal alkaloid synthesis pathway of Fritillaria cirrhosa. The SNP / InDel markers are used to identify the original plant of Fritillaria cirrhosa, providing a reference for the identification of the traditional Chinese medicine Fritillaria cirrhosa at the molecular level, and also providing a theoretical basis for the germplasm utilization and protection of Fritillaria cirrhosa plants.
[0050] The key point of the present invention is the discovery of the relationship between one SNP site on a sequence in the RPL17 gene, a gene involved in the synthesis pathway of Fritillaria cirrhosa steroid alkaloids, two SNP sites on a sequence in the CKX3 gene, and one SNP site on a sequence in the ILA gene and the origin of Fritillaria cirrhosa. On this basis, the origin of Fritillaria cirrhosa can be identified by any reagent or equipment that detects the bases of any one or more of the above SNP sites.
[0051] Specifically, an embodiment of the present invention provides an example of using KASP technology to detect SNP sites. The primers for gene fragment amplification of the present invention have good specificity. When used for PCR, they do not produce non-specific amplification with DNA fragments other than the target. The target gene is amplified through the use of KASP primers and KASP probes with good specificity, achieving high-specificity and high-sensitivity detection of SNP / InDel sites, and can quickly and accurately identify the origin of Fritillaria cirrhosa. The present invention also provides a segment of RPL17 gene sequence, two segments of CKX3 gene sequence, and one segment of ILA gene sequence, which can assist in determining the location of Fritillaria cirrhosa-specific SNP sites in these gene segments, facilitating the determination of the genotype of the SNP site.
[0052] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.
[0053] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0054] Figure 1 RPL17 (1855) PCR product;
[0055] Figure 2 ILA (14943) PCR product;
[0056] Figure 3 CKX3(1642) PCR product;
[0057] Figure 4 RPL17 (1855) Sanger sequencing verification results;
[0058] Figure 5 ILA (14943) Sanger sequencing verification results;
[0059] Figure 6 CKX3 (1642) Sanger sequencing verification results;
[0060] Figure 7 KASP typing results;
[0061] Figure 8 Schematic diagram of differentiating the 6 types of Fritillaria cirrhosa;
[0062] Figure 9 RPL17 (1855②) Sanger sequencing verification results;
[0063] Figure 10 Sanger sequencing verification results of CKX3 gene (1642①);
[0064] Figure 11 Sanger sequencing verification results of CKX3 gene (1642③);
[0065] Figure 12 Sanger sequencing verification results of ILA gene fragment (14943③); DETAILED DESCRIPTION
[0066] In order to more clearly understand the present invention, the present invention will be further described with reference to the following examples and drawings.
[0067] The experimental methods without specific conditions specified in the examples are conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the manufacturer; the various chemical reagents used in the examples are commercially available, and the primers used are synthesized by contract.
[0068] Example 1 Kit for Identifying Fritillaria cirrhosae of the Present Invention
[0069] The components of the kit of the present invention include:
[0070] (1) PCR amplification reagents: including primers for gene fragment amplification;
[0071] The primers used for gene fragment amplification are:
[0072]
[0073] (2) Reagents for the KASP method: including KASP primer sets for SNP typing;
[0074] KASP primer set for SNP typing:
[0075]
[0076]
[0077] Note: The underlined sequences in SEQ ID NO.7, SEQ ID NO.10, SEQ ID NO.13 and SEQ ID NO.16 are FAM tag sequences; the underlined sequences in SEQ ID NO.8, SEQ ID NO.11, SEQ ID NO.14 and SEQ ID NO.17 are HEX tag sequences.
[0078] Example 2 Method for Identifying Fritillaria cirrhosae of the Present Invention
[0079] a) using a plant genomic DNA extraction kit, extracting total genomic DNA from the dried bulbs of Fritillaria cirrhosa;
[0080] b) using the total genomic DNA obtained in step a) as a template, PCR reactions were performed using the primers for gene fragment amplification in the kit of Example 1. The reaction system (25 μL) was subjected to one cycle of initial denaturation at 95°C for 4 min, followed by one cycle of denaturation at 95°C for 30 s, annealing at 55-58°C for 30 s, and 35 cycles of extension at 72°C for 1 min, and final extension at 72°C for 5 min.
[0081] c) performing 1.5% agarose gel electrophoresis on the PCR products obtained in step b), and bright bands of 296 bp, 369 bp, and 294 bp were observed, respectively;
[0082] d) recovering and purifying the band obtained in step c), and then detecting it with the SNP typing KASP primer set in the kit of Example 1, and determining the origin of Fritillaria cirrhosa based on the fluorescence results;
[0083] The results are as follows: When the 296 bp band was amplified by PCR using the KASP primer set shown in SEQ ID NOs. 7 to 9, blue fluorescence was generated, indicating that the origin of Fritillaria cirrhosa is Fritillaria wabuensis;
[0084] When the 296 bp band was PCR amplified using the KASP primer set shown in SEQ ID NOs. 7 to 9, red fluorescence was generated; when the 369 bp band was PCR amplified using the KASP primer set shown in SEQ ID NOs. 10 to 12, blue fluorescence was generated. The origin of Fritillaria cirrhosa is Fritillaria taibaiensis.
[0085] When the KASP primer set shown in SEQ ID NOs. 7 to 9 was used to perform PCR amplification on the 296 bp band, and when the KASP primer set shown in SEQ ID NOs. 10 to 12 was used to perform PCR amplification on the 369 bp band, both produced red fluorescence, indicating that the origin of Fritillaria cirrhosa is Fritillaria thunbergii.
[0086] When the KASP primer set shown in SEQ ID NOs. 7 to 9 was used to perform PCR amplification on the 296 bp band, and when the KASP primer set shown in SEQ ID NOs. 13 to 15 was used to perform PCR amplification on the 369 bp band, both produced green fluorescence, indicating that the origin of Fritillaria cirrhosa is Fritillaria gansuensis.
[0087] When the 296 bp band was amplified by PCR using the KASP primer set shown in SEQ ID NOs. 7 to 9, green fluorescence was generated; when the 369 bp band was amplified by PCR using the KASP primer set shown in SEQ ID NOs. 13 to 15, red fluorescence was generated; and when the 294 bp band was amplified by PCR using the KASP primer set shown in SEQ ID NOs. 16 to 18, blue fluorescence was generated. The origin of Fritillaria cirrhosa is dark purple Fritillaria.
[0088] When the 296 bp band was PCR amplified using the KASP primer set shown in SEQ ID NOs. 7 to 9, green fluorescence was produced. When the 369 bp band was PCR amplified using the KASP primer set shown in SEQ ID NOs. 13 to 15, red fluorescence was produced. When the 294 bp band was PCR amplified using the KASP primer set shown in SEQ ID NOs. 16 to 18, green fluorescence was produced. The origin of Fritillaria cirrhosa is Fritillaria curlifolia.
[0089] The beneficial effects of the present invention are further illustrated by the following test examples:
[0090] Test Example 1, identification of Fritillaria cirrhosae of the present invention
[0091] 1. Experimental Methods
[0092] 1. Obtaining gene fragments for identification of Fritillaria cirrhosa
[0093] 100 mg of dried bulbs of six species of Fritillaria (Fritillaria wabuensis, Fritillaria gansuensis, Fritillaria purpurae, Fritillaria curlifolia, Fritillaria taibaiensis, and Fritillaria thunbergii) were collected and washed with 75% alcohol and then with sterile water. After wiping the samples dry, they were placed in a mortar pre-cooled with liquid nitrogen and ground into a very fine powder while adding liquid nitrogen. DNA was extracted from each Fritillaria sample according to the instructions of the plant genomic DNA extraction kit, and the DNA concentration of the extracted samples was detected using a multifunctional microplate reader (Bio-Tek, USA).
[0094] The extracted genomic DNA was used as a template and PCR amplification was performed using the following three pairs of primers:
[0095] Primer ①: 1855-F (SEQ ID NO: 1): AAGCTCGCCACTCAAATGGT
[0096] 1855-R(SEQ ID NO:2):ACTCACGGTTGATTCGCCC
[0097] Primer ②: 1642-F (SEQ ID NO: 3): GAGGAGAGTCTGAGGAGGCAAGG
[0098] 1642-R(SEQ ID NO:4):TCTGCTGAAGGAGTGCGTCTAGG
[0099] Primer ③: 14943-F (SEQ ID NO: 5): TCGTTGGCGTTACTGGTTCCTATTG
[0100] 14943-R (SEQ ID NO: 6): CCTCACTTAATCCTTGGGCAGC AC.
[0101] The reaction system for PCR amplification was: 1 μL 50 ng / μL DNA, 12.5 μL Max (PCR HeroTM (With Dye): 2× fast and efficient PCR reaction premix system (with dye) from Chengdu Fuji Biotechnology Co., Ltd.), 10.5 μL ddH2O and 0.5 μL forward and reverse primers, with a total volume of 25 μL.
[0102] PCR reaction parameters:
[0103]
[0104] The PCR products were detected by 1.5% agarose gel electrophoresis and the results were observed in a gel imager. The clear and bright bands without tailing were selected ( Figures 1 to 3 ), an agarose gel recovery kit (Beijing Tiangen Biochemical Technology Co., Ltd.) was used for recovery and purification, and the purified target fragment was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0105] The sequenced nucleotide sequences were compared with those in GenBank ( Figures 4-6 ), confirming that the target fragment amplified by primer ① is a segment of the RPL17 gene encoding the L17 protein in the 60S ribosomal large subunit, totaling 296 bp; the target fragment amplified by primer ② is a segment of the CKX3 gene encoding cytokinin oxidase / dehydrogenase 3, totaling 369 bp; the target fragment amplified by primer ③ is a segment of the ILA gene encoding the ILITYHIA protein, totaling 294 bp.
[0106] 2. SNP typing
[0107] Referring to the instructions for use of the AQP genotyping system, the KASP primer set was used to detect the obtained fragments in the RPL17 gene, CKX3 gene, and ILA gene, and SNP typing was performed based on the fluorescence results.
[0108] KASP primer set for SNP typing of RPL17 gene segment:
[0109]
[0110]
[0111] There are two KASP primer sets for SNP typing of CKX3 gene fragments, namely:
[0112]
[0113] The KASP primer set used for SNP typing of the ILA gene segment is:
[0114]
[0115] The reaction system is: 4-50 ng DNA, primer mix (a mixture of upstream typing primer 1, upstream typing primer 2 and common downstream primer): 0.14 μL (the volume of primer mix can be excluded from the PCR system), HiGeno2×Probe Mix A (Jiacheng KASP reagent): 5 μL, ddH2O: make up to 10 μL.
[0116] PCR reaction parameters:
[0117]
[0118]
[0119] Fluorescence data were read using a qPCR instrument, and KASP typing was performed on the fragments amplified by the KASP primer set according to the distribution of fluorescence signals. The results are shown in Figure 7 . Schematic diagram of the differentiation of KASP typing results Figure 8 .from Figures 7 and 8 It can be seen that when the KASP primer set for RPL17 gene segment SNP typing was used for detection, blue fluorescence was produced, and the origin of Fritillaria cirrhosa was Fritillaria wabuensis;
[0120] When the KASP primer set for SNP typing of the RPL17 gene segment was used for detection, red fluorescence was generated; when the first set of KASP primers for SNP typing of the CKX3 gene segment was used for detection, blue fluorescence was generated. The origin of Fritillaria cirrhosa is Fritillaria taibaiensis.
[0121] When the KASP primer set for RPL17 gene segment SNP typing and the first KASP primer set for CKX3 gene segment SNP typing were used for detection, both produced red fluorescence, indicating that the origin of Fritillaria cirrhosa is Fritillaria thunbergii.
[0122] When the KASP primer set for SNP typing of RPL17 gene segment and the second KASP primer set for SNP typing of CKX3 gene segment were used for detection, both produced green fluorescence, indicating that the origin of Fritillaria cirrhosa is Fritillaria dahurica.
[0123] When the KASP primer set for RPL17 gene segment SNP typing was used for detection, green fluorescence was generated; when the second KASP primer set for CKX3 gene segment SNP typing was used for detection, red fluorescence was generated; when the KASP primer set for ILA gene segment SNP typing was used for detection, blue fluorescence was generated. The origin of Sichuan Fritillaria is dark purple Fritillaria;
[0124] When the KASP primer set for RPL17 gene segment SNP typing was used for detection, green fluorescence was produced. When the second set of KASP primer set for CKX3 gene segment SNP typing was used for detection, red fluorescence was produced. When the KASP primer set for ILA gene segment SNP typing was used for detection, green fluorescence was produced. The origin of Fritillaria cirrhosa is Fritillaria curlifolia.
[0125] The fragments obtained by KASP detection were subjected to Sanger sequencing to verify the accuracy of KASP typing results. The results are shown in Figures 9-12 .from Figures 9-12 It can be seen that when SNP typing was performed on the RPL17 gene fragment, a DNA fragment (number 1855②) amplified using the KASP primer set contained a SNP site at position 228. Its polymorphism was T / C, and the corresponding polymorphism on the complementary strand was A / G. The nucleotide sequence of the single strand is as follows (SEQ ID NO: 19):
[0126] GGGGAGGTCTGACGCTTTGCTTCTGAGCCTGATTCACTTGAATATGAGATATAGTAGAGGGCATCAACATCCAAGCCTTTCATCTAACAAAAAGAAGCCAACCAAGATTCACTTAAACATGAGATATGTAGAGGGCGTCAACATCCGAA ACAATCTAAATACAAGCCAAACATAAATAATAACAAAGGACATACATCAGCATTACTCTCAGCATTCTTTAGCAAATCT / CAGAATGAACTTTGCAGACTTCATAGGCCAGCGACCCTGACCATTTGAGTGGCGAGCTTAAAAGAAGGC
[0127] When performing SNP typing on the CKX3 gene fragment, a DNA fragment (number 1642①) amplified using the first set of KASP primers had a SNP site at position 122, and its polymorphism was A / G, as shown below (SEQ ID NO: 20):
[0128] CCCGTAGCATGCTATCCATGGCTGACTTGTTTGTGCCCAGGGTTCAAATAGGGAGGTTCAAAGACCTCCTCCTTCGAACAATCTCAGCAGAGGCCTTTGGTGGGACGATCATAATATACCCA / GACTTTCATGCAGACGTACGCTGTCCTGCGCACAGGCTTTGTTTTTCTTCAAATTGACTTTT AAATGTATTTGCTAAAATCTAAAGGATGAAGTAGTCTAATATATAAACTTCACCTTCCAGATGGGATCCAAAAATGTCTAGCGTGCTGCCACAAGATGATTCTGGTCATGGTATCATGTATGTCGCAAGTGTTCTACGTGCCGCCCCATTGTTCTGCACAAGCGGCGCACCGTGCCTAGACGCCCC
[0129] When SNP typing was performed on the CKX3 gene fragment, a SNP site was found at position 112 of the DNA fragment (number 1642③) amplified using the second set of KASP primers. The polymorphism was T / G, as shown below (SEQ ID NO: 21):
[0130] TCCCCCCCCCGCCTTCACTCATCGTATCTGCTAGTTTGTGCCCAGGGTTCAAATAGGGAGGTTCAAAGACCTCCTCCTTCTTACAATCTCAGCAGAGGCCTTTTGGTGGGACT / GATCATAATATACCCGACTTTCATGCAGACGTACGCTGTCCTGCGCACAGGCTTTGTTTTTCTTCAAATTGACTTTTAAAT ATAATTGCTCAAATCTAAAGGATGAAGTAGTCTAATATATAAACTTCACCTTTCAGATGGGATCCAAAAATGTCTAGCGTGCTGCCACAAGATGATTCTGGTCATGGTATCATGTATGTCGCAAGTGTTCTACGTGCCGCCCCATTGTCCTGCACAAGCGGCACACCGTGCCTAGACGCACTCCTTTCAGCAGAA
[0131] When performing SNP typing on the ILA gene fragment, a DNA fragment (No. 14943③) amplified using the KASP primer set contained a SNP site at position 213, and its polymorphism was G / A, as shown below (SEQ ID NO: 22):
[0132] ACAGAGAAGAGAGAGGAGTGCTGATACTAAATAGAAGCATGCTC.AATTGTTGGAAATATGTGCTCTTTAGTAACAGAACCGAAGGATATGATTCCATATATTGAGTTGCTACTTCCTGAAGTAAAGAAGGCCCTTGTAGACCCAATT CCCGAAGTTCGTTCTGTTGCAGCATGAGCTCTTGGGTCTCTTATCAAAGGAATGGGTGAAGAGCG / AATTTCCAGATCTTGTCTCATGGTTACTTGATACACTTAAGTCTGACAACAGTAACGTCGAGAGATCTGGTGCTGCCCAAGA
[0133] Combining the KASP typing results with the Sanger sequencing verification results, it can be seen that by detecting the SNP sites of the RPL17 gene segment 1855②, the CKX3 gene segment 1642①, the CKX3 gene segment 1642③, and the ILA gene segment 14943③, and determining the genotype of these sites, the origin of Fritillaria cirrhosa can be accurately identified. Among them, the genotype of the SNP site at position 228 of the RPL17 gene segment 1855② (SEQ ID NO: 19) is TT, indicating that the origin of Fritillaria cirrhosa is Fritillaria wabuensis.
[0134] The genotype at position 228 of the RPL17 gene segment 1855② (SEQ ID NO: 19) is CC, the genotype at position 122 of the CKX3 gene segment 1642① (SEQ ID NO: 20) is AA, and the origin of Fritillaria cirrhosa is Fritillaria taibaiensis;
[0135] The genotype at position 228 of the RPL17 gene segment 1855② (SEQ ID NO: 19) is CC, and the genotype at position 122 of the CKX3 gene segment 1642① (SEQ ID NO: 20) is GG. The origin of Fritillaria cirrhosa is Fritillaria thunbergii.
[0136] The genotype at position 228 of the RPL17 gene segment 1855② (SEQ ID NO: 19) was TC, and the genotype at position 112 of the CKX3 gene segment 1642③ (SEQ ID NO: 21) was TG, Fritillaria gansuensis;
[0137] The genotype at position 228 of the RPL17 gene segment 1855② (SEQ ID NO: 19) is TC, the genotype at position 112 of the CKX3 gene segment 1642③ (SEQ ID NO: 21) is GG, and the genotype at position 213 of the ILA gene segment 14943③ (SEQ ID NO: 21) is GG. The origin of Fritillaria cirrhosa is Fritillaria thunbergii.
[0138] The genotype at position 228 of the RPL17 gene fragment 1855② (SEQ ID NO: 19) is TC, the genotype at position 112 of the CKX3 gene fragment 1642③ (SEQ ID NO: 21) is GG, and the genotype at position 213 in the sequence of the DNA fragment 14943③ (SEQ ID NO: 21) is GA. The origin of Fritillaria cirrhosa is Fritillaria thunbergii.
[0139] In summary, the present invention discovered the relationship between one SNP site on a sequence in the RPL17 gene, a gene in the steroid alkaloid synthesis pathway of Fritillaria cirrhosa, two SNP sites on a sequence in the CKX3 gene, and one SNP site on a sequence in the ILA gene and the origin of Fritillaria cirrhosa. On this basis, the origin of Fritillaria cirrhosa can be identified by any reagent or equipment that detects the bases of any one or more of the above SNP sites.
Claims
1. A kit for identifying the origin of Fritillaria cirrhosa, characterized in that: The method comprises a reagent for detecting SNP sites of RPL17 gene segment 1855②, CKX3 gene segment 1642①, CKX3 gene segment 1642③ and ILA gene segment 14943③ of Fritillaria cirrhosa; The nucleotide sequence of the RPL17 gene segment 1855② is shown in SEQ ID NO: 19; The nucleotide sequence of the CKX3 gene fragment 1642① is shown in SEQ ID NO: 20; The nucleotide sequence of the CKX3 gene fragment 1642③ is shown in SEQ ID NO: 21; The nucleotide sequence of the ILA gene fragment 14943③ is shown in SEQ ID NO: 22; The SNP site is located at position 228 in the RPL17 gene segment 1855②, and its polymorphism is T / C; located at position 122 in the CKX3 gene segment 1642①, and its polymorphism is A / G; located at position 112 in the CKX3 gene segment 1642③, and its polymorphism is T / G; located at position 213 in the ILA gene segment 14943③, and its polymorphism is G / A.
2. The kit according to claim 1, wherein The reagents are: reagents for the KASP method or reagents for the restriction fragment length polymorphism method.
3. The kit according to claim 2, wherein The KASP method reagents include the following KASP primer set: The KASP primer set for detecting the RPL17 gene segment 1855② SNP site, whose nucleotide sequences are shown in SEQ ID NOs. 7-9; A KASP primer set for detecting the CKX3 gene segment 1642① SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 10-12; The KASP primer set for detecting the CKX3 gene segment 1642③ SNP site, whose nucleotide sequences are shown in SEQ ID NOs. 13-15; The KASP primer set for detecting the 14943③ SNP site of the ILA gene segment has nucleotide sequences shown in SEQ ID NOs. 16 to 18.
4. The kit according to claim 1, wherein It also includes reagents for amplifying sequences of RPL17 gene fragments, CKX3 gene fragments, and ILA gene fragments; The reagents for amplifying the RPL17 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 1 to 2; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 3 to 4; and the reagents for amplifying the ILA gene fragment sequence include the primer pairs shown in SEQ ID NOs: 5 to 6.
5. Use of the kit according to any one of claims 1 to 4 in identifying the origin of Fritillaria cirrhosa.
6. A method for identifying the origin of Fritillaria cirrhosa, characterized in that: The steps include: (1) Extracting total genomic DNA from Fritillaria cirrhosa samples; (2) Detect the 228th SNP site in the RPL17 gene segment 1855②, the 122nd SNP site in the CKX3 gene segment 1642①, the 112th SNP site in the CKX3 gene segment 1642③, and the 213th SNP site in the ILA gene segment 14943③, and analyze them; The nucleotide sequence of the RPL17 gene segment 1855② is shown in SEQ ID NO: 19; The nucleotide sequence of the CKX3 gene fragment 1642① is shown in SEQ ID NO: 20; The nucleotide sequence of the CKX3 gene fragment 1642③ is shown in SEQ ID NO: 21; The nucleotide sequence of the ILA gene fragment 14943③ is shown in SEQ ID NO: 22; The genotype of the SNP site at position 228 of the RPL17 gene segment 1855② is TT, and the origin of Fritillaria cirrhosa is Fritillaria wabuensis; The genotype of position 228 of the RPL17 gene segment 1855② is CC, the genotype of position 122 of the CKX3 gene segment 1642① is AA, and the origin of Fritillaria cirrhosa is Fritillaria taibaiensis; The genotype of position 228 of RPL17 gene segment 1855② is CC, the genotype of position 122 of CKX3 gene segment 1642① is GG, and the origin of Fritillaria cirrhosa is Fritillaria thunbergii. The genotype of position 228 of RPL17 gene segment 1855② is TC, the genotype of position 112 of CKX3 gene segment 1642③ is TG, and the origin of Fritillaria cirrhosa is Fritillaria dahurica; The genotype of position 228 of RPL17 gene segment 1855② is TC, the genotype of position 112 of CKX3 gene segment 1642③ is GG, the genotype of position 213 of ILA gene segment 14943③ is GG, and the origin of Fritillaria cirrhosa is Fritillaria thunbergii. The genotype of position 228 of RPL17 gene segment 1855② is TC, the genotype of position 112 of CKX3 gene segment 1642③ is GG, the genotype of position 213 in the sequence of ILA gene segment 14943③ is GA, and the origin of Fritillaria cirrhosa is Fritillaria curlifolia.
7. The method according to claim 6, wherein The steps of the detection in step (2) are as follows: Using the total genomic DNA extracted in step (1) as a template, PCR amplification is performed using an amplification reagent to obtain an amplified product; the amplified product is detected using a reagent using the KASP method, and the origin of Fritillaria cirrhosa is determined based on the fluorescence result; The amplification reagents include reagents for amplifying RPL17 gene fragment, CKX3 gene fragment and ILA gene fragment sequences; The reagents for amplifying the RPL17 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 1-2; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ ID NOs: 3-4; and the reagents for amplifying the ILA gene fragment sequence include the primer pairs shown in SEQ ID NOs: 5-6. In the amplified product, the RPL17 gene fragment sequence is 296 bp long, the CKX3 gene fragment sequence is 369 bp long, and the ILA gene fragment sequence is 294 bp long; The KASP method reagents include the following KASP primer set: The KASP primer set for detecting the RPL17 gene segment 1855② SNP site, whose nucleotide sequences are shown in SEQ ID NOs. 7-9; The KASP primer set for detecting the CKX3 gene segment 1642① SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 10-12; The KASP primer set for detecting the CKX3 gene segment 1642③ SNP site, whose nucleotide sequences are shown in SEQ ID NOs. 13-15; The KASP primer set for detecting the 14943③ SNP site of the ILA gene segment has nucleotide sequences shown in SEQ ID NOs. 16 to 18.
8. The method according to claim 7, wherein When amplified with the KASP primer set that detects the SNP site 1855② of the RPL17 gene segment, blue fluorescence was generated. The origin of Fritillaria cirrhosa is Fritillaria wabuensis. When amplified with the KASP primer set that detects the SNP site 1855② of the RPL17 gene segment, red fluorescence was produced. When amplified with the KASP primer set that detects the SNP site 1642① of the CKX3 gene segment, blue fluorescence was produced. The origin of Fritillaria cirrhosa is Fritillaria taibaiensis. When the KASP primers for detecting the SNP site 1855② of the RPL17 gene segment and the KASP primers for detecting the SNP site 1642① of the CKX3 gene segment were used for amplification, both produced red fluorescence, indicating that the origin of Fritillaria cirrhosa is Fritillaria thunbergii. When the KASP primers for detecting the SNP sites at 1855② of the RPL17 gene segment and the KASP primers for detecting the SNP sites at 1642③ of the CKX3 gene segment were used for amplification, both produced green fluorescence, indicating that the origin of Fritillaria cirrhosa is Fritillaria dahurica. When amplified with the KASP primer set that detects the SNP site at 1855② of the RPL17 gene segment, green fluorescence was produced; when amplified with the KASP primer set that detects the SNP site at 1642③ of the CKX3 gene segment, red fluorescence was produced; and when amplified with the KASP primer set that detects the SNP site at 14943③ of the ILA gene segment, blue fluorescence was produced. The origin of Fritillaria cirrhosa is dark purple Fritillaria. When amplification was performed using the KASP primer set that detected the 1855②SNP site of the RPL17 gene segment, green fluorescence was produced; when amplification was performed using the KASP primer set that detected the 1642③SNP site of the CKX3 gene segment, red fluorescence was produced; and when amplification was performed using the KASP primer set that detected the 14943③SNP site of the ILA gene segment, green fluorescence was produced. The origin of Fritillaria cirrhosa is Fritillaria thunbergii.
Citation Information
Patent Citations
SNP marker for identifying bulbus fritillariae cirrhosae medicinal material base stock and application thereof
CN118547095A
SNP (Single Nucleotide Polymorphism) molecular marker for identifying species of fritillaria wangsiensis and application thereof
CN119799969A