Bacillus cereus GX0003935 and application of bacillus cereus GX0003935 in prevention and treatment of elephant trunk bean root-knot nematode
By using the fermentation broth and fermentation filtrate of Bacillus cereus GX0003935 and its metabolites, the problem of preventing and treating elephant cerevisiae in the prior art was solved, efficient and environmentally friendly prevention and control effects were achieved, and plant root health was promoted.
Patent Information
- Application Number
- CN202510331308.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-06-10
AI Technical Summary
The prior art lacks effective green, environmentally friendly and efficient methods in preventing and controlling elephant bean root knot nematodes. The use of chemical nematodes has problems such as soil ecological environment damage, environmental pollution and increased nematode resistance.
Bacillus cereus GX0003935 and its metabolites were used to treat Bacillus cereus and fermentation filtrate to significantly reduce the number of root knots and inhibit the invasion of Elephant Bean Root Knot Nematode.
The fermentation broth and fermentation filtrate of Bacillus cereus GX0003935 can effectively kill elephant root knot nematodes, reduce the number of root knots, significantly inhibit nematode infection, and promote the healthy development of plant roots.
Smart Images

Figure CN120118792A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microbial applications, and particularly to a Bacillus cereus GX0003935 and its application in controlling Meloidogyne enterolobii. Background Art
[0002] In the field of agricultural production, root-knot nematode disease is a highly destructive plant parasitic nematode disease, posing a serious threat to crop yields and quality worldwide. According to statistics, the economic losses caused by root-knot nematode infestation reach billions of dollars annually, and with the development of protected agriculture and the aggravation of continuous cropping obstacles, the impact of this disease is becoming increasingly serious.
[0003] Meloidogyne enterolobii is widely distributed in warm and tropical regions. Compared with common species such as Meloidogyne incognita, it has stronger pathogenicity and a shorter generation alternation cycle. This nematode has no overwintering phenomenon in tropical and subtropical regions, has extremely strong reproductive ability, and a wide host range. More importantly, Meloidogyne enterolobii can survive on plants carrying nematode-resistant genes such as Mi-1 and N, breaking through the genetic resistance mechanisms of some crops. In addition, it is not parasitically inhibited by the biocontrol bacterium Pasteuria penetrans, further increasing the difficulty of its control.
[0004] When Meloidogyne enterolobii severely infests plants, the underground parts of the plants will form swollen root knots, and the above-ground parts will show growth retardation, yellowing, dwarfing, wilting, and even large-scale withering and death, seriously affecting crop yields and quality. In addition, this disease can also exacerbate the spread of bacterial diseases, further deteriorating the epidemic trend of soil-borne diseases. Recent studies have shown that Meloidogyne enterolobii is gradually replacing Meloidogyne incognita as the most infective root-knot nematode species in tropical and subtropical regions of China. However, the research on this disease is still not deep enough, lacking effective control strategies and prevention mechanisms.
[0005] Currently, chemical nematicides are still one of the main means for controlling root-knot nematodes. However, the long-term and large-scale use of chemical nematicides has many problems and limitations: 1. Destroying the soil ecological environment: Chemical agents will kill beneficial microorganisms in the soil, leading to an imbalance in the soil microbial community and affecting crop growth. 2. Environmental pollution: Some nematicides are difficult to degrade and may pollute water bodies, soil, and air, affecting the stability of the ecosystem. 3. Increased nematode resistance: The long-term use of a single chemical agent has led to the gradual development of resistance in root-knot nematodes, reducing the control effect. Therefore, the development of green, environmentally friendly, and efficient root-knot nematode control methods has become the core direction of agricultural research.
[0006] Bacillus spp. is a kind of beneficial microorganism widely distributed in soil, rhizosphere and phyllosphere of plants. Due to its excellent characteristics as follows, it shows great application potential in the field of biological control of plant diseases: High nematocidal activity: Some Bacillus spp. can secrete antibacterial peptides, proteases and toxins, directly inhibiting the growth and infection ability of nematodes; Environmentally friendly: As a biological control agent, Bacillus spp. has no chemical residues and will not pollute soil, water bodies and air, meeting the development trend of green agriculture; Promote plant health: Bacillus spp. can not only control nematodes, but also promote plant growth, enhance the disease resistance of crops, and improve agricultural production efficiency. Therefore, screening highly efficient biocontrol Bacillus strains is the key to developing new biological nematicides, which can provide safe and sustainable pest control solutions for agricultural production, contribute to the development of green agriculture, maintain ecological balance, and bring significant economic and social benefits. Summary of the Invention
[0007] The purpose of the present invention is to provide a Bacillus cereus GX0003935 and its application in controlling Meloidogyne enterolobii, so as to solve the problems existing in the above-mentioned prior art. The Bacillus cereus GX0003935 provided by the present invention has high insecticidal activity against Meloidogyne enterolobii, can significantly reduce the number of root knots of crops, has good control effect, and can be used as a new biological nematicide to provide a feasible solution for the green control of agricultural pests and diseases.
[0008] To achieve the above purpose, the present invention provides the following solutions:
[0009] The present invention provides a Bacillus cereus GX0003935, and the preservation number of the Bacillus cereus GX0003935 is CGMCC No. 33279. It was preserved in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on January 3, 2025, and the preservation address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
[0010] The present invention also provides a fermentation broth containing the Bacillus cereus GX0003935, and the preparation method of the fermentation broth includes the following steps:
[0011] Activate the Bacillus cereus GX0003935, and perform single colony culture, seed culture and scale-up culture on the activated Bacillus cereus GX0003935, and adjust OD 600 to 1.0, and that's it.
[0012] Preferably, the activation medium is LB medium; the single colony culture medium is NA plate; the seed culture and scale-up culture medium is NB medium.
[0013] The present invention also provides a fermentation filtrate of the Bacillus cereus GX0003935 as described above. The preparation method of the fermentation filtrate comprises the following steps:
[0014] Activate the Bacillus cereus GX0003935, perform single colony culture, seed culture and scale-up culture on the activated Bacillus cereus GX0003935, adjust OD 600 to 1.0, centrifuge to obtain the supernatant, and filter and sterilize it to obtain the product.
[0015] Preferably, the activation medium is LB medium; the single colony culture medium is NA plate; the seed culture and scale-up culture media are NB medium;
[0016] The filtration and sterilization is to filter the supernatant with a 0.22 μm filter membrane.
[0017] The present invention also provides an application of the Bacillus cereus GX0003935 as described above, or the fermentation broth or the fermentation filtrate in the preparation of a biological agent for controlling Meloidogyne enterolobii.
[0018] The present invention also provides a biological agent for controlling Meloidogyne enterolobii, and the active ingredient comprises the Bacillus cereus GX0003935 as described above, or the fermentation broth or the fermentation filtrate.
[0019] The present invention also provides an application of the Bacillus cereus GX0003935 as described above, or the fermentation broth or the fermentation filtrate or the biological agent in controlling Meloidogyne enterolobii.
[0020] The present invention also provides a method for controlling Meloidogyne enterolobii, which comprises the step of applying the Bacillus cereus GX0003935 as described above, or the fermentation broth or the fermentation filtrate or the biological agent to the rhizosphere soil of plants.
[0021] Preferably, the plant is Ipomoea aquatica.
[0022] The present invention discloses the following technical effects:
[0023] The present invention provides a strain of Bacillus cereus GX0003935, whose metabolites have a significant killing effect on the J2 larvae of Meloidogyne enterolobii. The experimental results show that after treatment, the J2 larvae become rigid, unresponsive to mechanical touch within 10 s, the contents in the larvae become vacuolated, and partial body walls show shrinkage and rupture, eventually leading to the overflow of the contents, indicating that the nematodes are dead. In addition, both the fermentation broth and fermentation filtrate treatment groups of Bacillus cereus GX0003935 can effectively reduce the number of root knots, and the root knot reduction rates reach 74.69% and 73.83% respectively, significantly inhibiting the infection of root-knot nematodes. The control effects of the two treatment methods are comparable, and compared with the positive control, the root systems of the plants in the treatment groups are in better condition, showing: thick rhizomes, developed root systems, and increased root numbers; uniform distribution of main roots and lateral roots, and coordinated ratio of main roots to lateral roots; increased root length, increased root branches, and developed fine roots.
[0024] The present invention proves the significant potential of Bacillus cereus GX0003935 and its metabolites in controlling Meloidogyne enterolobii, laying a solid foundation for the research and development of new and efficient biological nematicides. At the same time, this strain provides a green, safe and sustainable biological resource, which is expected to play an important role in the field of agricultural biological control, further promoting the research and product development process of Bacillus, and promoting the development of ecological agriculture and sustainable disease prevention and control technologies. Brief Description of the Drawings
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0026] Figure 1 It is a morphological observation result diagram of Bacillus cereus GX0003935; among them, A is the colony morphology of Bacillus cereus GX0003935; B is the observation result by scanning electron microscope; C is the Gram staining result (100× oil immersion lens); the fuchsin staining result (100× oil immersion lens); the scale in the figure is 10 μm;
[0027] Figure 2 It is a maximum likelihood tree diagram of Bacillus cereus GX0003935 based on the combined sequence of 16S rRNA and gyrB;
[0028] Figure 3 It is a comparison result diagram of the contact nematode killing activities of the bacterial suspension, fermentation filtrate and fermentation broth of Bacillus cereus GX0003935;
[0029] Figure 4 It is a diagram showing the treatment results of 20% NB and the J2 larvae of Meloidogyne enterolobii in GX0003935 objects;
[0030] Figure 5 It is a diagram showing the influence results of fermentation time on the nematicidal activity of the active substances of Bacillus cereus GX0003935;
[0031] Figure 6 It is a diagram showing the influence results of Bacillus cereus GX0003935 on Meloidogyne enterolobii in potted plants; among them, A shows the number of root knots and the control effect of plants after blank control, positive control and treatment with Bacillus cereus GX0003935; B shows the root knot situation of the roots in each treatment group; the detailed photos of the roots indicated by the dotted rectangles are presented separately on the right side; the white arrows indicate the root knots formed 45 days after cultivation. Detailed implementation manners
[0032] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be regarded as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.
[0033] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0034] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0035] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and embodiments of the present invention are only exemplary.
[0036] Regarding the terms "comprising", "including", "having", "containing", etc. used in this text, they are all open-ended terms, meaning including but not limited to.
[0037] The experimental materials used in the embodiments of the present invention: NB medium, LB medium and their corresponding solid media; the root-knot nematodes used were sourced from the Guangxi Key Laboratory of Polysaccharide Materials and Modifications, College of Ocean and Biotechnology, Guangxi University for Nationalities.
[0038] BPB medium: 5.0 g of beef extract, 10.0 g of peptone, 5.0 g of sodium acetate, 1 L of water, pH 7.0, autoclaved at 121 °C for 20 min.
[0039] Example 1 Isolation of Strain GX0003935
[0040] Soil was collected from Hainan Bawangling National Nature Reserve in Hainan Province (109°3′45″E, 18°35′37″N) for bacterial isolation. Weighed 2 g of soil sample and poured it into a fermentation flask containing 50 mL of BPB medium, and cultured it on a shaker at 30 °C and 180 r / min for 4 h. The culture was placed in a 75 °C water bath for 10 min to kill non-thermophilic bacteria. Then, 1 mL of the supernatant was taken and serially diluted 10-fold until the final dilution reached 10 -5 . 100 μL of the bacterial solution from each dilution was evenly spread on the surface of NB solid medium. Three replicates were set for each dilution, and cultured inverted at 30 °C for 3 d until colonies grew. According to the colony morphological characteristics, different single colonies were picked, numbered, and purified. A glycerol solution with a mass fraction of 30% was prepared and autoclaved at 121 °C for 20 min. The purified single colonies were scraped and added to the glycerol tube and mixed well, and the strain was stored at -80 °C to preserve the strain activity for a long time.
[0041] Example 2 Identification of Strain GX0003935
[0042] 1. Observation of Strain Morphology
[0043] The strain GX0003935 isolated in Example 1 was streaked on NB solid medium and cultured at 30 °C for 24 h. After obvious single colonies formed, the colony morphology was observed, including colony color, size, transparency, etc.
[0044] The steps of Gram staining are as follows: Take a small amount of bacteria and smear it on a glass slide, add a small amount of sterile water and mix well, heat-fix it over the flame of an alcohol lamp, then add crystal violet to cover the bacterial coating and stain for 1 min. After washing with water, add iodine solution to cover for 1 min, wash with water, then continuously rinse and decolorize with 95% ethanol until the flowing ethanol is colorless. After washing with water, cover with safranin solution for 2 min, wash with water and air-dry, and observe the bacterial morphology and staining results under a microscope.
[0045] The steps of spore staining are as follows: Fix the bacteria on the slide using the same method as Gram staining. After cooling, add carbol fuchsin staining solution and stain at room temperature for 60 s. Pour off the staining solution and wash with water until colorless. After drying, examine under the oil immersion lens to observe the spore staining situation.
[0046] The morphological observation results of strain GX0003935 are shown in Figure 1 , and the results show that the colonies of this strain on NB solid medium are white colonies with a slightly shiny, candle-like appearance. The edges of single colonies are neat, slightly raised in the middle, the texture of the colonies is soft, and the surface is rough. Optical microscope observation shows that the bacteria are rod-shaped, and the arrangement patterns include single and short chain-like. The Gram staining test is positive, indicating that this strain is a Gram-positive bacterium and has light pink spores.
[0047] 2. Physiological and biochemical characteristics
[0048] Refer to the "Manual for Systematic Identification of Common Bacteria" and the "Bergey's Manual of Determinative Bacteriology" to detect the physiological and biochemical characteristics of strain GX0003935, including catalase, anaerobic test, M.R. test, V-P determination, etc.
[0049] The analysis results of physiological and biochemical characteristics are shown in Table 1. The results show that this strain is an aerobic bacterium, the M.R. test is negative, and catalase, V-P determination, starch hydrolysis, gelatin liquefaction, nitrate reduction, citrate utilization test, and malonate utilization are all positive.
[0050] Table 1 Analysis results of physiological and biochemical characteristics
[0051]
[0052] 3. Molecular biology identification
[0053] Take an appropriate amount of GX0003935 bacteria into a 1.5 mL centrifuge tube, add 100 μL of 10% Chelex-100 solution, mix well by shaking, heat in a boiling water bath for 30 min to lyse the cells and release DNA, centrifuge at 12000 r / min for 10 min, and the supernatant is the DNA extraction solution for standby.
[0054] The primers for 16S rRNA gene amplification are:
[0055] 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1);
[0056] 1492R: ACGGCTACCTTGTTACGACTT (SEQ ID NO.2).
[0057] The primers for gyrB gene amplification are:
[0058] UP-1: ATTTGGCGCTGGCGGTTAT (SEQ ID NO.3);
[0059] UP-2r: GGTTTCGGCTGGGCTGGTA (SEQ ID NO.4).
[0060] PCR amplification was carried out using a 50 μL system. The amplification system was: PCR Mix (25 μL), ddH 2 O (22 μL), primers 27F / 1492R or UP-1 / UP-2r (1 μL each), and DNA template (1 μL).
[0061] PCR amplification program: 94 °C for 2 min; 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, 30 cycles; 72 °C for 2 min.
[0062] PCR products were detected by 1 g / L agarose gel electrophoresis to verify whether the amplification was successful. The PCR products were sequenced by Wuhan Aoke Dingsheng Biotechnology Co., Ltd. The obtained sequences were aligned by the BLAST program on NCBI, and the 16S rRNA and gyrB gene sequences of similar strains were downloaded. Subsequently, the obtained sequences were aligned using PhyloSuite v1.2.31 software; the incomplete sequences at both ends were removed, and the effective intervals were taken for splicing; a phylogenetic tree of the spliced sequences was constructed based on the maximum parsimony method (MP); Pseudomonas chlororaphis was selected as the outgroup for the construction of the dendrogram.
[0063] In the 16S rRNA gene sequence alignment results, due to the large number of highly similar strains and the inability to obtain more genetic marker sequences for most strains, the resolution of phylogenetic analysis was limited. Therefore, the present invention conducts phylogenetic analysis based on the gyrB gene sequence alignment. Since most gyrB similar strains also have 16S rRNA gene sequences, gyrB similar strains were selected as the tree-building group, and their 16S rRNA and gyrB gene sequences were downloaded for further analysis. During the sequence processing, first, the 16S rRNA and gyrB gene sequences were aligned, and the incomplete fragments at both ends were removed. Subsequently, the 16S rRNA and gyrB gene sequences of the same strain were spliced, and a phylogenetic tree was constructed using the maximum parsimony method, with the number of calculations set to 1000.
[0064] Phylogenetic analysis results ( Figure 2)The results showed that strain GX0003935 and Bacillus cereus EA-CB1047 were grouped into the same branch, indicating a high degree of evolutionary relationship between the two. Combining the morphological characteristics, physiological and biochemical properties of the strain and the results of molecular biological identification, strain GX0003935 was preliminarily identified as Bacillus cereus.
[0065] 4. Strain preservation
[0066] Bacillus cereus GX0003935 was deposited in the China General Microbiological Culture Collection Center on January 3, 2025. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No. 33279.
[0067] Example 3 Insecticidal activity of Bacillus cereus GX0003935 against second-stage juveniles of Meloidogyne enterolobii
[0068] 1. Preparation of Bacillus cereus GX0003935 bacterial suspension, fermentation broth and fermentation filtrate
[0069] Take the bacterial liquid from the glycerol tube of the preserved strain GX0003935, streak inoculate it on LB medium, and activate it overnight at 37°C; pick the activated strain, inoculate it onto NA plate, and culture it at 30°C until single colonies grow; pick the single colonies, inoculate them into 50 mL NB medium, and shake culture at 30°C and 180 r / min for 24 h to obtain the seed liquid. Inoculate the seed liquid into 50 mL NB medium at an inoculation amount of 1% (v / v), shake culture at 30°C and 180 r / min for 72 h, and adjust the OD 600 value to 1.0 to obtain the fermentation broth; centrifuge the fermentation broth at 8000 r / min for 10 min, take the supernatant, filter and sterilize it through a 0.22 μm disposable filter membrane to obtain the fermentation filtrate; resuspend the bacterial cell precipitate with sterilized water to adjust the bacterial concentration to 3.57×10 8 CFU / mL (OD 600 = 1.0). The bacterial suspension, fermentation broth and fermentation filtrate were respectively aliquoted into sterilized EP tubes and stored at -20°C for later use.
[0070] 2. Culture of second-stage juveniles of Meloidogyne enterolobii
[0071] Artificial rearing of *Meloidogyne enterolobii*: The water spinach seedlings were cultivated to a height of 15 - 20 cm, transplanted into the soil infected with *Meloidogyne enterolobii*, and continued to be cultivated for 30 days. The diseased roots of the infected water spinach were collected, and the roots were rinsed with clean water until no soil residue remained. The mature egg sacs were collected, disinfected in 0.5% sodium hypochlorite solution for 5 minutes, and then washed repeatedly with sterile water. The egg masses were picked out, incubated at room temperature for 2 - 3 days, and the second-stage juveniles (J2) of *Meloidogyne enterolobii* were observed and picked out under a dissection microscope for bioactivity determination.
[0072] 3. Comparison of the contact nematocidal activities of the bacterial suspension, fermentation broth, and fermentation filtrate of *Bacillus cereus* GX0003935
[0073] In a six-well plate, 200 μL of the bacterial suspension / fermentation broth / fermentation filtrate of strain GX0003935, 600 μL of sterile water, and 200 μL of the nematode suspension (containing 30 J2 larvae) were added in sequence, and mixed well to make the dilution factor of the bacterial suspension / fermentation broth / fermentation filtrate 5 times; 20% NB medium was used as the control group. It was placed in an incubator at 25°C for 6 days, and the experimental data were observed and recorded every day. Each treatment was repeated 3 times, and 3 biological replicates were carried out to ensure the reliability of the data. The J2 larvae were considered dead when their bodies were rigid and had no response to mechanical touch within 10 s, and the mortality rate and corrected rate were calculated. The calculation formulas are as follows:
[0074]
[0075] The nematocidal activity (NA) was classified according to the following criteria: NA ≥ 80% was considered to have strong nematocidal activity, 50% ≤ NA < 80% was considered to have moderate nematocidal activity, 20% ≤ NA < 50% was considered to have weak nematocidal activity, and NA < 20% was considered to have no nematocidal activity.
[0076] Figure 3 It shows the dynamic change trend of the contact nematocidal activities of each component of *Bacillus cereus* GX0003935 against J2 larvae. The experimental results showed that the corrected mortality rates of the fermentation filtrate and fermentation broth treatment groups increased rapidly and approached 100% after 2 days of action, and then remained stable. This indicates that the fermentation filtrate and fermentation broth contain substances with high contact nematocidal activity against nematodes and can significantly affect J2 larvae in a short time.
[0077] In contrast, the corrected mortality rate of the bacterial suspension treatment group remained low within 6 days and showed little change, remaining below 20%. This result indicates that compared with the fermentation filtrate and the fermentation broth, the contact-killing ability of the bacterial suspension itself is weak, and the active ingredients it contains have an insignificant lethal effect on nematodes. Therefore, it can be preliminarily speculated that in the fermentation broth system, the main ingredient responsible for nematode killing is the fermentation filtrate, and the best effect can be achieved after 2 days of treatment. This further implies that the bacterial metabolites contained in the fermentation filtrate are very likely the key substances responsible for the contact-killing activity against nematodes. Considering all factors, to ensure the efficiency and accuracy of subsequent nematode contact-killing experiments, the fermentation filtrate was used in all subsequent bioassay experiments, and the contact-killing effect of nematodes was observed after 2 days of treatment.
[0078] Figure 4 The microscopic observation results of the treatment of nematodes with Bacillus cereus GX0003935 are shown. The experiment shows that the dead J2 larvae are stiff and unresponsive to mechanical touch within 10 seconds; vacuolization appears in the body contents, presumably due to severe disruption of intracellular material metabolism and biosynthesis pathways; partial body walls are shrunken and ruptured, resulting in the spillage of contents, indicating damage to the cell membrane integrity. In contrast, the surviving J2 larvae in the 20% NB treatment group have a naturally curved body, are flexible and unaffected.
[0079] Based on the above results, it is speculated that the metabolites in the fermentation filtrate of Bacillus cereus GX0003935 may achieve the effect of efficiently killing nematodes by interfering with the physiological metabolism process of nematodes, destroying their cell structure, or affecting their nervous system function.
[0080] 4. Optimal fermentation time of nematode-killing active substances of Bacillus cereus GX0003935
[0081] The optimal growth temperature of Bacillus cereus GX0003935 is 30 °C. It was inoculated into NB medium at an inoculum volume fraction of 1%, and the fermentation filtrates cultured for 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h were taken for nematode-killing activity determination respectively. Each treatment was repeated 3 times, and 3 parallel tests were carried out to ensure the accuracy of the experimental data.
[0082] Figure 5The effect of fermentation time on the nematicidal activity of metabolites produced by Bacillus cereus GX0003935 was shown. Initial stage of cultivation (12 - 48 h): The corrected mortality rate of nematodes increased rapidly with the cultivation time, rising from about 70% to nearly 100%, indicating that active substances gradually accumulated during this stage and achieved a relatively high nematicidal effect. 48 h - 120 h: The corrected mortality rate of nematodes tended to be stable, maintaining at nearly 100% with little fluctuation, indicating that the accumulation of active substances reached saturation and the insecticidal activity remained at a high level. After 60 h and 72 h: The strain entered the late growth stage, and the nematicidal activity decreased slightly, possibly due to changes in secondary metabolites, resulting in the degradation or inactivation of some active substances. Considering comprehensively, 48 h is the optimal fermentation time for Bacillus cereus GX0003935. At this time, the active metabolites are sufficiently accumulated, the nematicidal effect is the best, and the reduction in activity caused by over - long cultivation is avoided.
[0083] Example 4 Control effect of Bacillus cereus GX0003935 in pot experiments
[0084] The water spinach seedlings were grown until they had two leaves and one heart and were then set aside. Seedlings with consistent growth were selected and transplanted into flower pots containing 500 g of mixed soil (including 300 g of substrate nutrient soil and 200 g of nematode - containing soil), with 1 plant per pot.
[0085] Bacillus cereus GX0003935 was fermented for 48 h and the OD was adjusted 600 ≈1.0. The experimental settings included the fermentation broth diluted 5 - fold and the fermentation filtrate diluted 5 - fold; the blank control group was the sterilized NB medium diluted 5 - fold, and the positive control group was the 41.7% fluxapyroxad suspension concentrate (SC) diluted 1500 - fold. 50 mL of the test solution was added to each pot. Each treatment had 7 replicates, and the treatment groups were watered on the 1st, 15th, and 30th days. The number of root - knots of each plant was counted on the 45th day, and the control effect was calculated. The calculation formula for the control effect is as follows:
[0086]
[0087] The results of the pot experiments for each treatment after 45 d are as Figure 6 shown. Figure 6 Figure A shows the number of root - knots and the control effect of different treatment groups. Compared with the blank control, the root - knots of the positive control were almost completely inhibited, and the number of root - knots in the treatment groups with the fermentation broth and fermentation filtrate of Bacillus cereus GX0003935 decreased significantly, with the control rates reaching 74.69% and 73.83% respectively, indicating that both could effectively inhibit the infection of root - knot nematodes and the control effects were comparable. Figure 6Figure B shows the effects of different treatments on the roots of plants infected with root-knot nematodes. The root knots in the blank control group were obvious and numerous, and the root system morphology was severely damaged, indicating that root-knot nematodes had a significant impact on the root system. Compared with the positive control, the root systems in the treatment groups with the fermentation broth and fermentation filtrate of Bacillus cereus GX0003935 were in better condition. Both showed thick rhizomes, well-developed root systems, a large number of roots, uniform distribution of main roots and lateral roots, long root lengths, an appropriate ratio of main roots to lateral roots, and well-developed root branches and fine roots, showing strong growth advantages.
[0088] Comprehensively Figure 6 Based on the results of Figures A and B, both the fermentation filtrate and fermentation broth of Bacillus cereus GX0003935 had good control effects on Meloidogyne enterolobii, and there was no significant difference between the two, further verifying the control effect of the fermentation filtrate.
[0089] The embodiments described above are only used to describe the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A strain of Bacillus cereus GX0003935, characterized in that: The deposit number of the Bacillus cereus GX0003935 is CGMCC No.33279, and it was deposited in the General Microbiology Center of the China Culture Collection Administration on January 3, 2025. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
2. A fermentation broth containing the Bacillus cereus GX0003935 according to claim 1, characterized in that: The method for preparing the fermentation broth comprises the following steps: The Bacillus cereus GX0003935 is activated, and the activated Bacillus cereus GX0003935 is subjected to single colony culture, seed culture and expansion culture, and the OD 600 is 1.0, that is.
3. The fermentation broth according to claim 2, characterized in that The activated culture medium is LB culture medium; the culture medium for single colony culture is NA plate; the culture medium for seed culture and expansion culture is NB culture medium.
4. A fermentation filtrate of Bacillus cereus GX0003935 according to claim 1, characterized in that: The method for preparing the fermentation filtrate comprises the following steps: The Bacillus cereus GX0003935 is activated, and the activated Bacillus cereus GX0003935 is subjected to single colony culture, seed culture and expansion culture, and the OD 600 The concentration of 1.0 was 1.0, the supernatant was obtained by centrifugation, and then sterilized by filtration.
5. The fermentation filtrate according to claim 4, characterized in that The activated culture medium is LB culture medium; the culture medium for single colony culture is NA plate; the culture medium for seed culture and expansion culture is NB culture medium; The filtration sterilization is to filter the supernatant using a 0.22 μm filter membrane.
6. Use of the Bacillus cereus GX0003935 according to claim 1, the fermentation liquid according to claim 2 or 3, or the fermentation filtrate according to claim 4 or 5 in preparing a biological agent for controlling root-knot nematodes of elephant ear beans.
7. A biological agent for controlling root-knot nematodes of elephant ear beans, characterized in that: The active ingredient comprises the Bacillus cereus GX0003935 according to claim 1 or the fermentation broth according to claim 2 or 3 or the fermentation filtrate according to claim 4 or 5.
8. Use of the Bacillus cereus GX0003935 according to claim 1, the fermentation liquid according to claim 2 or 3, the fermentation filtrate according to claim 4 or 5, or the biological preparation according to claim 7 in controlling root-knot nematodes of elephant ear beans.
9. A method for controlling root-knot nematodes of elephant ear beans, characterized in that: The method comprises the step of applying the Bacillus cereus GX0003935 of claim 1 or the fermentation broth of claim 2 or 3 or the fermentation filtrate of claim 4 or 5 or the biological preparation of claim 7 to the rhizosphere soil of plants.
10. The method according to claim 9, characterized in that The plant is water spinach.