Cytochrome P450 gene AmCYP71AF43, polypeptide, carrier and application of cytochrome P450 gene AmCYP71AF43, polypeptide and carrier
By expressing the CYP71AF43 gene in the large-spike Kanmai Niang variety in plants, the problem of difficulty in obtaining herbicide-resistant gene resources in traditional breeding is solved, and significant resistance to APP herbicides is achieved, and the benefits and safety of agricultural production are improved.
Patent Information
- Application Number
- CN202510243278.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-03
- Publication Date
- 2025-06-10
AI Technical Summary
Traditional plant breeding is difficult to naturally obtain genetic resources that are resistant to herbicides, and the existing resistance sites are monopolized by commercial giants' patents, resulting in a decrease in the effectiveness of resistance resources.
The cytochrome P450 gene CYP71AF43 in the Dasui Kanmai species was discovered and used to express the gene in plants through transgenic technology, enhancing the resistance of plants to herbicides.
By expressing the CYP71AF43 gene, plants can significantly improve their resistance to APP herbicides, extend the use cycle of herbicides, reduce agricultural production costs, and improve agricultural production efficiency and ecological security.
Smart Images

Figure CN120118924A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering. Specifically, the present invention relates to the herbicide-resistant gene cytochrome P450 gene CYP71AF43, the protein encoded thereby, a vector, and their application in enhancing the herbicide resistance of crops by expressing them in crops. Background Art
[0002] In the process of modern agricultural development, the popularization of the direct seeding planting mode has made the prevention and control of farmland weeds a key link to ensure high and stable yields of crops. Especially in the paddy field ecosystem, the high physiological and metabolic similarity between gramineous weeds and rice will compete with crops such as rice for fertilizer, light, and nutrients, resulting in a serious decline in crop yields. Due to its characteristics of high efficiency, low toxicity, low cost, and convenience, it is often used in herbicide control. However, in the long process of traditional plant breeding and domestication, its core objectives mainly focus on improving crop yields, improving quality, and enhancing the resistance to common pests and diseases. Therefore, in the natural genetic resource treasure house of nature, gene resources that can naturally endow plants with resistance to various herbicides are extremely scarce. This makes it difficult for traditional natural genetic resources to directly provide sufficient gene support for cultivating herbicide-resistant crop varieties when facing the increasingly severe weed damage and herbicide application dilemmas in modern agriculture. At present, by targeting and inhibiting key genes with herbicides and then screening for endogenous resistance mutants, it has become an important strategy for developing herbicide-resistant germplasms of staple crops. For example, using the EMS mutagenesis technique to treat the target gene ALS of imidazolinone herbicides, practical resistance resources have been successfully obtained and shown significant chemical weed control advantages in varieties such as "Jinjing 818". However, most of the endogenous resistance loci of common herbicide target genes such as EPSPS, ACCase, ALS, and HPPD are monopolized by foreign commercial giants through patents. At the same time, the long-term single use of specific herbicides has led to the rapid spread of weed resistance in the fields, and the effectiveness of traditional resistance resources is decreasing day by day. Therefore, exploring new herbicide-resistant genes and introducing heterologous metabolic genes through transgenic technology to shape herbicide resistance characteristics are crucial for cultivating new herbicide-resistant crop varieties.
[0003] Aryloxyphenoxy propinoate (APP) herbicides are widely used in the global agricultural field due to their high efficiency, low toxicity, low residue and broad-spectrum herbicidal activity. There are about 20 commercial products on the market. The global sales of this type of herbicide in 2014 were 1217 million US dollars, accounting for 4.6% of the total herbicide sales. Fenoxaprop-p-ethyl belongs to APP herbicides. It is a systemic selective herbicide. Since the late 1980s, fenoxaprop-p-ethyl has been used in wheat fields in the Yangtze River Basin of China and has become the leading agent for controlling grass weeds in wheat fields. Due to the long-term and single use of this agent, the resistance problem of grass weeds to it has become increasingly prominent in recent years. The dosage increases in a vicious cycle during field use, and its residue in the environment will pose a potential threat to subsequent crops and non-target organisms, severely restricting its application scope and usage cycle. Therefore, cultivating grass crops resistant to APP herbicides is of great significance, which can not only broaden the usage boundary of such herbicides, but also effectively reduce agricultural production costs and improve agricultural production efficiency and ecological safety.
[0004] APP herbicides can inhibit acetyl-CoA carboxylase (ACCase) in plants. In the plant metabolic system, acetyl-CoA carboxylase (ACCase) occupies a core position. It can drive the carboxylation of ATP-dependent acetyl-CoA to generate malonyl-CoA. This substance is a key starting material for the biosynthesis of fatty acids and flavonoids, and then gradually combines to form fatty acid chains under the catalysis of fatty acid synthase. When ACCase is inhibited, the production of malonyl-CoA will be blocked, and the structural stability of the plant cell membrane will be seriously affected. The phospholipid bilayer composition of the cell membrane cannot maintain its normal state due to the lack of necessary fatty acid synthesis raw materials, resulting in an imbalance in the cell permeability and the inability to effectively control the entry and exit of substances into and out of the cell. Over time, the physiological environment inside the cell becomes more disordered, and ultimately the cell dies, seriously threatening the growth and survival of plants. In grass crops such as wheat and rice, mutations at some ACCase sites can reduce the sensitivity to APP herbicides, and the expression of the corresponding mutant proteins confers resistance to plants. However, patents related to these existing mutant sites have been applied for (such as Chinese patents: 112410308A, 109355264B). To improve the resistance intensity and gene diversity of transgenic crops, continuously exploring new herbicide-resistant genes and cultivating transgenic herbicide-resistant crops with them is still an urgent need in agricultural scientific research and production.
[0005] In the global field of agricultural biotechnology, the patent situation for herbicide resistance genes is severe. The endogenous resistance loci of key target genes such as EPSPS and ACCase are mostly monopolized by foreign companies. They rely on fine-tuning gene sequences and renewing "patent coats" to break through the 20-year validity period limit and monopolize the technology. In recent years, China has also obtained some patent authorizations for ACCase genes (Chinese patents: 109371000B, 109082416A). However, most of our patents are based on foreign core patents. If we want to industrialize transgenic technology, the "patent right of use" held by foreign countries is an insurmountable hurdle.
[0006] The present invention first discovered a variety of Alopecurus myosuroides with enhanced herbicide metabolism, then cloned a CYP450 gene CYP71AF43 using the information of its transcriptome sequence, and further demonstrated the herbicide resistance of the CYP71AF43 gene and its use in developing transgenic herbicide-resistant crops in transgenic yeast and rice callus. The present invention relates to a brand-new cytochrome P450 gene CYP71AF43, and its herbicide resistance has not been reported before the clarification in the present invention. Summary of the Invention
[0007] The primary object of the present invention is to provide a herbicide resistance gene that can be highly expressed in plants. This gene has excellent characteristics of efficient transcription and translation in plant cells and can highly express protein products with special herbicide resistance functions. The core goal is to introduce the gene sequence into the genome of target plants by precise and stable transgenic technology, and then carefully cultivate innovative transgenic plant lines with extremely strong tolerance to herbicides.
[0008] A cytochrome P450 gene CYP71AF43, the nucleotide sequence of which is SEQ ID NO:1 or a sequence having no less than 80% identity compared with SEQ ID NO:1.
[0009] The object of the second aspect of the present invention is to provide a polypeptide encoded by the nucleotide sequence of the said gene.
[0010] The object of the third aspect of the present invention is to provide a vector comprising an expression cassette formed by ligating the said nucleotide sequence molecule and a nucleotide sequence controlling expression.
[0011] The object of the fourth aspect of the present invention is to provide the use of the said cytochrome P450 gene CYP71AF43 or the said vector, by expressing the cytochrome P450 gene CYP71AF43 in plants through transgenic technology, so that the plants obtain the ability to resist herbicides.
[0012] Furthermore,
[0013] The herbicides described above include aryloxyphenoxypropionate (APP) herbicides, including but not limited to fenoxaprop-p-ethyl, haloxyfop-r-methyl, quizalofop-p-ethyl, diclofop-methyl, clodinafop-propargyl, metamifop, cyhalofop-butyl, etc.
[0014] The plants described above include rice, corn, soybean, cotton, wheat, turfgrass or forage grass.
[0015] The object of the fifth aspect of the present invention is to provide the application of the gene, polypeptide or vector described above in the breeding of herbicide-resistant transgenic plants.
[0016] The plants described above include: rice, corn, cotton, wheat, soybean, turfgrass or forage grass.
[0017] The object of the sixth aspect of the present invention is to provide a method for modifying plants: including using plant gene transformation technology to introduce an expression cassette formed by ligating the nucleotide sequence molecule described above with a nucleotide sequence controlling expression into plant cells, and then differentiating and cultivating them into corresponding transgenic plants, and the obtained plants have herbicide resistance.
[0018] The plants described above include: rice, corn, cotton, wheat, soybean, turfgrass or forage grass.
[0019] The object of the seventh aspect of the present invention is to further provide a system for rapidly detecting the sensitivity of an in vitro recombinant expressed protein to herbicides, and the steps are as follows:
[0020] (1) Recombinantly and operably ligate the sequence shown in SEQ ID NO:1 into a protein expression vector;
[0021] (2) Transfer the recombinant expression vector obtained in step (1) into a host cell;
[0022] (3) Induce the host cell to express a large amount of target protein;
[0023] (4) Dilute the host cell and spot it on a culture dish containing herbicide.
[0024] As a preferred embodiment of the present invention, the CYP71AF43 gene fragment of cytochrome P450 gene is ligated with the double-digested pYeDp60 using an IN FUSION (Takara, company) kit to obtain a pYeDp60 recombinant plasmid containing the cytochrome P450 enzyme gene.
[0025] That is, a recombinant plasmid containing the fenoxaprop-p-ethyl-metabolizing P450 gene CYP71AF43 described in the present invention.
[0026] As a preferred embodiment of the present invention, the constructed pYeDp60 recombinant plasmid containing the cytochrome P450 gene CYP71AF43 was transformed into Saccharomyces cerevisiae WAT11 to obtain a recombinant strain.
[0027] The CYP450 gene provided by the present invention, when expressed in plants, the protein encoded by its nucleotide sequence can confer resistance to at least one or more of the following herbicides: including but not limited to fenoxaprop - P - ethyl, haloxyfop - R - methyl, quizalofop - P - ethyl, diclofop - methyl, clodinafop - propargyl, metamifop, cyhalofop - butyl, etc. Using the herbicide - resistant CYP450 gene provided in the present invention, other homologous herbicide - resistant genes can be obtained by existing methods. For example, those of ordinary skill in the art can obtain these homologous genes by Southern hybridization or PCR methods. Further, those skilled in the art can obtain variants of this gene using existing techniques. For example, including but not limited to: 1) different nucleotide sequences obtained by using different codons for the same amino acid, and these sequences encode protein polypeptides with the same activity; 2) nucleotide sequences obtained by introducing variations in the nucleotide sequence but still encoding proteins with herbicide - resistant ability. Such variations can be random variations, targeted point mutations, or insertion or deletion mutations. Those of ordinary skill in the art can generate the above - mentioned variations by molecular biological methods. Transgenic plants into which these genes are introduced can be resistant to at least one of the following herbicides: including but not limited to fenoxaprop - P - ethyl, haloxyfop - R - methyl, quizalofop - P - ethyl, diclofop - methyl, clodinafop - propargyl, metamifop, cyhalofop - butyl, etc.
[0028] The present invention also provides a method for modifying plants: including functionally connecting the above - mentioned herbicide - resistant gene, promoter, and terminator by using plant gene transformation technology to form an expression cassette capable of expressing in plant cells. For example, when transforming monocotyledonous plants, the promoter can be the maize Ubiqutin - 1 promoter or the rice Actin promoter; and the terminator can be the Agrobacterium tumefaciens terminator (Nos) or other terminators. This expression construct can be integrated into the plant genome by Agrobacterium (such as Agrobacterium strains), gene gun methods, or other methods to obtain herbicide - resistant transgenic plants. Usually, it is introduced into immature embryos, mature embryos, undifferentiated callus, or protoplasts of plants through Agrobacterium or gene gun. The obtained plants have herbicide - resistant ability.
[0029] The present invention is applicable to all plants, including dicotyledonous and monocotyledonous plants.
[0030] Advantages of the present invention
[0031] In summary, the gene of the present invention can be used for expression in plants to endow the plants with the ability to be resistant to at least one herbicide, so that the herbicide can be used to selectively kill weeds. The present invention can also be applied to the breeding of crops and the screening of plant cell cultures. The present invention clarifies the resistance mechanism of weeds to herbicides, explores new herbicide resistance gene resources with complete independent intellectual property rights, and for APP herbicides, a brand-new autonomous gene cytochrome P450 gene CYP71AF43 is discovered. With this, high-quality herbicide-resistant crop germplasm materials are carefully cultivated, which have strong adaptability and good stability in multiple environments and have a significant effect on resisting herbicides, laying a solid foundation for the development of herbicide-resistant transgenic crops in China and helping to move towards the path of agricultural independent innovation. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] The following further elaborates on the specific embodiments of the present invention in conjunction with the drawings.
[0033] Figure 1 : Growth states of resistant (R-HB) and sensitive (S) Alopecurus myosuroides populations at the same dose of fenoxaprop-p-ethyl;
[0034] Figure 2 : Schematic diagram of the construction of the recombinant expression vector of CYP71AF43 protein expressed in Saccharomyces cerevisiae WAT11;
[0035] Figure 3 : Schematic diagram of the construction of the plant expression vector; the expression cassette (a) consists of a promoter, the Alopecurus myosuroides herbicide-resistant gene CYP71AF43, and a terminator;
[0036] Figure 4 : Detection results of the tolerance of the yeast strain transformed with the Alopecurus myosuroides herbicide-resistant gene CYP71AF43 to fenoxaprop-p-ethyl;
[0037] Figure 5 : Detection results of the tolerance of rice callus transformed with the Alopecurus myosuroides herbicide-resistant gene CYP71AF43 to fenoxaprop-p-ethyl. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0038] The following further elaborates on the present invention in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto. It should be understood that these embodiments are only used to illustrate the method of the present invention and not to limit the scope of the present invention. All experimental conditions not specified or experimental methods without special instructions are conventional conditions and conventional methods well-known to those skilled in the art.
[0039] Example 1 Resistance determination of Alopecurus myosuroides resistant to fenoxaprop-p-ethyl:
[0040] Alopecurus myosuroides Huds, commonly known as black grass, is an annual diploid cross-pollinated grass in the Poaceae family and is native to Eurasia. It is widely distributed in winter crop fields in Europe, especially winter wheat fields. In China, Alopecurus myosuroides is an invasive weed. Although the invasion time is relatively short, it has developed rapidly. The development of herbicide resistance has made it one of the most serious weeds in the agricultural field. Due to competing with wheat for water, fertilizer, and light, it poses a major economic challenge to the herbicide resistance of wheat. Using chemical herbicides to control weeds in wheat fields has improved the effect due to its advantages of simplicity, labor-saving, and time-saving. Therefore, over time, weed control in Chinese wheat fields has become increasingly dependent on chemical herbicides. This has led to an increase in the resistance levels of many noxious weeds in wheat fields, including Alopecurus myosuroides. To clarify the herbicide resistance level of Alopecurus myosuroides to fenoxaprop-p-ethyl, the sensitivity level of the collected Alopecurus myosuroides biotypes to fenoxaprop-p-ethyl was studied using the whole-plant assay method. The results showed that the collected resistant Alopecurus myosuroides biotype R-HB could grow normally at the recommended field dose of fenoxaprop-p-ethyl, and its median growth inhibition dose (GD 50 ) value was 149.40 g a.i. / ha; while the GD 50 value of the control sensitive Alopecurus myosuroides biotype S was 5.59 g a.i. / ha, and the relative resistance multiple reached 26.73-fold( Figure 1 ).
[0041] Example 2: Cloning of the resistance gene
[0042] In nature, conclusive evidence of a plant's resistance to fenoxaprop-p-ethyl is the possession of the fenoxaprop-p-ethyl target enzyme ACCase gene, that is, mutations at the relevant sites of the target enzyme ACCase reduce the sensitivity of fenoxaprop-p-ethyl to it, thereby obtaining resistance. The target enzyme resistance mechanism of the resistant fenoxaprop-p-ethyl population was studied. Nine plants were selected from each of the resistant and sensitive populations for cloning of the acetyl-CoA carboxylase (ACCase) fragment of the fenoxaprop-p-ethyl target enzyme gene, and the cloned gene sequences were compared. The results showed that compared with the S population, there were no target enzyme mutations in the R-HB population, indicating that this population has no target enzyme resistance mechanism.
[0043] Transcriptome sequencing technology was used to obtain transcriptome data of two populations of *Alopecurus myosuroides* (R-HB, S). When statistically evaluating the quality values of the sequencing, it was found that the base Q30 was above 90%, indicating that the sequencing quality was very reliable and the sequencing results were successful. Further analysis of the gene expression levels after assembly found that there were a total of 192 differentially expressed genes between R-HB and S, and genes related to non-target resistance were identified. Using the RNA samples of the transcriptome sequencing, 1 differentially expressed gene related to non-target resistance was found and verified by fluorescence quantitative PCR. The results showed that compared with the sensitive population S, the cytochrome P450 gene (CYP71AF43) was always highly expressed in the resistant population R-HB. Using the total RNA of *Alopecurus myosuroides* extracted as a template, it was reverse transcribed into cDNA using the HiScript II cDNA First Strand Synthesis Kit (Vazyme, company). According to the CDS sequence of the CYP71AF43 gene predicted by the transcriptome, two specific primers were designed (F: ATGGCGCAACAAGATCAGGAT, R: TAGGAATCCATCGGCACACG), and full-length amplification was carried out using the high-fidelity 2×PrimeSTAR Max Premix (TaKaRa, company). The amplification conditions were as follows:
[0044] Conditions:
[0045]
[0046] The target PCR product was purified, recovered, cloned, and sequenced, and finally the sequence of the CYP71AF43 gene of *Alopecurus myosuroides* (SEQ ID NO: 1) was successfully obtained
[0047] Example 3 Construction of an overexpression vector of the CYP71AF43 gene and determination of the sensitivity of transgenic calli to herbicides
[0048] 1) Construction of the recombinant expression vector of the CYP71AF43 gene. Specific primers containing the homologous arms of pYeDp60 were designed (F: CTAAATTACCGGATCCATGGCGCAACAAGATCAGGAT, R: ATCCCCCGCGGAATTCTAGGAATCCATCGGCACACG). After the target fragment was amplified from the T-cloning vector and purified and recovered, the expression vector pYeDp60 was digested with EcoRI and BamHI and the gel was recovered. Through the IN FUSION (Takara, company) kit for ligation reaction, the amounts of the recovered target fragment and linearized pYeDp60 were 1:1, and it was recommended to be 50 ng - 100 ng each.
[0049] Ligation reaction system:
[0050]
[0051]
[0052] React at 50 °C for 15 min.
[0053] After the ligation reaction, transform Escherichia coli competent cells, sequence the plasmids that can amplify the expected target fragment, and finally obtain the recombinant expression vector ( Figure 2 ) was transformed into the Saccharomyces cerevisiae WAT11 strain by the lithium acetate transformation method. Coated on a plate containing 50 mg L -1 ampicillin to obtain recombinant transformants.
[0054] 2) Screening of herbicide-resistant transgenic yeast and determination of its sensitivity to herbicides
[0055] Cultivate the recombinant strain in SD-Ura medium until OD 600 = 1, after centrifugation, change the medium to SG-Ura medium, and incubate the yeast cells in SG-Ura medium containing different concentrations of fenoxaprop-p-ethyl at 4 concentrations (OD 600 = 10 -1 、10 -2 、10 -3 and 10 -4 ). The negative control was WAT11 containing GFP, and incubated at 28 °C for 3 d. The results showed that: 1) Compared with GFP, the CYP71AF43 overexpressing transgenic yeast grew better at a concentration of 180 μm of fenoxaprop-p-ethyl ( Figure 4 ).
[0056] Example 4 Construction of CYP71AF43 gene overexpression vector and obtaining of transgenic herbicide-resistant rice
[0057] 1) Construct a CYP71AF43 gene overexpression vector.
[0058] Design specific primers (F: TGTTACTTCTGCAGGATGGCGCAACAAGATCAGGA, R: CGGATCCATAACGCGTAGGAATCCATCGGCACACG) to amplify the full-length sequence of the target gene from the T-clone sequencing vector, and use a high-fidelity enzyme ( Max DNA Polymerase, TaKaRa) for PCR amplification and purification to obtain the AmCYP71AF43 fragment with pox homologous arms.
[0059] Meanwhile, the overexpression vector pOX was double digested with Thermo FastDigest enzymes (FastDigest KpnI: 5'G G T A C↓C 3' and FastDigest MluI: 5'A↓C G C G T 3'). The specific implementation steps were as follows: Add 2 μL of 10X FastDigest Green Buffer, 1 μL of FastDigest KpnI, 1 μL of FastDigest MluI, 1000 ng of pox plasmid into a PCR tube, and make up to 20 μL with sterilized water. After reacting at 37 °C for 5 minutes, the linearized vector was purified.
[0060] Subsequently, the AmCYP71AF43 fragment with pOX homologous arms was mixed with the linearized vector pOX, and then the ligation reaction was carried out using the In-Fusion Snap Assembly seamless cloning kit (Takara). After the ligation reaction, it was transformed into DH5α Escherichia coli competent cells (Qingke). The plasmid with the expected target fragment amplified was subjected to sequence determination, and finally the overexpression vector pOX-AmCYP71AF43 of the full-length expression sequence of the Alopecurus myosuroides AmCYP71AF43 gene was obtained ( Figure 3 ).
[0061] 2) Transformation of the overexpression vector pOX-AmCYP71AF43 into Agrobacterium tumefaciens.
[0062] Place an ice box in the laminar flow hood, and put the air-dried electroporation cuvette, 1.5 mL centrifuge tube, YEP liquid medium, and Agrobacterium tumefaciens competent cells (EHA105 chemically competent cell, Qingke) in the ice box;
[0063] Take 1 μg of the overexpression plasmid and add it to 100 μL of Agrobacterium tumefaciens competent cells, and gently pipette and mix; transfer it to the electroporation cuvette, add it to the gap of the electroporation cuvette, and quickly electroporate in the conductivity meter; add 1000 μL of YEP liquid medium and quickly pipette and mix, and transfer it into a 1.5 mL centrifuge tube;
[0064] Cultivate at 28 °C and 180 rpm for 3 h, centrifuge at 4000 rpm for 3 min, and remove 800 μL of the supernatant;
[0065] Aspirate 100 μL of the remaining liquid in the centrifuge tube onto the YEB solid medium, and spread it evenly with a glass rod. Add (100 μL of Kana (50 mg / L) + 100 μL of Rifampicin (Rif) (50 mg / L)) to every 100 mL;
[0066] After 2 days, pick single colonies for PCR verification, and enrich the successful single colonies in YEP liquid medium (add the same concentration of antibiotics).
[0067] 3) Screening of resistant calli and determination of the sensitivity to fenoxaprop-p-ethyl.
[0068] Using the seeds of rice variety Zhonghua 11 (ZH11, a rice variety bred by the Institute of Crop Science, Chinese Academy of Agricultural Sciences) as materials, after removing the glumes, the seeds were disinfected with 75% ethanol for 1 minute, and then thoroughly washed with sterile water for 3 - 5 times. Subsequently, the seeds were added to 2.5% sodium hypochlorite and a drop of Tween 20, placed in a 50 mL centrifuge tube and shaken at 200 rpm for 15 min; this step was repeated twice. The rinsed seeds were washed several times with sterile water in a laminar flow hood, blotted dry with sterile filter paper, and then placed on N6D medium for dark culture at 28°C. After 3 weeks, dense callus particles were selected for transformation. Calli that were light yellow, dense and growing vigorously were used as materials for Agrobacterium transformation. The overexpressing Agrobacterium was cultured in 50 mL of YEP liquid medium containing antibiotics for 2 d, centrifuged at 3500 rpm for 10 min, the supernatant was discarded, and the Agrobacterium was resuspended with 40 mL of AAM (+8 μL of 100 mg / mL AS), and the OD600 value was measured to be between 0.6 - 1.0; the calli were infected with the AAM bacterial solution for 2 min; the calli were taken out with a sieve, placed on sterile filter paper to blot dry and air-dried; the air-dried calli were placed on 2N6-AS solid medium and cultured in the dark at 28°C for 3 d. After 3 d of co-culture, the calli were washed several times with sterile water, blotted dry with filter paper, and placed in N6D medium for subculture (adding antibiotics: 1 mL of hygromycin (50 mg / L) + 1 mL of cefotaxime (250 mg / L) + 0.6 mL of ticarcillin (200 mg / L) per liter of medium).
[0069] Determination of the herbicide resistance of transgenic calli: The co-cultured calli were placed on a screening medium containing hygromycin (50 mg / L) and cultured in the dark for 14 days, and then transferred to a freshly prepared screening medium for continued screening for 14 days. From the resistant calli that grew after two rounds of screening, light yellow and dense resistant calli were selected for the herbicide tolerance experiment. Using the transgenic rice calli with pOX-GFP overexpression as a control, the resistance of the transgenic rice calli with pOX-CYP71AF43 overexpression to APP herbicides (fenoxaprop) was observed. The results showed that: 1) Compared with GFP, the growth status of the CYP71AF43 overexpressing rice calli was better at the concentrations of 2, 4, 8, and 16 μm of fenoxaprop-p-ethyl. It was indicated that CYP71AF43 could endow rice with resistance to fenoxaprop-p-ethyl ( Figure 5 ).
[0070] Finally, it should also be noted that the above-listed are only several specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and there can be many variations. It should be pointed out that for those of ordinary skill in the art of this technology, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
[0071] The present invention uses the culture medium and the SD-Ura culture medium formula
[0072]
[0073] SG-Ura culture medium formula
[0074]
[0075] His / -Leu / -Trp mixture (100X)
[0076]
[0077]
[0078] YEP liquid culture medium formula
[0079]
[0080] YEB solid culture medium formula:
[0081]
[0082] N6D culture medium formula (callus induction and growth medium):
[0083]
[0084]
[0085] N6 vitamin formula
[0086] AAM culture medium
[0087] 2N6 culture medium (without AS)
[0088]
[0089] Concentration of antibiotic working solution:
[0090]
[0091] Sequence Listing
[0092] SEQ ID NO:1
[0093] ATGGCGCAACAAGATCAGGATATGCTGTACTACTACCTTTATTCCAGTGTCG
[0094] TCTTGGCGACCATCGTCCTAGTTCCTCTCCTGCTCGTTAAGCTCAGGCCAG
[0095] GCAACAATCACGGCAGAAACCCTCCACCGGGGCCATGGCAGCTGCCGGTG
[0096] ATAGGAAGCATGCACCACCTCGCGGGCGCCCTCCCGCACCACGCCATGCG
[0097] GGACCTCGCCCGGAGGCATGGCCCCCTCATGCTGCTCCGTCTCGGCGAGCT
[0098] CCGTCTCGTCGTGGCCTCGTCGGCCACGGCGGCGAGGGAGGTGACGAGAA
[0099] CCCATGACGCCATCTTCGCCACGCGGCCCCAGACCGCCACAATCAAGACG
[0100] CTGACAAGGAACGGCGTCGGCATCGCCATGGCGCCGCAGGGCGAGCAATG
[0101] GCGCCAGGCTCGCATGCTCTGCGTCAACGAGCTGCTAAGCGCGCGGCGGG
[0102] TGCGCTCACTCCAGAGCATCCGCGAGGCCGAGATCGCGAGGCTCGTGGCG
[0103] TCCCTCGCGTCCGACTCGGGAGCGTCTCGCGGCCAGCCCGTGAACGTCAG
[0104] CTCCCACATTGCCGCCTACTCCAACAACTCGGTGGTACGCGCCGCGATGGG
[0105] CGACCGGATGACAGACCGTGACGGCTTCCTGGAGTGCATGGAGGAGGGCG
[0106] TCAAGGTGGCCGCTGGGTTCAGCCTGGCGGACCTGTTCCCATCGTGGCGCC
[0107] TCGCGCGCTCGTTCAGCGGCACGATGCGGCGGCTGGAGGCGGCTACCAGC
[0108] CGTATGTTGTGTGTCATGGACGGTGTCATCGAGGAGCATCGCACGAGGAGG
[0109] TCAGCAGCCGGCATTGGCCACGAGGAAGATGACCTCCTGGATGTGCTTCTG
[0110] AATTTCCAGAAGGACGGGGCGCCTCTCCCCATAGGAACCATTCGTGCCATG
[0111] ATCATCGATTTGTTCGCGGCCGGGAGCGAGACCACGGCGTCGACGCTCCA
[0112] ATGGGCCATGGCGCAAATGATGCGTAACCCGAAGGTGCTCGGCAGGGCGC
[0113] AGGCGGAGGTGCGCAGCGCCCTGGCCGGGCAAAGCCGTGTCCGGGAGGA
[0114] GGTCGTGCCAGAGCTGCGCTACGTGCAATTGGTGATCAAGGAGGCGCTGC
[0115] GCCTGCACCCGGTGGCGCCGTTGCTCCTCCCGCGGGAGTGCCAGGAGCCG
[0116] TGCCGTGTTCTTGGCTACGACGTGCCCGAGGGCGCCATGGTATTGGTAAAT
[0117] GCGTGGGCGATGGCTCGGGAAACCGCGACTTGGGGCCCCGACGCCGAGG
[0118] AATTCAAGCCGGAGAGGTTCGAGGACAGCGCATGTGCCGCCTTGGACTTC
[0119] AAGGGGAACGACTTCCAGTTTCTGCCTTTTGGCTCGGGCAGGAGAATGTG
[0120] TCCTGGAGTGATGTTCAGCATCGCTGTCATGGAGCTCGCACTAGCAAGCCT
[0121] CCTTTTCCATTTCGACTGGGAGCTTCCCATAGGCACCGCTCCGGCTGAGCT
[0122] GGACATGGAGGAGGTGCTTGGGATCACGGCAAGGAGGAAGAATGATCTCT
[0123] GGCTGCATGCCACCCTTCGTGTGCCGATGGATTCCTAG
Claims
1. A cytochrome P450 gene CYP71AF43, characterized in that: The nucleotide sequence is: SEQ ID NO: 1 or a sequence having an identity of not less than 80% with SEQ ID NO:
1.
2. A polypeptide encoded by the nucleotide sequence of the gene according to claim 1.
3. A plasmid, characterized in that: An expression frame comprising the nucleotide sequence molecule according to claim 1 connected to a nucleotide sequence for controlling expression.
4. The use of the cytochrome P450 gene CYP71AF43 according to claim 1 or the plasmid according to claim 3, characterized in that: By expressing the cytochrome P450 gene CYP71AF43 in plants through transgenic plants, the plants can acquire the ability to resist herbicides.
5. The use according to claim 4, characterized in that The herbicide includes aryloxyphenoxypropionate esters, and further includes fenoxaprop-butyl.
6. The use according to claim 4, characterized in that The plants include rice, corn, soybean, cotton, wheat, turf grass or forage grass.
7. Use of the gene according to claim 1, the polypeptide according to claim 2, or the vector according to claim 3 in breeding herbicide-resistant transgenic plants.
8. The use according to claim 7, characterized in that: The plants include: rice, corn, cotton, wheat, soybean, lawn grass or forage grass.
9. A method for transforming a plant, characterized in that: The method comprises using plant gene transformation technology to introduce the expression frame comprising the nucleotide sequence molecule in claim 1 and the nucleotide sequence controlling expression as described in claim 3 into plant cells, and then differentiating and cultivating the cells into corresponding transgenic plants, wherein the obtained plants have herbicide resistance.
10. A system for rapidly detecting the sensitivity of in vitro recombinantly expressed proteins to herbicides, characterized in that: Here are the steps: (1) Recombining the sequence shown in SEQ ID NO: 1 into a protein expression vector; (2) transferring the recombinant expression vector of step (1) into a host cell; (3) Induce host cells to express large amounts of target proteins; (4) Dilute the host cells and spot them on a culture dish containing herbicide.
Citation Information
Patent Citations
Herbicide-resistant ACCase mutant gene and protein and application thereof
CN109082416A
A rice ACCase mutant gene and its application in plant herbicide resistance
CN109371000B
Application of rice ACCase mutant gene and protein thereof in plant herbicide resistance
CN112410308A
P45071D8 function influencing rice plant types and salt stress tolerance and application of P45071D8
CN107418937A