Sephatase dsGlu950 from deep sea and application thereof

Abstract

The invention belongs to the technical field of enzyme engineering and metagenomics, and relates to dextranase dsGlu950 from deep sea and application of the dextranase dsGlu950. The amino acid sequence of the enzyme is shown as SEQ ID NO.1 in a sequence table. The dextranase dsGlu950 from the deep sea, provided by the invention, can be used for effectively catalyzing a beta-glucan substrate in an environment of 30-80 DEG C so as to generate reducing sugar. The wide temperature adaptability enables the catalyst to be better suitable for extreme industrial application scenes, optimization of an existing industrial process can be promoted, possibility is provided for development of a new bioconversion technology, and therefore the catalyst has important significance in the fields of food processing and biomass catalysis.

Description

Technical Field

[0001] The present invention belongs to the technical fields of enzyme engineering and metagenomics, and relates to a dextranase dsGlu950 derived from the deep sea and its uses. Background Art

[0002] In the field of biomass conversion, β-1,3-dextranase, as an important biocatalyst, plays a crucial role. This enzyme can efficiently decompose dextran in the cell wall, providing a basis for subsequent bioconversion processes. Dextranases are mainly divided into endoenzymes and exoenzymes, which are responsible for cleaving the inside and ends of dextran respectively, thereby decomposing it into smaller sugar molecules. Among them, the endoenzyme hydrolyzes β-1,3-dextran from the inside of the sugar chain, exerting the main hydrolytic activity, while the exoenzyme hydrolyzes β-1,3-dextran substrates one by one from the non-reducing end of the sugar chain, playing a certain auxiliary role.

[0003] The potential of dextranase in industrial applications is gradually being explored, providing raw materials for the production of biofuels and other industrial processes. In the paper industry, dextranase can convert xylan in paper industry, fertilizers and agricultural waste into xylose monomers, and then into fuel. In the textile industry, dextranase can be used for degumming treatment of fibers to improve the softness and spinnability of fibers. The application of dextranase in the food industry and feed industry is also relatively extensive. In the food industry, due to the presence of dextran, the extraction rate of the sugar industry is reduced, and losses are caused by the increase in the residual sucrose content in molasses. Using dextranase to treat dextran in the decoction can effectively reduce sugar losses; in addition, in the beer brewing process, dextranase can be used to reduce the viscosity of wort, improve the filtration performance, increase the malt dissolution rate, prevent beer turbidity, and stabilize the beer quality. In the feed industry, dextranase in feed can be used to reduce the content of non-starch polysaccharides and their anti-nutritional factors, improve the absorption of nutrients by livestock and poultry, and increase the growth rate and feed conversion efficiency of livestock and poultry.

[0004] With the continuous development of biotechnology, significant progress has been made in the research and improvement of dextranase. Through genetic engineering and protein engineering means, scientists have developed a variety of highly efficient and stable dextranases, which not only have significantly improved activity and stability, but also perform well in heat resistance and stress resistance. There is currently a blank in dextranases that can exhibit high activity under extreme temperature conditions such as low temperature and high temperature. Summary of the Invention

[0005] The object of the present invention is to fill the blank in the existing technology and provide a dextranase dsGlu950 mined and identified from the deep-sea hydrothermal vent metagenome, which can effectively catalyze β-dextran substrates to generate reducing sugars in an environment of 30 - 80°C.

[0006] To achieve the above object, the technical solution adopted by the present invention is: a dextranase dsGlu950 derived from the deep sea, whose amino acid sequence is shown in Sequence Listing SEQ ID NO.1.

[0007] Preferably, the nucleotide sequence of the gene encoding the dextranase dsGlu950 is shown in Sequence Listing SEQ ID NO.2.

[0008] Preferably, the present invention also provides an expression vector containing the gene, and the expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector or a viral vector.

[0009] Preferably, the present invention also provides a host cell containing the expression vector, and the host cell is a bacterium.

[0010] Preferably, the present invention also provides an engineered strain, and the engineered strain contains the gene or the expression vector.

[0011] The present invention also provides the use of the dextranase dsGlu950 in catalyzing β - glucan substrate to generate reducing sugar in an environment of 30 - 80 °C.

[0012] The present invention further provides the use of the expression vector, the gene, the host cell, and the engineered strain in the preparation of dextranase dsGlu950.

[0013] The dextranase dsGlu950 derived from the deep sea provided by the present invention can effectively catalyze β - glucan substrate to generate reducing sugar in an environment of 30 - 80 °C. Its broad temperature adaptability enables it to better apply to relatively extreme industrial application scenarios, which can not only promote the optimization of existing industrial processes, but also provide the possibility for the development of new biotransformation technologies. Therefore, the present invention has important significance in the fields of food processing and biomass catalysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is the plasmid map of pET22b expressing dsGlu950 in the embodiment of the present invention; Figure 2 It is the SDS - PAGE analysis result of purified dsGlu950; among them, M is the protein marker; 1 is the purified dsGlu950; Figure 3 It is the schematic diagram of determining dextranase activity by DNS method; Figure 4 It is the standard curve of glucose solution; Figure 5 It is the enzyme activity of dsGlu950 at different temperatures; Figure 6Activity comparison of dsGlu950 catalyzing different substrates. Detailed implementation mode

[0015] To facilitate the understanding of this research, the following will combine the accompanying drawings and specific embodiments to explain this research in more detail. However, this research can be implemented in many different forms and is not limited to the embodiments described in this specification. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosed content of this research more thorough and comprehensive.

[0016] This invention screens from deep-sea metagenomes and obtains a glucanase named dsGlu950, which can specifically hydrolyze β-1,3-glycosidic bonds. The amino acid sequence of this enzyme is shown in Sequence Listing SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in Sequence Listing SEQ ID NO.2.

[0017] The following conducts tests and verifications on the functional characteristics and catalytic activities of this enzyme through experiments.

[0018] I. Preparation of the substrate of dsGlu950 Laminarin (L9634, Merck, Darmstadt, Germany) is used to verify the function of dsGlu950, and an acidic buffer solution with a pH of 4.8 is used to dissolve the laminarin substrate. Weigh 0.2 g of the laminarin substrate into a beaker, add 20 mL of the acidic buffer solution, place it in an 80°C water bath with magnetic stirring until the laminarin is completely dissolved, then stop heating and continue stirring until it cools down, and make up the volume to 2.5 mL with the acidic buffer solution to make its final concentration 8 mg / mL.

[0019] Preparation of the acidic buffer solution: Weigh 176.52 g of disodium hydrogen phosphate dodecahydrate and 53.26 g of citric acid monohydrate into a beaker, add about 800 mL of distilled water and dissolve it fully, then transfer it to a 5 L volumetric flask, adjust the pH to 4.8 ± 0.05 with sodium hydroxide solution (200 g / L) or citric acid solution (0.1 mol / L), and finally make up the volume with distilled water and shake well.

[0020] II. Analysis of the dsGlu950 gene and protein sequence To determine the novelty of the dsGlu950 amino acid sequence, the present invention searched for its homologous proteins in GenBank through online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and arranged them according to sequence similarity. Table 1 lists the top 10 sequences with the highest identity to dsGlu950 in the GeneBank database. The identity of the protein that is evolutionarily closest to dsGlu950 is 98.05%, indicating that the full-length sequence of this protein has not been publicly disclosed and has novelty.

[0021] Table 1. Protein sequences with high identity to dsGlu950 in GeneBank GeneBank accession number Amino acids length Identity (%) HAX14573.1 205 98.05 WP_225597937.1 254 98.03 WP_273016945.1 254 97.24 HCQ75768.1 254 97.24 WP_072984615.1 254 96.46 MBQ51407.1 254 96.46 WP_167596445.1 254 96.06 MEC8883572.1 254 96.06 MEC7782194.1 254 95.67 WP_370173420.1 254 95.28 。

[0022] 1. Cloning of the dsGlu950 gene The full gene was synthesized based on the dsGlu950 amino acid sequence and codon-optimized for E. coli expression. The synthesized sequence is shown in SEQ ID NO.1 in the sequence listing. The dsGlu950 gene fragment was amplified using Glu-F and Glu-R as primers. Using pET22b as a template, 22b-F and 22b-R were used as primers to linearly amplify pET22b. The primer sequences are shown in Table 2. The PCR amplification conditions were: 98°C for 30 seconds; 98°C for 10 seconds, 56°C for 5 seconds, 72°C for 10 seconds, for 35 cycles; 72°C for 1 minute, and then cooled to 4°C for storage.

[0023] Table 2. Primers for cloning dsGlu950 into pET22b and their sequences Primer Primer sequence (5’ - 3’) Serial number Glu-F ctgcccagccggcgatggccCAAGAAAGGGAGCTAGTATGGTCAG SEQ ID NO.3 Glu-R cagtggtggtggtggtggtgCGGCTTCAGCTGATAAACACG SEQ ID NO.4 22b-F CACCACCACCACCACCACTG SEQ ID NO.5 22b-R GGCCATCGCCGGCTGGGC SEQ ID NO.6 。

[0024] 2. Construction of engineering strains The obtained dsGlu950 fragment was ligated with the linearized pET22b vector fragment using a seamless cloning kit (ClonExpress II One Step Cloning Kit, Novoprotein, Nanjing) to form the expression vector pET22b-dsGlu950, the map of which is as Figure 1 shown, and transformed into the E. coli expression strain Escherichia coli BL21(DE3) pLysS to obtain the expression strain E. coli dsGlu950. The strain E. coli dsGlu950 expresses a fusion protein with a pelB signal peptide at the N-terminus and a His tag at the C-terminus, and dsGlu950 can be obtained by Ni-NTA affinity chromatography for activity detection.

[0025] Expression and Purification of 3.dsGlu950 Pick E. coli A monoclonal of dsGlu950 was inoculated into the medium (containing 50 μg / mL ampicillin and 20 μg / ml chloramphenicol double resistance) for seed culture, and cultured in a shaker at 37°C and 220 rpm for 8 - 12 h; the scale of expansion culture was 1:500 - 1:100, and cultured in a shaker at 37°C and 220 rpm for about 4 - 6 hours. When OD 600 reached 0.8 - 1.2, IPTG was added to start induction, and the final concentration of IPTG could be 0.2 - 1 mM. The induction conditions were 18 - 30°C for 18 - 24 h. The induced bacterial solution was centrifuged at 4°C and 3000 - 6000 g for 10 minutes to collect the bacterial cells.

[0026] The collected bacterial cells were resuspended with 50 mL of pre-cooled lysis buffer, and the bacterial cells were lysed using an ultrasonic crusher in an ice bath. The lysis program was a power of 290 W, ultrasonic crushing for 4 s, stopping for 8 s, and the total ultrasonic duration was 15 min. Centrifuged at 4°C, 13000 g for 60 min to take the supernatant. The supernatant was incubated with 3 mL of Ni-NTA resin at 4°C for 1 hour to allow the target protein to fully bind to the resin. It was washed successively with 15 mL of lysis buffer and 15 mL of wash buffer, and eluted with 5 mL of elution buffer to collect the target protein. The eluate was concentrated to 2.5 mL using an Ultracel-30K ultrafiltration tube. The desalting column PD-10 was equilibrated with 25 mL of desalting buffer. 2.5 mL of the concentrated protein solution was added to the desalting column PD-10, and 3.5 mL of desalting buffer was added to collect the protein. The collected effluent was dsGlu950. dsGlu950 was concentrated to 1 mL using an Ultracel-30K ultrafiltration tube. The absorbance at 280 nm was measured using a micro-spectrophotometer to determine the concentration of the purified protein. 5 μL of the protein was taken for SDS-PAGE detection, and the detection results are as Figure 2 shown. The remaining protein was snap-frozen with liquid nitrogen and stored at -80°C.

[0027] Formulas of each buffer for the above protein purification: Lysis buffer (1 L): 7.8 g of NaH 2 PO 4 ·3H 2 O, 17.532 g of NaCl, 100 g of glycerol, 0.6808 g of imidazole, pH 8.0.

[0028] Wash buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, 1.3616 g imidazole, pH 8.0.

[0029] Elution buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, 17.02 g imidazole, pH 8.0.

[0030] Desalting buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, pH 8.0.

[0031] III. Plotting of the substrate standard curve For the determination of glucoamylase activity, laminarin is used as the substrate. The process is as Figure 3 shown: After the substrate is hydrolyzed, glucose monomers are produced. This reducing sugar can reduce the nitro group of DNS to an amino group in an alkaline and heated environment, producing a brownish-red substance that exhibits a characteristic absorption peak at 485 nm. After separately pipetting 1 mL of acidic buffer solution and a series of standard working solutions of glucose into graduated test tubes, 1 mL of water and 2.5 mL of DNS reagent are added. After mixing, the mixture is placed in a boiling water bath for 5 min, then cooled to room temperature with running water, and made up to 12.5 mL with water. Using the blank as a control, the absorbance is measured at a wavelength of 540 nm. Using the glucose mass (mg) as the ordinate and the absorbance as the abscissa, a standard curve is plotted. The results are as Figure 4 shown.

[0032] Preparation of the series of standard working solutions of glucose: Weigh 1 g of anhydrous glucose dried to constant weight at 105 °C into a 100 mL volumetric flask, dissolve it with distilled water, and make up to the mark. Separately pipette 1 mL, 2 mL, 3 mL, 4 mL, 5 mL, 6 mL, and 7 mL of the prepared glucose solution into 100 mL volumetric flasks, and make up to the mark with acidic buffer solution so that the mass of glucose in each milliliter is 0.1 - 0.7 mg.

[0033] IV. Determination of the enzyme activity of dsGlu950 at different temperatures One of the most representative proteins of β-glucoamylase is Blg32, which was isolated from Bacillus lehensis, it showed high activity towards β-glucan substrates. Measure 0.5 - 1 mL of the glucanase sample into a 100 mL volumetric flask, add 80 mL of acidic buffer solution, stir well for 30 min, then make up the volume to 100 mL with acidic buffer solution and mix evenly. Then continue to dilute it twice with acidic buffer solution to control the glucanase activity at 0.04 - 0.08 U / mL. Using laminarin as the reaction substrate, first pipette 10 mL of the dissolved substrate and equilibrate it in a 50°C water bath for 5 min. At the same time, pipette 10 mL of the glucanase sample solution and equilibrate it in a 50°C water bath for 5 min.

[0034] The present invention uses the DNS method to determine the enzyme activity. The specific method is as follows: Under the conditions of pH 4.8, 30°C, 50°C, and 80°C, a 12.5 ml reaction system includes 1 mL of appropriately diluted enzyme solution and 1 mL of glucanase substrate. After reacting for 30 min, add 2.5 mL of DNS reagent to terminate the reaction, heat it in a boiling water bath for 5 min, cool it to room temperature, and then measure the absorbance value of the sample at a wavelength of 540 nm. The blank control group, under the conditions of pH 4.8, 30°C, 50°C, and 80°C, first adds 1 mL of appropriately diluted enzyme solution and reacts for 30 min, then supplements 1 mL of glucanase substrate, and then immediately adds 2.5 mL of DNS reagent to terminate the reaction, heat it in a boiling water bath for 5 min, cool it to room temperature, and then measure the absorbance value of the sample at a wavelength of 540 nm. One enzyme activity unit (U) is defined as the amount of enzyme that releases 1 μmol of reducing sugar from a β-glucan solution with a mass concentration of 4 mg / mL in 1 minute under certain temperature and pH conditions.

[0035] The glucanase activity is calculated according to Equation 1: Equation 1; In the formula, is the β-glucanase activity of the test sample, U / mL; is the mass of glucose calculated from the absorbance on the standard curve, mg; 1000 is the conversion coefficient between millimoles and micromoles, 1 mmol = 1000 μmol; is the sample dilution factor; is the sample volume, mL; 180.2 is the molar mass of glucose, mg / mmol; is the enzymatic hydrolysis reaction time, min.

[0036] The reaction results are as Figure 5 shown. The activities of Blg32 and dsGlu950 at 30°C reached 474.27 and 4917.22 U / mg respectively, at 50°C were 2275.72 and 12633.99 U / mg, and at 80°C were 1026.99 and 1682.41 U / mg.

[0037] V. Activity Comparison of dsGlu950 Catalyzing Different Substrates In this example, laminarin, yeast β-glucan, and barley β-glucan were used as reaction substrates respectively to compare the activities of dsGlu950 and Blg32. 1 mL of dsGlu950 and Blg32 were incubated with 1 mL of glucanase substrate at pH 4.8 and 50 °C for 30 min, then 2.5 mL of DNS reagent was added to terminate the reaction respectively. After heating in a boiling water bath for 5 min and cooling to room temperature, the absorbance of the samples was measured at a wavelength of 540 nm.

[0038] The reaction results are as Figure 6 shown. Both dsGlu950 and Blg32 showed high activities towards the laminarin substrate, and also showed certain catalytic activities towards yeast and barley β-glucan, demonstrating their great application potential in the food processing and biomass conversion industries.

Claims

1. A deep-sea derived glucanase dsGlu950, characterized in that: The amino acid sequence is shown in the sequence listing SEQ ID NO.

1.

2. The gene encoding the glucanase dsGlu950 according to claim 1, characterized in that The nucleotide sequence is shown in the sequence listing SEQ ID NO.

2.

3. An expression vector comprising the gene according to claim 2, characterized in that: The expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector or a viral vector.

4. A host cell comprising the expression vector according to claim 3, characterized in that: The host cell is a bacterium.

5. An engineered strain, characterized in that: The engineered strain comprises the gene according to claim 2 or the expression vector according to claim 3.

6. The use of the glucanase dsGlu950 according to claim 1, characterized in that: The glucanase dsGlu950 catalyzes β-glucan substrate to generate reducing sugars under the environment of 30-80°C.

7. Use of the gene according to claim 2, the expression vector according to claim 3, the host cell according to claim 4 or the engineered strain according to claim 5 in preparing the glucanase dsGlu950 according to claim 1.

Images