Application of Zm00001d008500 gene knockout in improving maize ear rot resistance

By knocking out the Zm00001d008500 gene in the maize genome using the CRISPR/Cas12 system, the problem of time-consuming and labor-intensive traditional breeding methods was solved, and the effect of rapidly improving maize ear rot resistance was achieved.

CN120118917BActive Publication Date: 2026-05-26INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2025-03-07
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve resistance to corn ear rot, and traditional breeding methods are time-consuming, labor-intensive, and wasteful of resources.

Method used

By knocking out the Zm00001d008500 gene in the maize genome using the CRISPR/Cas12 system, the expression and activity of its encoded protein are suppressed, thereby improving maize's resistance to ear rot.

Benefits of technology

It significantly improved maize's resistance to ear rot, shortened the breeding cycle, saved resources, and provided a new method for modern breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005301912480000011
    Figure HDA0005301912480000011
  • Figure HDA0005301912480000012
    Figure HDA0005301912480000012
Patent Text Reader

Abstract

This invention discloses the application of knocking out the Zm00001d008500 gene in improving maize ear rot resistance. This invention relates to the field of biotechnology and provides the application of inhibiting the expression and / or activity of the protein encoded by the Zm00001d008500 gene in either of the following: (A1) improving maize resistance to ear rot; (A2) improving maize resistance to the pathogen of ear rot. This invention, through gene editing, knocks out the Zm00001d008500 gene in the maize genome, which can significantly improve maize resistance to ear rot. This invention is of great significance for the rapid creation of maize ear rot-resistant germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of knocking out the Zm00001d008500 gene in improving resistance to maize ear rot. Background Technology

[0002] Genome editing is a technique for targeted and precise modification of the genome, primarily involving zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats / CRISPR-associated nucleases (CRISPR / Cas). The CRISPR / Cas12 system is a gene-editing tool based on CRISPR (clustered regularly interspaced short palindromic repeats) and the Cas protein, belonging to the type V CRISPR system. Its characteristic protein is Cas12a (also known as Cpf1). Unlike Cas9, the Cas12a system requires only a single guide RNA (crRNA) to function. The Cas12a protein possesses a RuvC domain, which is responsible for cleaving both strands of the target DNA, resulting in a DNA double-strand break. Cas12a has a unique cleavage mechanism. After recognizing the PAM sequence of the target DNA, it cleaves the target strand at a specific position upstream of the PAM, generating a 5' sticky end. Furthermore, after completing the target strand cleavage, Cas12a also activates its non-specific single-stranded DNA (ssDNA) cleavage activity. This characteristic makes it valuable for applications in nucleic acid detection and biosensor design.

[0003] The Cas12a system is relatively simple in composition, requiring no tracrRNA assistance; crRNA alone is needed to guide Cas12a to recognize and cleave target DNA. This simplified design makes it more flexible and convenient to operate in genome editing. In recent years, researchers have also developed smaller Cas12 variants, such as Cas12f and Cas12n, which have shown higher precision and efficiency in targeted editing. The Cas12 system has been widely used in genome editing, pathogen detection, and biosensor development.

[0004] Compared to Cas9, Cas12a has broader PAM sequence requirements. For example, LbCpf1 has similar PAM sequence requirements to Cas9, while FnCpf1 has no strict restrictions on PAM sequences. This makes Cas12a more advantageous in some organisms that are difficult to edit using Cas9. Furthermore, Cas12a's trans-cleavage activity gives it higher sensitivity and specificity in nucleic acid detection. Currently, the CRISPR / Cas12 system has been applied to genome editing in various organisms, including plants, animals, and microorganisms.

[0005] Among my country's grain crops, corn ranks first in both planting area and yield, with the majority used for feed production. In recent years, with the continuous development of my country's economy and society, people's health awareness is constantly upgrading. This change in dietary structure has driven the growth in demand for meat, poultry, eggs, and dairy products, and has also propelled the rapid development of agriculture, animal husbandry, and the food processing industry. Corn is a major raw material in feed for converting meat, poultry, eggs, and dairy products. Therefore, continuously increasing corn production has a significant impact on my country's food security and economic development. Corn ear rot is one of the major diseases in corn-growing areas in China and even worldwide. It is caused by fungal infection. Severe cases during harvest can lead to the entire corn ear becoming soft and rotten, resulting in a significant decrease in corn yield and quality. At the same time, the secondary metabolites secreted by the pathogen, such as deoxynivalenol (DON) and fumonisins (FUM), pose a great threat to human and animal health. Symptoms caused by different pathogens also vary to some extent. The main characteristic of ear rot caused by *Fusarium verticillatum* is a white mycelial layer covering the kernels. Simultaneously, the fumonisin (FUM) produced by *Fusarium verticillatum* is extremely harmful to humans and animals; for example, it is closely related to esophageal cancer in humans, pulmonary edema in pigs, and leukomalacia in horses. Ear rot caused by *Fusarium graminearum* is mainly characterized by a pink or grayish-white mycelial layer covering the kernel surface; in severe cases, the ear and husk adhere together. *DON* produced by *Fusarium graminearum* has a significant impact on pigs, leading to reduced feed intake. Additionally, *DON* can cause headaches and dizziness in humans. The pathogens of corn ear rot mainly overwinter on corn seeds and diseased plant debris, serving as the primary source of infection. Different pathogens have different transmission routes: *Fusarium verticillatum* is mainly spread through rainwater, silks, and insect infestation; while *Fusarium graminearum* is mainly spread through silks and insect infestation. Additionally, the pathogens can also invade from the corn roots and spread to the ear through the stalk. Corn ear rot can occur from the seedling stage to maturity and harvest, but the peak incidence occurs within 21 days after silking. In production, corn ear rot primarily damages the ear, typically starting from the top, causing the kernels to become dull, wrinkled, and underdeveloped, and the cob to soften and rot, severely impacting mechanized harvesting and leading to reduced yield and quality. The incidence rate of corn ear rot in general fields is 5%–10%, reaching 40%–50% in severe years, and exceeding 50% for highly susceptible varieties. Therefore, controlling the occurrence and damage of corn ear rot is of great significance. Corn ear rot often occurs in the later stages of corn growth, making field control difficult. Planting disease-resistant varieties is key to controlling this disease at its source. Developing disease-resistant varieties through traditional breeding is time-consuming, labor-intensive, and wasteful of resources. Combining gene editing technology with disease-resistant corn cultivation can significantly shorten the breeding cycle and save considerable resources, gradually becoming a new modern breeding method. Summary of the Invention

[0006] The purpose of this invention is to provide the application of knocking out the Zm00001d008500 gene in improving resistance to maize ear rot.

[0007] In a first aspect, the present invention claims protection for the use of inhibiting the expression and / or activity of the protein encoded by the Zm00001d008500 gene in any of the following:

[0008] (A1) Improves corn's resistance to ear rot;

[0009] (A2) Improve corn resistance to ear rot pathogens.

[0010] Specifically, inhibiting the expression and / or activity of the protein encoded by the Zm00001d008500 gene can be achieved through at least one of the following six regulatory levels: 1) inhibiting the expression of the Zm00001d008500 gene at the gene transcription level; 2) inhibiting the expression of the Zm00001d008500 gene at the post-transcriptional level (i.e., inhibiting the expression of the protein encoded by the Zm00001d008500 gene through splicing or processing of the primary transcript of the relevant gene); 3) inhibiting the expression of the Zm00001d008500 gene at the RNA transport level. The inhibition of the expression of the Zm00001d008500 gene-encoded protein is achieved by regulating the expression of the encoded protein (i.e., by regulating the transport of the mRNA of the relevant gene from the nucleus to the cytoplasm); 4) by regulating the expression of the Zm00001d008500 gene-encoded protein at the translational level; 5) by regulating the expression of the Zm00001d008500 gene-encoded protein at the mRNA degradation level; and 6) by regulating the activity of the Zm00001d008500 gene-encoded protein at the post-translational level. The same applies below.

[0011] Secondly, the present invention claims the use of a substance capable of inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in any of the following:

[0012] (A1) Improves corn's resistance to ear rot;

[0013] (A2) Improve corn resistance to ear rot pathogens.

[0014] In the first and second aspects mentioned above, the inhibition of the expression and / or activity of the protein encoded by the Zm00001d008500 gene can be achieved by knocking out or reducing the expression of the Zm00001d008500 gene in the maize genome.

[0015] In the second aspect above, the substance may be a substance capable of knocking out or reducing the expression of the Zm00001d008500 gene in the maize genome.

[0016] Furthermore, inhibiting the expression and / or activity of the protein encoded by the Zm00001d008500 gene can be achieved by introducing a CRISPR / Cas (e.g., Cas12) editing tool, siRNA, or shRNA targeting the Zm00001d008500 gene in the maize genome into maize. Accordingly, the substance can be a CRISPR / Cas (e.g., Cas12) editing tool, siRNA, or shRNA targeting the Zm00001d008500 gene in the maize genome.

[0017] In one embodiment of the present invention, the target sequence of the CRISPR / Cas editing tool is shown in SEQ ID No. 1.

[0018] Thirdly, the present invention claims protection for any of the following methods:

[0019] Method I: A method for improving maize resistance to ear rot may include the following steps: inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome, thereby improving maize resistance to ear rot.

[0020] Method II: A method for improving maize resistance to ear rot pathogens may include the following steps: inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome, thereby improving maize resistance to ear rot pathogens.

[0021] Method III: A method for breeding maize varieties with enhanced resistance to ear rot may include the following steps: inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome, thereby achieving the breeding of maize varieties with enhanced resistance to ear rot.

[0022] Method IV: A method for breeding maize varieties with enhanced resistance to ear rot pathogens may include the following steps: inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome, thereby achieving the breeding of maize varieties with enhanced resistance to ear rot pathogens.

[0023] Furthermore, in the method, the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome can be inhibited by knocking out or reducing the expression of the Zm00001d008500 gene in the maize genome.

[0024] Furthermore, in the method, the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome can be suppressed by introducing a CRISPR / Cas (such as Cas12) editing tool, siRNA, or shRNA that targets the Zm00001d008500 gene in the maize genome into the maize.

[0025] In one embodiment of the present invention, the target sequence of the CRISPR / Cas editing tool is shown in SEQ ID No. 1.

[0026] In one embodiment of the present invention, suppressing the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome specifically involves making a single-base deletion (resulting in a frameshift mutation) at position 1652 A in SEQ ID No. 3 of the Zm00001d008500 gene in the maize genome.

[0027] In the aforementioned aspects, the pathogen causing ear rot may be *Fusarium graminearum*. In one embodiment of the present invention, the pathogen causing ear rot is *Fusarium graminearum* CICC 2697.

[0028] In the aforementioned relevant aspects, the protein encoded by the Zm00001d008500 gene can be any of the following:

[0029] (B1) A protein with the amino acid sequence SEQ ID No. 2;

[0030] (B2) A maize protein having the same function as the amino acid sequence shown in SEQ ID No. 2, by substitution and / or deletion and / or addition of one or more amino acid residues;

[0031] (B3) has 99%, 95%, 90%, 85% or more or 80% identity with any of the amino acid sequences defined in (B1)-(B2) and is derived from maize and has the same function.

[0032] (B4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (B1)-(B3).

[0033] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0034] The 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or higher level of identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0035] In the aforementioned relevant aspects, the Zm00001d008500 gene can be any of the following:

[0036] (C1) The DNA molecule shown in SEQ ID No. 3;

[0037] (C2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined by (C1) and encodes the protein encoded by the Zm00001d008500 gene;

[0038] A DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more or more, or 80% or more identity with any of the DNA sequences defined in (C3) and (C1)-(C2) and encodes the protein encoded by the Zm00001d008500 gene.

[0039] For the genes mentioned above, nucleotide sequence identity can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of nucleotide sequences to calculate the identity value (%), then the identity value can be obtained.

[0040] In the aforementioned genes, the 95% or higher identity can be at least 96%, 97%, or 98% identity. The 90% or higher identity can be at least 91%, 92%, 93%, or 94% identity. The 85% or higher identity can be at least 86%, 87%, 88%, or 89% identity. The 80% or higher identity can be at least 81%, 82%, 83%, or 84% identity.

[0041] Experiments have shown that this invention, through gene editing, knocking out the Zm00001d008500 gene in the maize genome, can significantly improve maize's resistance to ear rot. This invention is of great significance for the rapid creation of germplasm resistant to maize ear rot. Attached Figure Description

[0042] Figure 1 This section describes the construction of gene-editing vectors and the creation of mutant plants. In the diagram, A represents the vector map; B represents the gene structure; and C represents the gene-editing site.

[0043] Figure 2 For the identification of resistance to corn ear rot. ** indicates P < 0.01. Detailed Implementation

[0044] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0046] The amino acid sequence of the protein encoded by the Zm00001d008500 gene involved in the following examples is shown in SEQ ID No. 2, and the nucleotide sequence of the Zm00001d008500 gene is shown in SEQ ID No. 3.

[0047] Example 1: Application of Zm00001d008500 gene knockout in improving maize ear rot resistance

[0048] I. Materials and Methods

[0049] 1. Receptor material

[0050] The genetic transformation recipient is maize inbred line KN5585.

[0051] 2. Vectors, strains, and main reagents

[0052] The gene editing vector was CPB-CAS12ICS. - BluntSimple Cloning Vector and Escherichia coli strain Trans1-T1 were purchased from Beijing TransGen Biotech Co., Ltd. Hind III restriction endonuclease (NEB), KOD Plus and KOD FX high-fidelity PCR amplification enzyme were mainly purchased from Beijing Bailinke Biotechnology Co., Ltd., Beijing Liuhetong Trade Co., Ltd., and other companies.

[0053] 3. Construction of CRISPR / CAS12ICS knockout vector

[0054] CRISPR / CAS12ICS knockout vectors such as Figure 1 A. The maize endogenous U6-2 promoter is used to initiate sgRNA expression. The gRNA was designed based on the Zm00001d008500 gene in the reference genome sequence B73_RefGen_v4. The gRNA sequence was validated by Sanger sequencing in the KN5585 receptor.

[0055] The target sequence for the Zm00001d008500 gene is as follows:

[0056] 5'-tcgaccagctgcaggaactt-3' (SEQ ID No. 1).

[0057] The full sequence of the CRISPR / CAS12ICS knockout vector is as follows:

[0058] CTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAA

[0059] ACAGCTATGACATGATTACGAATTCCCGATCTAGTAACATAGATGACACCGCGCGCGATAATTTATCCTAGTTTGCGCGCTATATTTTGTT

[0060] TTCTATCGCGTATTAAATGTATAATTGCGGGACTCTAATCATAAAAACCCATCTCATAAATAACGTCATGCATTACATGTTAATTATTACA

[0061] TGCTTAACGTAATTCAACAGAAATTATATGATAATCATCGCAAGACCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCCAAATGTTTG

[0062] AACGATCGGGGAAATTCGAGCTGGTCACCTCACTTCTTCTTTTTAGCCTGCCCCGCCTTCTTGGTCGCCGCTGGCCGCTTtgagccagagc

[0063] cgccggacgcgctgctctcctccttcatcttcttcttgcacgggatgacccagtcattcaggcagatgttgacggcggccacctcgtccgc

[0064] attgcaggagtggtacttcacgccgttcaggtacacgaatgtagactcagccaggagcctgtgggtggtcaggaacaccctgccgcccctc

[0065] ctcgggatcagaatctcctcatccttcacctttgacaggaactgctccacggtcagcttcttgtcggcgaaaaggccgtgctgcttcagga

[0066] actcaacggcgcccaccttgtagcaagtgttgctcttcttgttagacgcccacctaacgacggcggcgagggcgttctggccccacttgga

[0067] gaagtcggcccgggagtaggagctgtacctgcagcgcagggccggctttgggtcgtcgtagtcggccctgtgcaccagtgggtcctggtgg

[0068] gaggtgtagaacgctggcacgcccttgatattgaagccgtacaggttgcacatatcctccagcttcttgaccacggccctagagcaccaat

[0069] ccatcgtattcctgttgtgggccttggaggcggagcggtcggtgctggacaggttgccctccacgacaacgtggaccaccgcgttatcgac

[0070] cttgtacttctgggccaccgtcatcagggaagacgcgatgcggctggtgcgctcctcgcgcttgttgctcctcttgttgttgatggccacc

[0071] agcaggtcgaacagggacttgtccttggcctccttatccaccatctccttagcgccaagcctgtcgaagtaggagagcaccagggacttga

[0072] aggagccgagggccttcagggtggtccaggacagtgagccgaggcgcatgggggagaagcggccgttggcaacgcgcaggatctcattcct

[0073] caggagggtcaggtcaacctcgttggacctcaggtggttgagcatggtcttgaagtagaagttgttgaaagcgtaggccttccttggcgcg

[0074] gtggacaggtccaccagcgtgccgtccttgtgcttcacgcccagcttgttgaagaacttcctggcggagtccacccactctgtgtcgccaa

[0075] tctcgaacaggtcgacgccgtcgtgattcagctggtcaacgtactcgccgcggctattcagcgtcctggactcgatagagccgctctcaac

[0076] gaacctgacccacatgttcctgaacggaatcgcgtcggtggacttcggcttcaccacctgcatcacggcgtatgtgttggaggccgtctgg

[0077] ttctggtccatgcccaccaggtagtcgcccaccagcacctccctccggggcttggacacctcgacggagtgcacgatgatcacggtgtagt

[0078] cgtcgttcttcttgttgatggtgaaggagagcttcgggttcaggacgttcgcggtcatgttgttcagggcgcagtgctggcgcttcaggag

[0079] cttggccttcgggttgcccttcaggccgtcggtgatggaggaggggagctgggtgtagtcctcggacctgtacagcctgttcctcacgttc

[0080] acggagtcggcgagagacgggttgtacgcgtggacctcctcgaagaacttcatgttgtgcgtcggcacgtggtgcgtctcccacttgccct

[0081] tattcagcagcctcatctcaagccagatcatgttgttctggccaataagcctgccgccgtgctcgccggacaccagggcgcccttcttgga

[0082] gacgtaattagacctcagcacctcgcccaccatcgcgctgttgccgaacgtcatgccctggttgcactcgactgttgggttggccttgatc

[0083] ctcagcagcttctcctctctctggttgaaccgggccaccctgccccacttctcaaccggcacctcgttgttccagatgtactccaggatgt

[0084] tcttgatcggatgcttgatgcccttctcctcgaactcgtccttcacggtggcgaaggcgctctcgaagtcggtggcctccgccttcagctt

[0085] gtacagctccgccaccacgttgtactttctgttgaagccaatgtgctccggcttgatcacgaacttgtccggggtcttgtggaactcggag

[0086] ctgaagaacttggacctcaggatctccacgtcgtcgccctcgctcaggaggcccctcagctccacctcgttcttgaacttctccagggtgg

[0087] agttgaagttcctggtgtcggtcttcttgatggagctcgccgcgttcctgtaggcctgggaccagaggttctggtcgtacggcacgccgct

[0088] ctcgctctccaggtacttcttcacgacatccttcttcggcagggaaatctccttctgctttctgccaatgtccctctggatgtttgacatc

[0089] agctgttcgagcatcagctcagtgatctcgccgctcttctcggagaggtaggaggcggtcctgcctgtggatctgcccttgtagttcttca

[0090] cggcctccttgtggctcttggcatcgaacgcgttcagcaggatcttcaggtactgcgtgtaatccttcggcgggttcttcttgatgccgtt

[0091] cagcaggttgttcagcatcttcaccttctgctgcctgtcctccttcttgccctcgccgaacaggccggacacagagccccagccgttcacg

[0092] tcgtccttgttcagcgggagccagtcctcccacagcatggtggtggcgtactcggagaactgggaggcagaaaggcccatctccctagcga

[0093] ggcggtcggcctcccaggcgcagtcaatccacatgtacttcttggggtcgaagttggaatcgaagtaggactgcacattggccgggatcgc

[0094] agtgcccactggcaggtggttggccagggacttggccaggttggccttgtccaccttcgcgaaagacgtggactccaccggaacgaggcgg

[0095] aacagcctcaccgcgaaggccagcaccagctggtcattgtccaccttctccacgacctcgacgaacttgttgaatggcacggcgccgtacg

[0096] cgcaaaccaggaacctgtgcagcagggacttcacgctcttgtaggcgttccacgtctcgtccaggtacttgaacttcctgtggttcggcag

[0097] cagcaggctctggtacggccttctcacctccaccttcttgactttccgcttcttctttggtgactcgaactcgcttccgtcggctgtccgt

[0098] ttCTTATCGTCATCGTCTTTGTAATCAATATCATGATCCTTGTAGTCTCCGTCGTGGTCCTTATAGTCCATCTGCAGAAGTAACACCAAAC

[0099] AACAGGGTGAGCATCGACAAAAGAAACAGTACCAAGCAAATAAATAGCGTATGAAGGCAGGCTAAAAAAAATCCACATAGCTGCTGCAT

[0100] ATGCCATCATCCAAGTTATATATAATTATAATTATATAAAACATACTTGTTTATTATATATATAAGGTACTCAAGGTTAGAGATATATAGAATGA

[0101] TAGATGCTGCATATGCCATCATGTATGCATCAGTAAAACCCACATCAACATGTATACCTATCCTAGATCGATATTTCCATCCATCTTAA

[0102] ACTCGTAACTATGAGATGTGACACACACACAGTTCCAAAATTATAAATACACCAGGTAGTTTGAAACAGTATTCTACTCCGATCT

[0103] AGAACGAATGAACGACCCCAACCACACCATCATCACAACCAAGCGAACAAAAAGCATCTGTATGCATCAGTAAAACCCGCATC

[0104] AACATGTATACCTATCCTAGATCGATATTTCCATCCATCATCTCAATTCGTAACTATGATGTATGGCACACATACAGATCCAAAA

[0105] TTAATAAATCCACCAGGTAGTTTGAAACAGAATTAATTCTACTCCGATCTAGAACGACCGCCCAACCACCACATCATCACAACCAGAAC

[0106] AAAAAAAGCATGAAAAGATGACCCAAAAAGTGCACGGCATATTGAAATAAGGAAAAGGGCAAACCAAACCCTATGCCAACGAAA

[0107] CAAAAAAAATCATGAAATCGATCCCGTCTGCGGAACGGCTAGAGCCATCCCAGGATTCCCCAAAGAGAAACACTGGCAAGTTAGCAATCAG

[0108] AACGTGTCTGACGTACAGGTCGCATCCGTGTACGAACGCTAGCAGCACGGATCTAACACAAACACGGATCTAACACAAACATGAACAGAAG

[0109] TAGAACTACCGGGCCCTAACCATGGACCGGAACGCCGATCTAGAGAAGGTAGAGAGGGGGGGGGGGGGAGGACGAGCGGCGTACCTTGAAG

[0110] CGGAGGTGCCGACGGGTGGATTTGGGGGAGATCTGGTTGTGTGTGTGTGCGCTCCGAACAACACGAGGTTGGGGAAAGAGGGTGTGGAGGG

[0111] GGTGTCTATTTATTACGGCGGGCGAGGAAGGGAAAGCGAAGGAGCGGTGGGAAAGGAATCCCCCGTAGCTGCCGGTGCCGTGAGAGGAGGA

[0112] GGAGGCCGCCTGCCGTGCCGGCTCACGTCTGCCGCTCCGCCACGCAATTTCTGGATGCCGACAGCGGAGCAAGTCCAACGGTGGAGCGGAA

[0113] CTCTCGAGAGGGGTCCAGAGGCAGCGACAGAGATGCCGTGCCGTCTGCTTCGCTTGGCCCGACGCGACGCTGCTGGTTCGCTGGTTGGTGT

[0114] CCGTTAGACTCGTCGACGGCGTTTAACAGGCTGGCATTATCTACTCGAAACAAGAAAAATGTTTCCTTAGTTTTTTTAATTTCTTAAAGGG

[0115] TATTTGTTTAATTTTTAGTCACTTTATTTTATTCTATTTTATATCTAAATTAATTTAAATAAAAAAACTAAAATAGAGTTTTAGTTTTCTTAA

[0116] TTTAGAGGCTAAAATAGAATAAAATAGATGTACTAAAAAAATTAGTCTATAAAAAAACCATTAACCCTAAACCCTAAATGGATGTACTAATAA

[0117] AATGGATGAAGTATTATATAGGTGAAGCTATTTGCAAAAAAAAAGGAGAACACATGCACACTAAAAAAAGATAAAACTGTAGAGTCCTGTTGT

[0118] CAAAATACTCAATTGTCCTTTAGACCATGTCTAACTGTTCATTTATATGATTCTCTAAAACACTGATATTATTGTAGTACTATAGATTATA

[0119] TTATTCGTAGAGTAAAGTTTAAATATATGTATAAAGATAGATAAACTGCACTTCAAACAAGTGTGACAAAAAAAATATGTGGTAATTTTTT

[0120] ATAACTTAGACATGCAATGCTCATTATCTCTAGAGAGGGGCACGACCGGGTCACGCTGCACTGCACAAGCTGGGTAGAGAAAGCAAGGGAG

[0121] ACTGACCCTAAAGCCAAGCTAGGTCAGGGTAAGAAGCGTGCGGCCTTCTGGCAGCTACTTGGGCCGCACCAAAGAAACACAACCCACACGA

[0122] CCTATGTCGTCGTCACGGCTTGCACATTTTTATGACCATGCCGGCCAGCCAACATAGCTTCTACCGGCTTATAAGTCTTCCTTCTTCAGAG

[0123] AAAGCAATCGTGGTCAAATGCTCCTGCCAGTGTCAAATTGAGGCAACTTTTTGCGCGAGCAGACGTGGGTCCGATGTGTGCAAAACTAATG

[0124] GTGGCTGTCATGTGGGCGCCCGTAGTCTGCAATGTGGGCCCAACGTCCGGAGTGTGTGATAGCTTGCACGATAGGAATGGCTGAATGGGAA

[0125] TGGGGGATTTTGTCACATGGGACCGGAGTGCCCCAAGTCAGGAGTTGCTCGACGTCCCGCGTCACAGAATGTGATGGTTTGTCGGACAGCA

[0126] GCGGTGGAAGAGCCATTATGGCTTAGTGTGGCATCAGCCATACCTTACTTTTAATAACTCTCATATTTTCTACTATAACATCAAAATAAGA

[0127] TGTATGTTGTCTCTTATCTAGCAGGTCTTGAGGTCGATTCACAATTCTTGCAGATTTCATTTTTTGAGCCATAACAGGGATAAGGGCAAAC

[0128] AGGAAAATGAAAAAAGGCATAACAGAAAATGGTAGACTACCCTAACAGAAAATGGTAGACTACCCTTACCGTCTTAATAAGTAGTAGAGAT

[0129] TTGTTCAGCAGGCCGCTTTTAGCTAGTTTCGAGTCGTCGAAATCAGCTTCTGCTAGGTAACAACGTGTTTGGTTTGCCGGACAACGGCGTC

[0130] CGGAATCATCCGATCCTATATCTGAACCTAATATATTTGTTTGGTTTACATCATAGATCTGTGTCGTCCGACATCAGATGCTCTATGTAGC

[0131] GCTGGTTAGAAGTACAATTATGCAGCATCGATTTACTCCCAGAAAAACAACGGACGACCTCACACAGGAGCAGCTCATGCCGGATCAACTG

[0132] AATTTGCAACCAAACACGTCCTAAATGTTTTGCTTTTCATAGTCTATTTTTTTGTTAGAATCGTTTATGTAAAAATCACATGTAAATATAG

[0133] AATCTATCGATGATAGGATAAATATGATGCTCCGCGTAGACTCCTTTGGGCCCGTGTGTTTCAGCTTTTTTCTGACCAGCTTTTCTGAGAA

[0134] TTTAGCCGCGGAGAGAATCTGGCTGTATAGAGAATCTGAGTATTATTAGGATTACGTGCAGATAAAGATAAAGTTGTCCATGTGGCTCAGG

[0135] ATCTATAAAGTGACGAATTACTACTATTGCGACGACTCAACCGATTATATGTTTATGTTGATTTTGAATGATTTTTATATAAACGAATTTT

[0136] ATAGAAACTGGCTGAAAAGCTGAGTGTTTCGTAGTCTGCAACAGCTTTTGGTAGCAAGAAGCTGCGAAAAGCCGAAACAAACAACGACTTT

[0137] ATCTTCTTTAGCACATAAATGGTATAAAAAAATGTCGTAACAGCTATTTTTTTAAGAATCCAGTTTCTCGGAGATCTTTGGAAAAAAGTTC

[0138] TCTGAAACAGCCCCGCGTCGCTACGTGCAGCTCCATCTGCTCCGTGTTGTCCCCACCCCAATCACCGCTGTCGCTTCGCCGCAGGCATCCC

[0139] AGCAGCGAGCTAGCATGCACGCACGCACGCAAGCACACGGCGGCAGCTGCACGGATGCGGCCGAGTGCGGCAGCACAGCAGCGCGCGCGCG

[0140] CTCCACATCGCCTTCGCTAGTTCGCTCCGCCACGTACGCGGCCCGGCCTCCACCTGGCGGCGCGCATGGCTGCGACCCTCGCCGCGCCACC

[0141] TCTTCATATACGCTGCAGCTCGCCTCGAACCCTCGCATCGAACGCACACTCGCACTCGCACGTACACCACACTAGTTACCACAGACGACGG

[0142] GCGCCATGGCCTCCTCCGAGAACGTCATCACCGAGTTCATGCGCTTCAAGGTGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGAT

[0143] CGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGAC

[0144] ATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGTCCTTCCCCGAGG

[0145] GCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGCGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCTGCTTCATCTA

[0146] CAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCGCCTG

[0147] TACCCCCGCGACGGCGTGCTGAAGGGCGAGACCCACAAGGCCCTGAAGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCT

[0148] ACATGGCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACGCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCATCGT

[0149] GGAGCAGTACGAGCGCACCGAGGGCCGCCACCACCTGTTCCTGTAGGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCT

[0150] GTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGA

[0151] GATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCG

[0152] CGCGGTGTCATCTATGTTACTAGATCGGATCCCTAATTGGCCCTTACAAAATAGCTAGACGTGCAGGTGGCTGGATGTGCGCTCCCTGAAT

[0153] ATCAACTTGTGTCTCCTCCGATTCAGTCCGCAGATGAAACTTGGTAATAACTGCAGCTGATCCGTCGTCATTCATGCTATGCAGGGGATTC

[0154] GATCTTCAGCATGTGCAGTGCAGGCAACAACAATCTACGTTGTCTGGGCTTGCGATAGGTACACGACCACGAGGGAAGGCAACGCGTGATG

[0155] TATGGGCCGCGCCTAAGCATCCAGCCCACGCGGGCGTGCGCGTCGTCGCTACGGCTTGCGGGGGGAAGGGATCAAGGGACGAACCGAGAACT

[0156] AGTACCAGACCGGCCAGCGAGCATTGCAGACACCGGCTTATAAGTTCAGCTGCGACCACCGCTCCgAAATTACTGATGAGTCCGTGAGGAC

[0157] GAAACGAGTAAGCTCGTCAGAGAATGTGTGCATAGTCACACtcgaccagctgcaggaacttGGCCGGCATGGTCCCAGCCTCCTCGCTGGC

[0158] GCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACTTTTTTTTTTTTTTTTTTCCTGCAGGCATGCAAGCTTGGCACTGGCCGTC

[0159] GTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTAACCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCG

[0160] AAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGCTAGAGCAGCTTGAGCTTGGGATCAGATTGTCGTTTC

[0161] CCGCCTTCAGTTTAAACTATCAGTGTTTGACAGGATATATTGGCGGGTAAACCTAAGAGAAAGAGCGTTTTATTAGAATAATCGGATATTT

[0162] AAAAGGGCGTGAAAAGGTTTATCCGTTCGTCCATTTGTATGTGCATGCCAACCACAGGGTTCCCCTCGGGATCAAAGTACTTTGATCCAAC

[0163] CCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACATGTCGCACAAGTCCTAAGTTACGCGACA

[0164] GGCTGCCGCCCTGCCCTTTTCCTGGCGTTTTCTTGTCGCGTGTTTTAGTCGCATAAAGTAGAATACTTGCGACTAGAACCGGAGACATTAC

[0165] GCCATGAACAAGAGCGCCGCCGCTGGCCTGGTGGGCTATGCCCGCGTCAGCACCGACGACCAGGACTTGACCAACCAACGGGCCGAACTGC

[0166] ACGCGGCCTATGAGGTAAAGAGAAAATGAGCAAAAGCCAAACACGCTAAGTGCCGGCCGTCCGAGCGCACGCAGCAGCAAGGCTGCAACGT

[0167] TGGCCAGCCTGGCAGACACGCCAGCCATGAAGCGGGTCAACTTTCAGTTGCCGGAGCTGGCCAGGATGCTTGACCACCTACGCCCTGGCGA

[0168] CGTTGTGACAGTGACCAGGCTAGACCGCCTGGCCCGCAGCACCCGCGACCTACTGGACATTGCCGAGCGCATCCAGGAGGCCGGCGCGGGC

[0169] CTGCGTAGCCTGGCAGAGCCGTGGGCCGACACCACCACGCCGGCCGGCCGCATGGTGTTGACCGTGTTCGCCGGCATTGCCGAGTTCGAGC

[0170] GTTCCCTAATCATCGACCGCACCCGGAGCGGGCGCGAGGCCGCCAAGGCCCGAGGCGTGAAGTTTGGCCCCCGCCCTACCCTCACCCCGGC

[0171] ACAGATCGCGCACGCCCGCGAGCTGATCGACCAGGAAGGCCGCACCGTGAAAGAGGCGGCTGCACTGCTTGGCGTGCATCGCTCGACCCTG

[0172] TACCGCGCACTTGAGCGCAGCGAGGAAGTGACGCCCACCGAGGCCAGGCGGCGCGGTGCCTTCCGTGAGGACGCATTGACCGAGGCCGACG

[0173] CCCTGGCGGCCGCCGAGAATGAACGCCAAGAGGAACAAGCATGAAACCGCACCAGGACGGCCAGGACGAACCGTTTTTCATTACCGAAGAG

[0174] ATCGAGGCGGAGATGATCGCGGCCGGGTACGTGTTCGAGCCGCCCGCGCACGTCTCAACCGTGCGGCTGCATGAAATCCTGGCCGGTTTGT

[0175] CTGATGCCAAGCTGGCGGCCTGGCCGGCCAGCTTGGCCGCTGAAGAAACCGAGCGCCGCCGTCTAAAAAGGTGATGTGTATTTGAGTAAAA

[0176] CAGCTTGCGTCATGCGGTCGCTGCGTATATGATGCGATGAGTAAATAAACAAATACGCAAGGGGAACGCATGAAGGTTATCGCTGTACTTA

[0177] ACCAGAAAGGCGGGTCAGGCAAGACGACCATCGCAACCCATCTAGCCCGCGCCCTGCAACTCGCCGGGGCCGATGTTCTGTTAGTCGATTC

[0178] CGATCCCCAGGGCAGTGCCCGCGATTGGGCGGCCGTGCGGGAAGATCAACCGCTAACCGTTGTCGGCATCGACCGCCCGACGATTGACCGC

[0179] GACGTGAAGGCCATCGGCCGGCGCGACTTCGTAGTGATCGACGGAGCGCCCCAGGCGGCGGACTTGGCTGTCCGCGATCAAGGCAGCCCG

[0180] ACTTCGTGCTGATTCCGGTGCAGCCAAGCCCTTACGACATATGGGCCACCGCCGACCTGGTGGAGCTGGTTAAGCAGCGCATTTGAGGTCAC

[0181] GGATGGAAGGCTACAAGCGGCCTTTGTCGTGTCGCGGGCGATCAAAGGCACGCGCATCGGCGGTGAGGTTGCCGAGGCGCTGGCCGGGTAC

[0182] GAGCTGCCCATTCTTGAGTCCCGTATCACCGCAGCGCGTGAGCTACCCAGGCACTGCCGCCCGGCACAACCGTTCTTGAATCAGAACCCG

[0183] AGGGCGACGCTGCCCGCGAGGTCCAGGCGCTGGCCGCTGAAATTAAATCAAAACTCATTTGAGTTAATGAGGTAAAGAAAATGAGCAAA

[0184] AGCACAAACACGCTAAGTGCCGGCCGTCCGAGCGCACGCAGCAGCAAGGCTGCAACGTTGGCCAGCCTGGCAGACACGCCAGCCATGAAGC

[0185] GGGTCAACTTTCAGTTGCCGGCGGAGGATCACACCAAGCTGAAGATGTACGCGGTACGCCAAGGCAAGACCATTACCGAGCTGCTATCTGA

[0186] ATACATCGCGCAGCTACCAGAGTAAATGAGCAAATGAATAATGAGTAGATGAATTTTAGCGGCTAAAGGAGGCGGCATGGAAAATCAAGA

[0187] ACAACCAGGCACCGACGCCGTGGAATGCCCCATGTGTGGAGGAACGGGCGGTTGGCCAGGCGTAAGCGGCTGGGTTGCCTGCCGGCCCTGC

[0188] AATGGCACTGGAACCCCCAAGCCCGAGGAATCGGCGTGAGCGGTCGCAAACCATCCGGCCCGGTACAAATCGGCGCGGCGCTGGGTGATGA

[0189] CCTGGTGGAGAAGTTGAAGGCCGCGCAGGCCGCCCAGCGGCAACGCATCGAGGCAGAAGCACGCCCCGGTGAATCGTGGCAAGCGGCCGCT

[0190] GATCGAATCCGCAAAGAATCCCGGCAACCGCCGGCAGCCGGTGCGCCGTCGATTAGGAAGCCGCCCAAGGGCGACGAGCAACCAGATTTTT

[0191] TCGTTCCGATGCTCTATGACGTGGGCACCCGCGATAGTCGCAGCATCATGGACGTGGCCGTTTTCCGTCTGTCGAAGCGTGACCGACGAGC

[0192] TGGCGAGGTGATCCGCTACGAGCTTCCAGACGGGCACGTAGAGGTTTCCGCAGGGCCGGCCGGCATGGCCAGTGTGTGGGATTACGACCTG

[0193] GTACTGATGGCGGTTTCCCATCTAACCGAATCCATGAACCGATACCGGGAAGGGAAGGGAGACAAGCCCGGCCGCGTGTTCCGTCCACACG

[0194] TTGCGGACGTACTCAAGTTCTGCCGGCGAGCCGATGGCGGAAAGCAGAAAGACGACCTGGTAGAAACCTGCATTCGGTTAAACACCACGCA

[0195] CGTTGCCATGCAGCGTACGAAGAAGGCCAAGAACGGCCGCCTGGTGACGGTATCCGAGGGTGAAGCCTTGATTAGCCGCTACAAGATCGTA

[0196] AAGAGCGAAACCGGGCGGCCGGAGTACATCGAGATCGAGCTAGCTGATTGGATGTACCGCGAGATCACAGAAGGCAAGAACCCGGACGTGC

[0197] TGACGGTTCACCCCGATTACTTTTTGATCGATCCCGGCATCGGCCGTTTTCTCTACCGCCTGGCACGCCGCGCCGCAGGCAAGGCAGAAGC

[0198] CAGATGGTTGTTCAAGACGATCTACGAACGCAGTGGCAGCGCCGGAGAGTTCAAGAAGTTCTGTTTCACCGTGCGCAAGCTGATCGGGTCA

[0199] AATGACCTGCCGGAGTACGATTTGAAGGAGGAGGCGGGGCAGGCTGGCCCGATCCTAGTCATGCGCTACCGCAACCTGATCGAGGGCGAAG

[0200] CATCCGCCGGTTCCTAATGTACGGAGCAGATGCTAGGGCAAATTGCCCTAGCAGGGGAAAAAGGTCGAAAAGGTCTCTTTCCTGTGGATAG

[0201] CACGTACATTGGGAACCCAAAGCCGTACATTGGGAACCGGAACCCGTACATTGGGAACCCAAAGCCGTACATTGGGAACCGGTCACACATG

[0202] TAAGTGACTGATATAAAAGAGAAAAAAGGCGATTTTTCCGCCTAAAACTCTTTAAAACTTATTAAAACTCTTAAAACCCGCCTGGCCTGTG

[0203] CATAACTGTCTGGCCAGCGCACAGCCGAAGAGCTGCAAAAAGCGCCTACCCTTCGGTCGCTGCGCTCCCTACGCCCCGCCGCTTCGCGTCG

[0204] GCCTATCGCGGCCGCTGGCCGCTCAAAAATGGCTGGCCTACGGCCAGGCAATCTACCAGGGCGCGGACAAGCCGCGCCGTCGCCACTCGAC

[0205] CGCCGGCGCCCACATCAAGGCACCCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACA

[0206] GCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGT

[0207] CACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCG

[0208] CACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAG

[0209] CGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAA

[0210] GGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAG

[0211] AGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTA

[0212] CCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG

[0213] CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGA

[0214] CACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGC

[0215] CTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATC

[0216] CGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTG

[0217] ATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGCTGATGAATCCCCTAATGATTTTGGTAAAAATCATTAAGT

[0218] TAAGGTGGATACACATCTTGTCATATGATCAAATGGTTTCGCGAAAAATCAATAATCAGACAACAAGATGTGCGAACTCGATATTTTACAC

[0219] GACTCTCTTTACCAATTCTGCCCCGAATTACACTTAAAACGACTCAACAGCTTAACGTTGGCTTGCCACGCATTACTTGACTGTAAAACTC

[0220] TCACTCTTACCGAACTTGGCCGTAACCTGCCAACCAAAGCGAGAACAAAACATAACATCAAACGAATCGACCGATTGTTAGGTAATCGTCA

[0221] CCTCCACAAAGAGCGACTCGCTGTATACCGTTGGCATGCTAGCTTTATCTGTTCGGGCAATACGATGCCCATTGTACTTGTTGACTGGTCT

[0222] GATATTCGTGAGCAAAAACGACTTATGGTATTGCGAGCTTCAGTCGCACTACACGGTCGTTCTGTTACTCTTTATGAGAAAGCGTTCCCGC

[0223] TTTCAGAGCAATGTTCAAAGAAAGCTCATGACCAATTTCTAGCCGACCTTGCGAGCATTCTACCGAGTAACACCACACCGCTCATTGTCAG

[0224] TGATGCTGGCTTTAAAGTGCCATGGTATAAATCCGTTGAGAAGCTGGGTTGGTACTGGTTAAGTCGAGTAAGAGGAAAAGTACAATATGCA

[0225] GACCTAGGAGCGGAAAACTGGAAACCTATCAGCAACTTACATGATATGTCATCTAGTCACTCAAAGACTTTAGGCTATAAGAGGCTGACTA

[0226] AAAGCAATCCAATCTCATGCCAAATTCTATTGTATAAATCTCGCTCTAAAGGCCGAAAAAATCAGCGCTCGACACGGACTCATTGTCACCA

[0227] CCCGTCACCTAAAATCTACTCAGCGTCGGCAAAGGAGCCATGGGTTCTAGCAACTAACTTACCTGTTGAAATTCGAACACCCAAACAACTT

[0228] GTTAATATCTATTCGAAGCGAATGCAGATTGAAGAAACCTTCCGAGACTTGAAAAGTCCTGCCTACGGACTAGGCCTACGCCATAGCCGAA

[0229] CGAGCAGCTCAGAGCGTTTTGATATCATGCTGCTAATCGCCCTGATGCTTCAACTAACATGTTGGCTTGCGGGCGTTCATGCTCAGAAACA

[0230] AGGTTGGGACAAGCACTTCCAGGCTAACACAGTCAGAAATCGAAACGTACTCTCAACAGTTCGCTTAGGCATGGAAGTTTTGCGGCATTCT

[0231] GGCTACACAATAACAAGGGAAGACTTACTCGTGGCTGCAACCCTACTAGCTCAAAATTTATTCACACATGGTTACGCTTTGGGGAAATTAT

[0232] GAGGGGATCTCTCAGCGTTAAGGGATTTTGGTCATGCATTCTAGGTACTAAAACAATTCATCCAGTAAAATATAATATTTTATTTTCTCCC

[0233] AATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTCGACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGGCAAT

[0234] GTCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCATCTTTCACAAAGATGTTGCTGTCTCCCAGG

[0235] TCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCTTTAAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCTT

[0236] CCCAGTTTTCGCAATCCACATCGGCCAGATCGTTATTCAGTAAGTAATCCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACA

[0237] ATCCGATATGTCGATGGAGTGAAAGAGCCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCC

[0238] GAGCAAAGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTGCAGGACCTTTGGAACAGGCAGCTTTC

[0239] CTTCCAGCCATAGCATCATGTCCTTTTCCCGTTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAATATAGGTTTTC

[0240] ATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTTACGCAGCGGTATTTTTCGATCAGTTTTTTCAATTCC

[0241] GGTGATATTCTCATTTTAGCCATTTATTATTTCCTTCCTCTTTTCTACAGTATTTAAAGATACCCCAAGAAGCTAATTATAACAAGACGAA

[0242] CTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAACAGCTTTTTCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTA

[0243] TCGACGGAGCCGATTTTGAAACCGCGGTGATCACAGGCAGCAACGCTCTGTCATCGTTACAATCAACATGCTACCCTCCGCGAGATCATCC

[0244] GTGTTTCAAACCCGGCAGCTTAGTTGCCGTTCTTCCGAATAGCATCGGTAACATGAGCAAAGTCTGCCGCCTTACAACGGCTCTCCCGCTG

[0245] ACGCCGTCCCGGACTGATGGGCTGCCTGTATCGAGTGGTGATTTTGTGCCGAGCTGCCGGTCGGGGAGCTGTTGCTGGCTGGTGGCAGGA

[0246] TATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTAATGTACTGAATTAACGCCGAATTAATTCG

[0247] GGGGATCTGGATTTTAGTACTGGATTTTGGTTTTTAGGAATTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAATACATACTAAGGG

[0248] TTTCTTATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATCTGGGAACTACTCACACATTATTATGGAGAAACTCG

[0249] AGTCAAATCTCGGTGACGGGCAGGACCGGACGGGGCGGTACCGGCAGGCTGAAGTCCAGCTGCCAGAAACCCACGTCATGCCAGTTCCCGT

[0250] GCTTGAAGCCGGCCGCCCGCAGCATGCCGCGGGGGGCATATCCGAGCGCCTCGTGCATGCGCACGCTCGGGTCGTTGGGCAGCCCGATGAC

[0251] AGCGACCACGCTCTTGAAGCCCTGTGCCTCCAGGGACTTCAGCAGGTGGGTGTAGAGCGTGGAGCCCAGTCCCGTCCGCTGGTGGCGGGGG

[0252] GAGACGTACACGGTCGACTCGGCCGTCCAGTCGTAGGCGTTGCGTGCCTTCCAGGGGCCCGCGTAGGCGATGCCGGCGACCTCGCCGTCCA

[0253] CCTCGGCGACGAGCCAGGGATAGCGCTCCCGCAGACGGACGAGGTCGTCCGTCCACTCCTGCGGTTCCTGCGGCTCGGTACGGAAGTTGAC

[0254] CGTGCTTGTCTCGATGTAGTGGTTGACGATGGTGCAGACCGCCGGCATGTCCGCCTCGGTGGCACGGCGGATGTCGGCCGGGCGTCGTTCT

[0255] GGGCTCATGGTAGACTCGAGAGAGATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGTGTCCTCTCCAAATGAAATGAACTTCCTTATAT

[0256] AGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTG

[0257] GTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCT

[0258] TTCCTTTATCGCAATGATGGCATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCC

[0259] GAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACG

[0260] AGAGTGTCGTGCTCCACCATGTTCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGT

[0261] GGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGTGCCACCTT

[0262] CCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTC

[0263] AATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAGAGTGTCGTGCTCCACCATGTTGGCAAGCTGCTCTAGC

[0264] CAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCG

[0265] CAACGCAATTAATGTGAGTTAGCTCA。

[0266] Specifically, positions 17097-17121 are LB T-DNA repeat elements; positions 17199-17373 are CaMV poly(A)signal elements; positions 17380-17931 are Bar elements; positions 17976-18652 are CaMV 35S promoter elements; positions 115-367 are NOS terminator sequences; and positions 393-440 are nucleoplasmin. NLS coding sequence; positions 3584-3144 are CAS12ICS coding sequence; positions 3585-3638 are BiNLS coding sequence; positions 3639-3704 are 3×FLAG coding sequence; positions 3710-5681 are Ubi promoter sequence; positions 8583-8979 are maize endogenous U6-2 promoter sequence; positions 8981-9023 are HH; positions 9047-9066 are gRNA spacer sequence targeting the Zm00001d008500 gene; positions 9067-9134 are HDV sequence; positions 9394-9421 are RB sequence.

[0267] 4. Maize genetic transformation

[0268] (1) The CRISPR / CAS12ICS knockout vector obtained above was introduced into BMEHA105 Agrobacterium competent cells (Beijing Bomeide Gene Technology Co., Ltd., catalog number: BC303-01) to obtain recombinant Agrobacterium.

[0269] (2) The recombinant Agrobacterium obtained in step (1) was cultured in N6 liquid medium to obtain the bacterial culture OD. 600nm The recombinant Agrobacterium bacterial suspension was centrifuged at 5000 rpm for 10 min to collect the bacterial cells. The cells were then resuspended in a prepared infection buffer [1 L of infection buffer is prepared by mixing 4 g of N6 salt containing N6 vitamin, 2 mg of 2,4-D, 100 mg of inositol, 0.7 g of L-proline, 68.4 g of sucrose, 36 g of glucose, 1 mL of AgNO3 (10 mg / mL), 1 mL of As (100 mol / L), and water, pH 5.2]. 600nm The value is around 0.5, and then the mixture is shaken at 28℃ and 150r / min for 0.5h to obtain the inoculum.

[0270] (3) Soak the callus tissue of the maize inbred line KN5585 with good growth in the infection buffer for 1 hour, then transfer it to the infection solution prepared in step (2) and soak it for 15 minutes, and then air dry.

[0271] (4) Place the callus tissue infected in step (3) into a co-culture medium [1L of co-culture medium is prepared by mixing 4g of N6 salt containing N6 vitamin 1000×, 2mg of 2,4-D, 30g of sucrose, 8g of agar, 1mL of AgNO3 (10mg / mL), 1mL of As (100mol / L), 3mL of L-cysteine ​​(100mg / mL) and water, pH 5.8], and culture at 20℃ for 3 days, then transfer to recovery medium [1L of recovery medium is prepared by mixing 4g of N6 salt, 1ml of N6 vitamin 1000×, 1.5mg of 2,4-D, 0.7g of L-proline, 30g of sucrose, 5μg of AgNO3, 0.5g of... MES, 100 mg cefotaxime, 100 mg vancomycin, 8 g agar and water were mixed and cultured at pH 5.8 for 10 days at 28°C, and then transferred to recovery medium containing 1.5 mg / L glufosinate and cultured in the dark at 28°C for 7 days to screen for positive callus tissue.

[0272] (5) Transfer the positive callus obtained in step (4) to embryoid induction medium [1L of embryoid induction medium is prepared by mixing 4.43g MS salt containing MS vitamin (containing inositol), 0.25mg 2,4-D, 30g sucrose, 5mg 6-BA, 4g plant gel, 1mL Cefo (250mg / mL) and water, pH 5.8], and culture in the dark for 2 weeks, then transfer to differentiation medium [1L of differentiation medium is prepared by mixing 4.43g MS salt containing MS vitamin (containing inositol), 30g sucrose, 4g plant gel, 1mL Cefo (250mg / mL) and water, pH 5.8]. After green shoots emerge, transfer to rooting medium [1L of rooting medium is prepared by mixing 2.215g 1 / 2 MS, 30g sucrose, 51.55mg 6-BA, 4g plant gel, 1mL Cefo (250mg / mL) and water, pH 5.8]. MSvitamin, obtained by mixing 4g of plant gel with water, pH 5.8] rooted, grew to a certain height, and cultured in the air for 3 days before transplanting.

[0273] (6) Take about 3 cm of plant leaves, grind them thoroughly in a tube, add 500 μl of buffer (from bar gene test strip), insert bar gene test strip (Beijing Aochuang Jinbiao Biotechnology Co., Ltd., product number: A07-13-413), and plants that show positive bands are T0 generation positive plants.

[0274] 5. Mutation detection

[0275] Primers 5'-GGTTTTGTGTTATCTGGTTTG-3' and 5'-CATCATCAGAGTCAGAATGC-3' were designed based on the target location of the knockout vector. PCR was used to amplify the target gene in the corresponding plants, and the mutation type was analyzed using DSDecode software after sequencing. The PCR reaction system and procedure were the same as those used for transgenic component verification.

[0276] 6. Mutant resistance identification

[0277] During the investigation of maize ear rot, the husks of mature maize ears inoculated with bacterial solution were removed, and the number of diseased kernels in each ear was recorded. Statistical data were recorded and relevant analyses were performed to identify the genetic resistance effect.

[0278] 7. Inoculation and resistance testing for maize stalk rot

[0279] Fusarium graminearum CICC 2697 (described in the article "Kong, W.; Huo, H.-R.; Gu, Y.; Cao, Y.-Q.; Wang, J.-L.; Liang, J.-Y.; Niu, S.-Q. Antifungal activity of camphor against four phytopathogens of Fusarium. South African Journal of Botany 2022, 148, 437–445.", publicly available from the applicant, is for the sole purpose of repeating experiments of this invention and may not be used for other purposes) is typically cultured on potato dextrose agar (PDA) medium. The steps for preparing PDA medium are as follows: First, take 46g of potato dextrose agar powder (Beijing Xuejiete Technology Co., Ltd., product number: Q9931) and add it to 1000ml of distilled water, heat until completely dissolved, and autoclave at 115℃ for 20 minutes. When the culture medium cools to about 50°C, pour it into a petri dish under sterile conditions, and let it cool and solidify before use.

[0280] The environmental conditions for culturing *Fusarium graminearum* were a constant temperature of 25℃ under aerobic conditions. The incubation period after inoculation was 5-7 days, during which the colony diameter reached 48-53 mm. The colonies were milky white, velvety in texture, with a flat surface and a reddish-brown reverse side, without exudate or soluble pigment production. When the colony diameter reached 3-5 cm, a spore suspension of *Fusarium graminearum* was prepared. Using a sterile punch, holes were made at the edge of the colonies to obtain mycelial cakes, which were then inoculated into mung bean soup medium for further cultivation. The cultivation conditions were 25-28℃ and a shaker at 150 rpm. After about one week of cultivation, spores could be detected under a microscope in the supernatant. After two weeks, the spore quantity reached 10... 8 -109 The spore concentration was 10^10 / ml. At this point, the mycelia were filtered through four layers of sterile gauze, and the filtrate was centrifuged at 12,000 rpm for 5-10 minutes. After removing the supernatant, the spores were resuspended in sterile water, counted using a hemocytometer, and the spore concentration was adjusted to 1×10^10 spores with sterile water. 5 Up to 5×10 5 spores / ml. This yields a Fusarium graminearum spore suspension. Adjust the spore concentration to 1×10⁻⁶. 6 Up to 5×10 6 For every 500ml of suspension, add 1ml of Tween 80 (Beijing Cooler Master Technology Co., Ltd., product number: CT11581-100mL). Using a sterile syringe, draw up the spore suspension and inject it into corn ears 7 days after pollination. Insert the syringe needle into the corn ear from the silks at the tip of the female ear, slowly injecting approximately 2ml of Fusarium graminearum spore suspension per plant. After injection, observe the disease condition of the corn ears after harvest.

[0281] II. Results and Analysis

[0282] 1. Construction and genetic transformation of CRISPR / CAS12ICS knockout vector

[0283] This invention successfully constructed a knockout vector that eliminates the maize ear rot gene Zm00001d008500. Figure 1 (A and B). One transformation event was obtained through Agrobacterium-mediated genetic transformation. Upstream and downstream primers were designed around the sgRNA binding site. PCR amplification and Sanger sequencing revealed a mutation in the sgRNA binding region. Figure 1 The mutant ZmFER2 was obtained by deleting one thymine atom (C) and a frameshift mutation was obtained. The mutation type was the deletion of one thymine atom. Materials with frameshift mutations in one allele were used for resistance identification against maize ear rot. The only difference between the mutant ZmFER2 and the wild type is the deletion of position A at position 1652 of SEQ ID No. 3 (Zm00001d008500) in the genome of the mutant ZmFER2, resulting in a frameshift mutation.

[0284] 2. Identification of resistance to ear rot

[0285] The mutant ZmFER2 was mixed with wild-type KN5585 seeds at a 1:1 ratio and sown. The mixed seeds were then inoculated with a Fusarium graminearum spore suspension for identification, excluding interference from environmental and other factors. Based on genotyping and the number of infected kernels per ear, the knockout mutant ZmFER2 showed significantly greater resistance to disease compared to the wild-type KN5585. These results indicate that this mutant exhibits significant resistance to ear rot. For detailed results, please refer to [link to detailed results]. Figure 2Twenty-one spikes were counted for both the mutant ZmFER2 and the wild-type KN5585, and the average of the results was taken.

[0286] The above experimental results show that by using gene editing to knock out the maize ear rot gene Zm00001d008500, it is possible to quickly create maize ear rot resistant germplasm.

[0287] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of a substance capable of inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in any of the following: (A1) Improves corn's resistance to ear rot; (A2) Improve corn's resistance to ear rot pathogen; The pathogen causing ear rot is Fusarium graminearum; The protein encoded by the Zm00001d008500 gene is any one of the following: (B1) A protein with the amino acid sequence SEQ ID No. 2; (B2) is obtained by attaching a tag to the N-terminus and / or C-terminus of the protein defined in (B1).

2. The application according to claim 1, characterized in that: Inhibiting the expression and / or activity of the protein encoded by the Zm00001d008500 gene is achieved by knocking out or reducing the expression of the Zm00001d008500 gene in the maize genome. The substance is capable of knocking out or reducing the expression of the Zm00001d008500 gene in the maize genome.

3. The application according to claim 1, characterized in that: Inhibition of the expression and / or activity of the protein encoded by the Zm00001d008500 gene was achieved by introducing a CRISPR / Cas editing tool targeting the Zm00001d008500 gene in the maize genome into maize. The substance is a CRISPR / Cas editing tool that targets the Zm00001d008500 gene in the maize genome.

4. The application according to claim 3, characterized in that: The target sequence of the CRISPR / Cas editing tool is shown in SEQ ID No.

1.

5. The application according to claim 1, characterized in that: The Zm00001d008500 gene is the DNA molecule shown in SEQ ID No.

3.

6. Any of the following methods: Method I: A method for improving maize resistance to ear rot, comprising the following steps: inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome, thereby improving maize resistance to ear rot; Method II: A method for improving maize resistance to ear rot pathogen, comprising the following steps: inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome, thereby improving maize resistance to ear rot pathogen; Method III: A method for breeding maize varieties with improved resistance to ear rot, comprising the following steps: inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome, thereby achieving the breeding of maize varieties with improved resistance to ear rot; Method IV: A method for breeding maize varieties with enhanced resistance to ear rot pathogen, comprising the following steps: inhibiting the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome, thereby achieving the breeding of maize varieties with enhanced resistance to ear rot pathogen; The protein encoded by the Zm00001d008500 gene is any one of the following: (B1) A protein with the amino acid sequence SEQ ID No. 2; (B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein defined in (B1); The pathogen causing ear rot is Fusarium graminearum.

7. The method according to claim 6, characterized in that: In the method, the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome are suppressed by knocking out or reducing the expression of the Zm00001d008500 gene in the maize genome.

8. The method according to claim 6 or 7, characterized in that: In the method, the expression level and / or activity of the protein encoded by the Zm00001d008500 gene in the maize genome are suppressed by introducing a CRISPR / Cas editing tool targeting the Zm00001d008500 gene in the maize genome into maize.

9. The method according to claim 8, characterized in that: The target sequence of the CRISPR / Cas editing tool is shown in SEQ ID No.

1.

10. The method according to claim 6 or 7, characterized in that: The Zm00001d008500 gene is the DNA molecule shown in SEQ ID No. 3.