Non-specific nuclease dsNuc354 from deep sea and application

Abstract

The invention belongs to the technical field of enzyme engineering and metagenomics, and relates to non-specific nuclease dsNuc354 from deep sea and application thereof. The amino acid sequence of the enzyme is shown as SEQ ID NO.1 in a sequence table. The non-specific nuclease dsNuc354 provided by the invention has relatively high activity and stability, can efficiently catalyze DNA and RNA substrates under the condition of 40 DEG C, is derived from deep sea metagenome data mining, is a brand new nuclease, and shows unique deep sea adaptability.

Description

Technical Field

[0001] The present invention belongs to the technical fields of enzyme engineering and metagenomics, and relates to a non-specific nuclease dsNuc354 derived from the deep sea and its uses. Background Art

[0002] As an important biocatalyst, nucleases play a key role in multiple fields such as biopharmaceuticals, food processing, environmental governance, and the feed industry. They are mainly divided into endonucleases and exonucleases, which are responsible for degrading nucleic acids from the inside or end of nucleic acid molecules respectively. In the field of biopharmaceuticals, nucleases are used to remove nucleic acid contamination in recombinant protein production, improving purity and production efficiency; in the food industry, they can be used to produce 5'-flavor nucleotides to improve food flavor; in environmental governance, nucleases help degrade microbial residues in wastewater and improve resource utilization rate. In addition, in the feed industry, nucleases can reduce the content of high-molecular nucleic acids in feed, improve the absorption efficiency of animals for nutrients, and promote the growth of livestock and poultry.

[0003] With the development of biotechnology, important progress has been made in the research of nucleases. Scientists have optimized their activity, stability, and tolerance through genetic engineering and protein engineering. Nucleases with extreme environmental adaptability are screened from deep-sea metagenomes to explore their catalytic characteristics under conditions such as low temperature, high temperature, and high salt. Currently, there are still research gaps in this field. By tapping the potential of these special nucleases, efficient biocatalytic tools can be provided for biomass conversion, biopharmaceuticals, and environmental governance, promoting their wide application in the industrial field. Summary of the Invention

[0004] The object of the present invention is to fill the gaps in the existing technology and provide a non-specific nuclease dsNuc354 mined and identified from the deep-sea hydrothermal vent metagenome. This enzyme is a brand-new enzyme resource obtained through metagenomic data mining and functional identification, and its optimal reaction temperature is 40°C.

[0005] To achieve the above object, the technical solution adopted by the present invention is: a non-specific nuclease dsNuc354 derived from the deep sea, whose amino acid sequence is shown in Sequence Listing SEQ ID NO.1.

[0006] Preferably, the nucleotide sequence of the gene encoding the non-specific nuclease dsNuc354 is shown in Sequence Listing SEQ ID NO.2.

[0007] Preferably, the present invention also provides an expression vector containing the gene, and the expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector, or a viral vector.

[0008] Preferably, the present invention also provides a host cell comprising the expression vector, wherein the host cell is a bacterium.

[0009] Preferably, the present invention also provides an engineered strain, which comprises the gene or expression vector.

[0010] The present invention also provides the use of the non-specific nuclease dsNuc354, which is used for degrading DNA or RNA, and has an optimum temperature of 40°C.

[0011] The present invention further provides the use of the expression vector, gene, host cell and engineering strain in preparing the non-specific nuclease dsNuc354.

[0012] The non-specific nuclease dsNuc354 provided by the present invention has higher activity and stability than the reported nucleases, and can efficiently catalyze DNA and RNA substrates at 40°C, which is a rare feature among similar enzymes. In addition, it is derived from deep-sea metagenome data mining and is a new nuclease that exhibits unique deep-sea adaptability. This feature makes it particularly suitable for temperature-sensitive industrial applications, such as food processing, biomedicine, and nucleic acid degradation in marine environments, broadening the application potential of nucleases under extreme conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the pET22b plasmid map for expressing dsNuc354 in the examples of the present invention; Figure 2 is the SDS-PAGE analysis result of purified dsNuc354; wherein, M is a protein marker; 1 is purified dsNuc354; Figure 3 Schematic diagram of the spectrophotometric method for determining nuclease activity; Figure 4 Comparison of the activities of dsNuc354 and NUC1 catalyzing different substrates. DETAILED DESCRIPTION

[0014] In order to facilitate the understanding of this study, the following is a more detailed description of this study in conjunction with the accompanying drawings and specific embodiments. However, this study can be implemented in many different forms and is not limited to the embodiments described in this specification. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of this study more thorough and comprehensive.

[0015] The present invention screens from deep-sea metagenomes and obtains a non-specific nuclease, named dsNuc354, which can non-specifically hydrolyze DNA and RNA. The amino acid sequence of this enzyme is shown in Sequence Listing SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in Sequence Listing SEQ ID NO.2.

[0016] The following conducts tests and verifications on the functional characteristics and catalytic activity of this enzyme through experiments.

[0017] I. Preparation of the substrate of dsNuc354 Weigh 0.015 g of calf thymus DNA (D4522, Merck, Darmstadt, Germany), accurate to 0.0001 g, dissolve it in water to make its solution concentration 0.15 mg / ml, and prepare it freshly for use as the reaction DNA substrate for the DNA / RNA non-specific nuclease. Weigh 0.015 g of yeast RNA (R6750, Merck, Darmstadt, Germany), accurate to 0.0001 g, dissolve it in water to make its solution concentration 0.15 mg / ml as the reaction RNA substrate for the DNA / RNA non-specific nuclease.

[0018] II. Preparation of the reaction buffer of dsNuc354 Weigh 121.14 g of Tris (tris(hydroxymethyl)aminomethane) into a beaker, add about 800 mL of distilled water to dissolve it fully, transfer it to a 1 L volumetric flask, adjust the pH to 8.0 ± 0.05 with hydrochloric acid (0.1 mol / L), and finally make up the volume with distilled water and shake well.

[0019] III. Analysis of the dsNuc354 gene and protein sequence To determine the novelty of the dsNuc354 amino acid sequence, the present invention searches for its homologous proteins in GenBank through online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and arranges them according to sequence similarity. As shown in Table 1, among the top 10 proteins with the highest sequence identity, the first sequence is the dsNuc354 of the present invention, and this sequence is derived from the MAG database. However, this MAG sequence is only the result of metagenomic data assembly and has not been experimentally verified, and its function, enzymatic properties, and industrial application potential have not been publicly disclosed. The present invention has for the first time carried out cloning, expression, and functional verification, and has detailedly determined its enzymatic characteristics, proving that this enzyme has significant catalytic activity and stability under specific conditions, providing an experimental basis for its potential value in the fields of biocatalysis, industrial applications, etc., and for the first time revealing its biological function and application value, with important novelty.

[0020] Table 1. Protein sequences with high consistency with dsNuc354 in GeneBank GeneBank accession number Amino acids length Identity (%) MCD6596354.1 237 100.00 (MAG) MCD4805331.1 237 89.03 MDL1984439.1 237 87.34 MCK5306360.1 237 86.92 MEE9443692.1 232 86.64 MCH7773284.1 237 83.97 UCC45508.1 237 83.12 MCP4154154.1 237 82.28 HEB93211.1 237 81.86 HEB55526.1 237 81.43 。

[0021] 1. Cloning of dsNuc354 gene The full gene was synthesized based on the dsNuc354 amino acid sequence and codon-optimized for E. coli expression. The synthesized sequence is shown in SEQ ID NO.1 in the sequence listing. The dsNuc354 gene fragment was amplified using Nuc-F and Nuc-R as primers. Using pET22b as a template, pET22b was linearly amplified with 22b-F and 22b-R as primers. The primer sequences are shown in Table 2. The PCR amplification conditions were: 98°C for 30 seconds; 98°C for 10 seconds, 56°C for 5 seconds, 72°C for 10 seconds, for 35 cycles; 72°C for 1 minute, and then cooled to 4°C for storage.

[0022] Table 2. Primers for cloning dsNuc354 into pET22b and their sequences Primer Primer sequence (5’ - 3’) Serial number Nuc-F ctgcccagccggcgatggccAATTCACCCAACCTAAAAAGGGA SEQ ID NO.3 Nuc-R cagtggtggtggtggtggtgCCACATGCGACGCACACG SEQ ID NO.4 22b-F CACCACCACCACCACCACTG SEQ ID NO.5 22b-R GGCCATCGCCGGCTGGGC SEQ ID NO.6 。

[0023] 2. Construction of expression vector and engineering strain The obtained dsNuc354 fragment was ligated with the linearized pET22b vector fragment using a seamless cloning kit (ClonExpress II One Step Cloning Kit, Novoprotein, Nanjing) to form the expression vector pET22b-dsNuc354, and the map is as Figure 1 shown, and transformed into the E. coli expression strain Escherichia coli BL21(DE3) pLysS to obtain the expression strain E. coli dsNuc354. The strain E. coli dsNuc354 expresses a fusion protein with a pelB signal peptide at the N-terminus and a His tag at the C-terminus, and dsNuc354 can be obtained by Ni-NTA affinity chromatography for activity detection.

[0024] 3. Expression and purification of dsNuc354 Pick E. coli dsNuc354 monoclonal colonies into the medium (containing 50 μg / mL ampicillin and 20 μg / ml chloramphenicol double resistance) for seed culture, and culture in a shaker at 37°C and 220 rpm for 8 - 12 h; the expansion culture ratio is 1:500 - 1:100, and culture in a shaker at 37°C and 220 rpm for about 4 - 6 hours. When OD 600When it reaches 0.8 - 1.2, add IPTG to start induction. The final concentration of IPTG can be 0.2 - 1 mM. The induction conditions are 18 - 30 °C for 18 - 24 h. Centrifuge the induced bacterial solution at 4 °C at 3000 - 6000 g for 10 minutes to collect the bacteria.

[0025] Resuspend the collected bacteria in 50 mL of pre - cooled lysis buffer, and use an ultrasonic crusher to lyse the bacteria in an ice bath. The lysis program is a power of 290 W, ultrasonic disruption for 4 s, stop for 8 s, and the total ultrasonic duration is 15 min. Centrifuge at 4 °C at 13000 g for 60 min to take the supernatant. Incubate the supernatant with 3 mL of Ni - NTA resin at 4 °C for 1 hour to allow the target protein to fully bind to the resin. Wash successively with 15 mL of lysis buffer and 15 mL of wash buffer, and elute and collect the target protein with 5 mL of elution buffer. Concentrate the eluate to 2.5 mL using an Ultracel - 30K ultrafiltration tube. Equilibrate the desalting column PD - 10 with 25 mL of desalting buffer, add 2.5 mL of the concentrated protein solution to the desalting column PD - 10, add 3.5 mL of desalting buffer to collect the protein, and the collected effluent is dsNuc354. Concentrate dsNuc354 to 1 mL using an Ultracel - 30K ultrafiltration tube, measure the absorbance at 280 nm with a micro - spectrophotometer to determine the concentration of the purified protein, and take 5 μL of the protein for SDS - PAGE detection. The detection results are as Figure 2 shown. The remaining protein is quickly frozen with liquid nitrogen and stored at - 80 °C.

[0026] The formulations of each buffer for the above protein purification are as follows: Lysis buffer (1 L): 7.8 g of NaH 2 PO 4 ·3H 2 O, 17.532 g of NaCl, 100 g of glycerol, 0.6808 g of imidazole, pH 8.0.

[0027] Wash buffer (1 L): 7.8 g of NaH 2 PO 4 ·3H 2 O, 17.532 g of NaCl, 100 g of glycerol, 1.3616 g of imidazole, pH 8.0.

[0028] Elution buffer (1 L): 7.8 g of NaH 2 PO 4 ·3H2 O, 17.532 g of NaCl, 100 g of glycerol, 17.02 g of imidazole, pH 8.0.

[0029] Desalting buffer (1 L): 7.8 g of NaH 2 PO 4 ·3H 2 O, 17.532 g of NaCl, 100 g of glycerol, pH 8.0.

[0030] IV. Hydrolysis reaction of dsNuc354 on DNA and RNA at different temperatures For the determination of nuclease activity, calf thymus DNA and yeast RNA are used as substrates. After the substrates are hydrolyzed, the nucleic acid structure disintegrates, the base stacking effect decreases, the ultraviolet absorption of single-stranded or single nucleotides increases, and at the same time, the degraded DNA and RNA are fragmented, and the exposure of bases also causes an increase in absorption. The enzyme activity is compared by measuring the increment of the absorption peak at 260 nm. The process is as Figure 3 shown.

[0031] In the present invention, the enzyme activity is determined by spectrophotometry. The specific method is as follows: At pH 8.0 and 40 °C, a 3 ml reaction system includes 0.5 mL of appropriately diluted enzyme solution, 1.5 mL of nuclease substrate, and 1 mL of buffer. After reacting for 10 min, the absorbance value of the sample is measured at a wavelength of 260 nm. The blank control group is at pH 8.0 and 40 °C. First, 0.5 mL of water is added, then 1.5 mL of nuclease substrate is supplemented, and finally 1 mL of buffer is added. After water bath for 10 min, the absorbance value of the sample is measured at a wavelength of 260 nm. One enzyme activity unit (U) is defined as the amount of enzyme required to increase the absorbance of the reaction solution at 260 nm by 0.001 within 1 min under the conditions of 40 °C and pH 8.0.

[0032] One of the most representative proteins of DNA / RNA non-specific nucleases is NUC1, which was isolated from Serratiamarcescens , and showed high activity towards both DNA and RNA substrates. In this example, calf thymus DNA and yeast RNA were used as reaction substrates respectively to compare the activities of dsNuc354 and NUC1. 0.5 mL of dsNuc354 and NUC1 were incubated with 1.5 mL of DNA and RNA substrates respectively at pH 8.0 and 40 °C together with 1 mL of buffer for 10 min, and then the absorbance value of the sample was measured at a wavelength of 260 nm. The nuclease activity was calculated according to Equation 1.

[0033] The calculation formula for nuclease activity is as follows: Equation 1; Wherein, is the nuclease activity, U / mL; is the absorbance difference measured at 260 nm between the test tube and the blank control tube; is the dilution factor; 1000 is the conversion coefficient between the original absorbance value and the specified absorbance of 0.001 in the activity regulation; 10 is the conversion coefficient between the reaction time and the activity unit definition.

[0034] The reaction results are as Figure 4 shown. dsNuc354 showed activities against both DNA and RNA substrates, reaching 192.31 U / mg and 294.87 U / mg respectively, and NUC1 was 336.28 U / mg and 287.63 U / mg. This result demonstrates the great application potential of dsNuc354 in the food processing and biomass conversion industries.

Claims

1. A non-specific nuclease dsNuc354 from deep sea, characterized in that: The amino acid sequence is shown in the sequence listing SEQ ID NO.

1.

2. The gene encoding the non-specific nuclease dsNuc354 according to claim 1, characterized in that: The nucleotide sequence is shown in the sequence listing SEQ ID NO.

2.

3. An expression vector comprising the gene according to claim 2, characterized in that: The expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector or a viral vector.

4. A host cell comprising the expression vector according to claim 3, characterized in that: The host cell is a bacterium.

5. An engineered strain, characterized in that: The engineered strain comprises the gene according to claim 2 or the expression vector according to claim 3.

6. The use of the non-specific nuclease dsNuc354 according to claim 1, characterized in that: This nuclease is used to degrade DNA or RNA, and its optimal temperature is 40°C.

7. Use of the gene according to claim 2, the expression vector according to claim 3, the host cell according to claim 4 or the engineered strain according to claim 5 in preparing the non-specific nuclease dsNuc354.

Images